mummified fairy remains found!!!
01 Apr 2007 2,089 Comments
in April Fool's, Blogroll, Christianity, Fans, Fantasy, Historical, Hoaxes, Holiday, Humour, Politics, Religion, Science, Supernatural, Weird, environment, fairies, humor
This is totally legit.
In news bound to rock doctrinaire Evolutionistas everywhere, another set of ancient fairy remains has been found. Assiduous readers of the ol’ raincoaster blog will recall our original reporting on the fossil fairy of Coney Island, which we broke to the larger world several months ago, much to the consternation of the scientific orthodoxy.
Now comes breaking news from Derbyshire, via Neatorama, that the mummified remains of several authentic flower fairies have been located in a barrow somewhere in the countryside. The exact site is being kept secret for obvious reasons; there is no knowing what shameful lengths the charlatans in lab coats might go to in order to erase this stunning blow to their orthodoxy.
The proof is undeniable:
The 2inch remains complete with wings; skin, teeth, and flowing red hair have been examined by anthropologists and forensic experts who can confirm that the body is genuine. X-rays of the “fairy” reveal an anatomically identical skeleton to that of a child. The bones, however, are hollow like those of a bird making them particularly light. The puzzling presence of a navel evne suggests that the beings reproduce the same as humans despite the absence of reproductive organs.
Well, I’d like to see what the “scientific community” can set against that kind of proof, eh? Try your darndest, you godless heathens! Just look at that photo; it’s even got a Police Evidence Bag and latex gloves! You can’t get much more official than that! Ha! I say again, HA!















Apr 01, 2007 @ 11:37:11
The Ha! you say. Well, this is certainly unusual to say the least. I think you might be on to something here. So, I say Ha!
Apr 01, 2007 @ 17:06:13
That bears no resemblance whatsoever to Quentin Crisp! Fraud!
Apr 01, 2007 @ 19:27:57
Brilliant!
Apr 01, 2007 @ 19:56:13
Did you see the big news on the BBC: “Photographs of a mummified fairy supposedly found in Derbyshire have been revealed as an April Fool’s prank.”
Oooh. Heavy hitting reporting there boys. Go get thee some high paying jobs at Yahoo.
Apr 01, 2007 @ 20:34:12
Oh, just as I was getting excited :-/
Apr 01, 2007 @ 22:09:04
The Beeb has lost all credibility, and this is just the final nail in the coffin. Naturally, the lapdog of the establishment would seek to discredit a find of such magnitude; it could shatter their carefully-constructed NeuLab world.
I hope that all readers will join me in a boycott of the BigBrotherCompany until such time as they admit their part in the cryptocracy which keeps much of the so-called “free world” in chains!
Clap your hands!
Apr 01, 2007 @ 22:49:40
Oh yeah. I’m always hitting those things with my car out on the heath. They make a real mess of the windscreen.
Apr 01, 2007 @ 22:54:15
See, finally a use for squeegee people. Who wants to deal with that mush themselves? Also: corroboration! Who would not take the word of someone named “analglyph”?
Apr 02, 2007 @ 21:30:20
Hey. Ease up on the ‘anal’.
Apr 02, 2007 @ 22:17:37
If I had a dime for every time I said that…
Apr 02, 2007 @ 23:40:22
You’d have $17.05.
Apr 02, 2007 @ 23:55:22
At the very least. And that’s just YOUR account.
Apr 04, 2007 @ 17:47:28
I hate to be daft but…is this for real? Or humor?
Apr 04, 2007 @ 20:39:07
Of course fairies are real! You wanna kill off Tink or something?
Apr 12, 2007 @ 10:46:50
I do(nt) belive in faries!!
This is a lame prank. It looks real, but pranks like this are old!
Apr 12, 2007 @ 10:48:12
I do(‘nt) belive in faries!
Pranks inolving faries are nnoying. And boring, if your gonna prank at all, make it new!!
Apr 12, 2007 @ 10:51:09
Gee, Cthulhu isn’t nearly as great as I expected.
The acolytes are gonna be bummed!
Apr 20, 2007 @ 19:40:18
that thing looks real.and freaky. but, i think that fairies should stay in our imagination.
Apr 20, 2007 @ 20:09:09
But what happens to them when they die? This poor fairy was obviously unloved.
Clap your hands!
Apr 24, 2007 @ 20:23:22
I DO believe in fairies!! I do believe in fairies! I do believe in fairies!!!
Yes – and I DO believe in Santa, the Tooth Fairy and her sidekick the Tooth Mouse, not to mention the Easter Bunny!!! (this is what happens when one has little kids in their lives!!!)
Apr 24, 2007 @ 22:38:55
The Tooth Mouse? Do tell. I would hate to think I’ve left one out of the pantheon.
Apr 25, 2007 @ 04:39:27
I believe in fairies, too, Tanz. In fact I’m getting my hair fixed by one tomorrow.
Apr 25, 2007 @ 04:40:10
Yeah, what is a tooth mouse?
Apr 25, 2007 @ 07:04:21
Which reminds me to get my hair cut. Can’t afford to get the teeth done yet, and my dentist is straight anyway. Come to think of it, he IS a bit mousy.
Apr 27, 2007 @ 19:49:23
The Tooth Mouse! Heck yes, he deserves to be in the temple too Raincoaster!!! In fact, I think he’d prefer a tooth encrusted one!!!
Apparently, according to folklore and bits and pieces handed down the ages, the Tooth Fairy used to be a mouse!!!! The mouse turned into a fairy to help the good queen defeat the evil king by hiding under his pillow and knocking all his teeth out!
Yip – macarbre I know, but hey – isn’t that where all fairy tales find their origins?? Sugar coated horror stories from centuries gone by!!
So, you see Stiletto, queens and fairies abound!
Apr 27, 2007 @ 23:04:26
Yeah, and don’t neglect the Organ Transplant Goblin, either.
Him, you really don’t want to piss off.
Apr 28, 2007 @ 00:20:03
No, that’s why I make all those sacrifices of tourists!
Thanks for the tooth mouse backgrounder. How did I get through most of a degree in comparative literature and folk tales without knowing this?
Apr 28, 2007 @ 10:23:07
Goblins and Fairies aside, new to all ‘dis’ blog-readin’ and have to say that I have found your blog a fascinating read Raincoaster!!! And yours too Metro. I admire the time it must take you to put it all together!!!!
BTW it really is quite interesting what one can find on Wikipedia these days!! No almost degree needed for that! :-)
Apr 28, 2007 @ 12:54:23
Thanks. All compliments gratefully accepted; when Great Cthulhu rises and the Earth is cleared off, you will be eaten first, a high honour indeed!
Apr 28, 2007 @ 20:28:38
OMG – but not before I go totally mad I take it!!!
Apr 28, 2007 @ 20:34:30
Exactly! You learn fast, young Grasshopper.
Apr 28, 2007 @ 21:30:04
Gwash!! Awww – thanks!! Grasshopper eh! That brings us to another tale!! You know, the one about the grasshopper that only wanted to play and live it up all summer long, scoffing at the hardworking little ants along the way – then come winter -he was stuck out in the cold and who took him in … none other than the very same hardworking lil’ bitty ants, that’s who!
And the moral of that story is ….
Apr 29, 2007 @ 03:49:58
The moral of that story is: Learn your invertebrate biology. Grasshoppers only live one season.
Apr 30, 2007 @ 03:35:20
I guess that’s my cue to bow out ‘gracefully’ – catcha on da waves ‘R’ !!
Apr 30, 2007 @ 05:40:40
Nobody hangs around here long without getting a dose of da attitude. Tough it out and stick around.
Apr 30, 2007 @ 20:07:35
What’s wrong with your teeth, Raincoaster? The tooth mouse take them all?
May 01, 2007 @ 04:20:11
Apparently so. I shall go buy myself a new pair of fangs soon.
May 11, 2007 @ 09:49:55
this is amazing!
May 11, 2007 @ 10:55:47
Don’t miss the fossil fairy too!
May 11, 2007 @ 14:32:19
Hair, teeth, if I were a hairdresser or dentist I’d offer my services for free.
Not sayin’ it’d be any good but I’d still try my best.
May 11, 2007 @ 23:50:27
Hey, they’ve done wonders with Cher!
May 22, 2007 @ 11:56:31
just imagine, all this time we thought fairies were just imaginary, and they turn out real, so that means sum1 would had to have seen one before and passed down the tale, meaning any imaginary creature could actually have lived! i cant quite picture a heap of giants roaming aroud though….
May 22, 2007 @ 11:59:34
They’re very stealthy. Mostly nowadays they are in the US, playing professional basketball. It’s all true!
May 26, 2007 @ 09:57:50
the “fairy” looks real but it still isnt enough for me to think they are real and that they do exist sorry
May 26, 2007 @ 09:59:20
How can you say that? Every time you doubt, God kills a fairy! Why do you think he took Liberace away from us? EH?
May 26, 2007 @ 10:01:16
well i need scientific proof that they do exist i’m so sorry
May 26, 2007 @ 10:01:56
but that picture does look pretty real
May 26, 2007 @ 10:14:31
Hey, they’ve got the police evidence bag and everything. Maybe it was a murder!
Also, don’t neglect the corroborating evidence:
http://raincoaster.com/2006/11/24/pic-o-the-day-fossilized-fairy/
May 28, 2007 @ 23:32:18
i do beleive in fairy’s!!! and dont forget unicorns and murmaids and stuff, i beleive they just died cuz noone beleived in them… but i dont think the mummified fairy is real cuz if fairys were real there bodies wouldnt be left behind because that will kill the meaning of “beleiving in them” its cheating if you only beleive in things once youve seen them.
May 29, 2007 @ 04:35:46
But, don’t you believe in James Brown? And his dead body was all over CNN!
May 29, 2007 @ 04:37:09
Man, whoever did his mortuary work didn’t do that great of a job, I thought. But then, they didn’t have that much to work with I’m sure.
Just wait til Keith Richards meets his maker.
May 29, 2007 @ 05:35:20
Are you kidding? Alcohol and heroin are preservatives! He’ll look exactly the same when they dig him up in a thousand years.
May 31, 2007 @ 04:12:58
This is amazing!!!!! I am absolutly shocked I am so amazed that people found this increadable find!!
May 31, 2007 @ 04:13:31
Wow
May 31, 2007 @ 04:16:20
THIS IS SOOOOO WILD WITH A CAPITAL W !!!!!!!!!!!!!!!!
May 31, 2007 @ 04:39:09
Did you see the other one? Click on the links in the article.
May 31, 2007 @ 04:48:58
i believe the story might be fake but i also believe that faries exist.
May 31, 2007 @ 04:56:39
HOW CAN YOU SAY THAT?! If fairies exist, they most definitely would be all over Derbyshire. I hear it’s FULL of fairies.
May 31, 2007 @ 10:03:29
if there are fairies, there should be fairy dusts… wish peter pan would teach me how to fly with it i will go to derbyshire to grab one. Fly A-W-A-Y!
Jun 01, 2007 @ 01:27:40
I think you have to at least buy it dinner first.
Jun 06, 2007 @ 10:26:03
faires do not believe u stupid dick fucks
Jun 06, 2007 @ 10:32:44
oh and also they could of found the bag and the “wings” look like leafs i get and they body could just be fake so ask yourselfs dat
Jun 06, 2007 @ 10:41:33
kelly, you’re right. Fairies do not believe you: I asked them.
mr smuggles, are you saying you collect leaves that look like fairy wings? How remarkable. I ask myself dat all the time…or is that “I axe myself”?
Jun 07, 2007 @ 08:36:52
well i find the leaves were i am now u STUPID DICK FUCKER AND ALSO THE BODY COULD BE MADE OUT OF CLAY SO FUCK DAT
Jun 07, 2007 @ 08:38:05
SO SHOVE IT UP UR VIGINA OR DICK MOTHER FUCKER CUNT
Jun 07, 2007 @ 08:38:18
fairies are not true if u think that they r ture you r a dick fuckers and the wings look like leaves and the body looks like a brunt barbie doll
Jun 07, 2007 @ 08:38:20
*VIRIGINA
Jun 07, 2007 @ 08:39:45
so raincoaster get a life and dont be a naked masterbating fucker
Jun 07, 2007 @ 08:42:32
u r a DICK LICKER if u think fairies r true and its a burnt BARBIE DOLL with LEAVES ON THE BACK.
Jun 07, 2007 @ 08:52:01
Dear Mister Sums/Smuggles/Whateveryoucallyourselfnextwhenyou’repretendingtobetwopeople, also known as | eujg@hotmail.com | — | IP: 58.7.76.51
Well sweetheart, ONE of us needs to get a life, that’s for sure.
Jun 07, 2007 @ 14:58:47
u r a DICK LICKER if u think fairies r true and its a burnt BARBIE DOLL with LEAVES ON THE BACK.
Hey! I resemble that remark!
http://eatmyfuckingstilettos.files.wordpress.com/2007/05/march07athshot1.jpg
So eat shit Mr Sums!
Jun 07, 2007 @ 15:09:48
Holy shit, so you do! If that’s not fate, what is?
Also, impressive lats!
Jun 07, 2007 @ 16:05:51
Thank you, Rain! I know how you feel about personal links but I thought it was a perfectly and irresistibly suiting response to his post!
Jun 07, 2007 @ 16:30:31
I’m cool with links as long as you’re not popping in once in your lifetime just to drop a link to an unrelated post on your own site. I know you’re not a spammer, no issues there.
And that was just too perfect.
Jun 08, 2007 @ 00:39:43
couldn’t you all just be quiet! I wanted to believe!!
Jun 08, 2007 @ 01:14:53
We believe! It’s those others who are nay-saying! Look, Stiletto Girl is even living the dream in tattoos and costume!
Jun 09, 2007 @ 01:45:46
well im sorry to hurt your feelings but hey we’re in the real world and you have to get used to it so im sorry raincoaster and also do u know a girl called veirty i dont know how to spel her name correcrly but please inform me if you do
Jun 09, 2007 @ 01:47:44
oh and also were are two different people
Jun 09, 2007 @ 01:50:27
please tell me if you know this girl her name is veirty
Jun 09, 2007 @ 02:00:11
are u there raincoaster
Jun 09, 2007 @ 04:06:22
I know someone named Verity, but I very much doubt that is the person you’re talking about, as she lives in Mexico.
Those posts were done from the same ISP, and the person input exactly the same email address. Either they were both the same person or you have a stalker, sweetie.
If you live in the real world, you really should be more realistic. Do I know your friends? I rather doubt it.
Jun 09, 2007 @ 04:10:25
Fairies may be fiction. Trolls on the other hand …
Grotesque little thing isn’t it? I love how it’s trying to talk like a normal human being.
Jun 09, 2007 @ 04:23:02
um shes my bf and i told her about it and she put in a fake email adress like me
Jun 09, 2007 @ 04:29:34
um how do I know you’re telling the truth? Verity says you’re a liar.
Jun 09, 2007 @ 10:42:48
where i am veirty is a 12 year old girl
Jun 09, 2007 @ 10:43:42
are u der raincoaster
Jun 10, 2007 @ 02:59:00
why arent you answering raincoaster?????????????????????????????????????????????????????????????????????????????????????????????????????? scared
Jun 11, 2007 @ 08:03:16
Because I have better things to do than hang around the internet in case some trolls in the comment section happen to be demanding my attention.
Now that you’ve annoyed me, you should be MUCH MORE afraid.
Jun 17, 2007 @ 06:27:52
y should i be afaraids
Jun 17, 2007 @ 07:54:55
What’s an afaraid? I don’t believe in afaraids.
Jun 18, 2007 @ 01:39:59
Every time someone says i do(“nt) believe in Fairy’s one dies.
So that is why this poor little fairey has died. I DO BELIEVE IN FAIRIES
It looks real enough for me, so I think it is true.
Jun 18, 2007 @ 03:09:46
AMEN.
Jun 24, 2007 @ 12:46:19
http://news.bbc.co.uk/1/hi/england/derbyshire/6514283.stm
The person who actually designed this host has openly admitted to it.
“Former Derbyshire resident Dan Baines, 31, who designs illusions for magicians, made the fairy as a prank.”
Here is Dan Baines’ personal website: http://www.lebanoncircle.co.uk/DeadFairy.htm
Jun 24, 2007 @ 23:50:11
Oh yeah, sure. That’s what he told them on-camera. I’ll be it’s a different story when he’s walking through the woods alone in the dark. You’re sooooooo gullible!
Jul 05, 2007 @ 17:52:36
I know they could have lived just like any other “creature”. It is believable and I always did believe. And of course still do. Easy to prove someone right, hard to prove someone wrong in this case.
Jul 06, 2007 @ 02:03:10
Wow If they get a hair sample from it what result of animal did it say it was??? wouldn’t it say that the animal was unknown
Jul 06, 2007 @ 04:27:29
Of course we know what it was: It was a fairy!!!
Jul 10, 2007 @ 10:08:28
police bag and gloves could just be used as a prop to make it look like a more realistic situation.
Jul 15, 2007 @ 12:05:36
This is reli gd ! Mi frined actually thought it was real ! Ha ha aha aha aha aha ha ha ha ha ha !
Jul 15, 2007 @ 21:28:20
Have your friend discuss it with claire up there. She’s a hateful doubter!
Jul 18, 2007 @ 00:08:29
¡¡¡¡NO SE QUE DECIR!!!!!
Jul 18, 2007 @ 00:49:16
JESSICA, WHY ARE YOU SHOUTING???
Jul 18, 2007 @ 13:21:25
Where do these people come from, Raincoaster? That’s it, I’m going to prank you one day.
Jul 18, 2007 @ 16:30:03
ohhh come on.! is that real???;-$
Jul 18, 2007 @ 21:02:21
Of COURSE it’s real. It was on the BBC!
Jul 20, 2007 @ 11:34:32
Hey Raincoaster!! Long time no chat! Amazed to see the fairy debate continues!! Wow – and some really, “um” poetic, eloquent …. comments up there! Guess it all keeps the blog alive, eh!
And, yes – I do still believe in fairies. Funny. I usually say I only believe in what I can see with my own two eyes, and yet, as far as fairies go – I believe? Huh!
Jul 20, 2007 @ 11:35:41
Well I see them all the time around here. You’re just not staying up late enough!
Yes, the fairy debate continues, although slower. I expect most of the fairy commenters are in the lineup for the Harry Potter book at the moment.
Jul 20, 2007 @ 20:54:22
Thats some crazy shit! Never seen any thing like it!
Jul 21, 2007 @ 10:45:41
i think its fake but i do belive in faries and wen i searched for “real faries” they showed that pic and they said “real fairy found NOT ! ! !” it might be real it might not be u never know love, o:-)
Jul 21, 2007 @ 10:46:51
i stay up all night
Jul 21, 2007 @ 10:48:51
THEY SHOULD X RAY IT AND SHOW A VIDEO ! ! ! !
love, o:-) lol
Jul 21, 2007 @ 10:50:42
Bellas right I DO BELIVE IN FAIRIES I DO I DO I DO I DO I DO ! ! ! !
Jul 21, 2007 @ 10:55:22
CASEYS ALSO RIGHT BRING BACK THE MAGICAL CRITERS SAY I BELIVE IN FARIES,UNICORNS,AND MERMAIDS I ALREADY DID SO U SAY IT
Jul 21, 2007 @ 11:02:44
WELL I THOUGHT IT
Jul 21, 2007 @ 11:03:46
its not a burnted barbie doll cause it has ribs ! ! ! ! ! if u dont think im right look at it again
love, o:-)
Jul 21, 2007 @ 11:05:31
they could of found it and it barely had wings so they removed it and put leaves on it and Mr. smugglers ur a dick licker cause u dont belive in it so ha i say again HA one more time HAAAA ! ! ! :-P
Jul 21, 2007 @ 11:10:54
i mean mr sums sorry mr smuggler i got it mixed up :-*
Jul 21, 2007 @ 11:12:54
dont say u dont bbelive in faries just say i “think” there not real I BELIVE IN FARIES I DO I DO
Jul 26, 2007 @ 10:04:47
WTF?! no way…..!! O_O
Jul 26, 2007 @ 10:15:27
Like, WAY!
Jul 26, 2007 @ 17:18:58
lol it looks like a doll the way the hands are all straight… kinda like in grand theft auto their fingers are always stuck together they dont move individualy…
if you look at the close up and look at the hand it looks like… ok if you make a model car sometimes you have to shave off extra plastic from the parts and thats what it looks like between the thumb and finger
just saying
Jul 30, 2007 @ 13:28:06
If you believe in God then you have to believe in fairies.
Fairies are elementals they are of the lower realms of angels.
Us as humans, God has given us gardian angels, now fairies are the same but they are the gardians of animals and plants.
Now I really dont care wether you believe me or not but I’ve seen a fairy, not like a little person with wings but a big ball of light floating through the room.
It’s very sad if you dont believe in Angels, as they sure do help you out a lot.
Jul 30, 2007 @ 13:51:57
That’s from the Gospel of St. Timothy Leary, isn’t it?
Jul 30, 2007 @ 14:46:48
this is LAME
Jul 30, 2007 @ 22:39:51
Sooooo, your comment fits perfectly!
Aug 01, 2007 @ 23:28:02
fairys are real ok u can think whatever u wannna think there still real if u ppl took the time to study about them u would believe but u dont because ur all stupid all the ppl that DONT believe there real and i dont care what all u ppl say there real and thats it period done
Aug 01, 2007 @ 23:38:02
ive seen a fairy too and if u think im stupid whatever if u think ur a hot shot saying ohh this is stupid bla bla bla bla thats ur opinion not mine or any of the other ppl that believe in them there real creatures god put them on this planet for a reason to make this planet a better place. the fairys arnt little with wings like natalie said and shes right they are a ball of light i was sleeping in my room when it tuged on my hair and the most likely time of night which is june 23 is the most likely time of night to see a fairy and when that happend it was june 23 and no it wasnt a rat i have no rats in my house its been searched and theres none.
Aug 01, 2007 @ 23:41:18
Why is June 23 most likely?
Aug 02, 2007 @ 16:33:29
I`d like to see the X-rays mentioned, a C-14 test, a DNA examination and Histology of teeth and skin.
That would be areal proff.
Aug 02, 2007 @ 23:42:15
Well, do you think they’re going to release blockbusters like that into the public realm? I bet they’re waiting for a book deal.
Aug 03, 2007 @ 04:37:27
OMG – you people are so daft. This is totally fake. If it were real, why do we not have it in the museum? Instead is is placed as “police evidence” and posted all over the net.
Get real people!
Aug 06, 2007 @ 16:13:12
no it cou;d be real thats why its being checked out at the police stastion. and when they know that if its real or not then they will deside where it should go. any way i think its real. cause how could someone make something that with it showing ribs or the teeth !?
Aug 06, 2007 @ 20:12:06
Of course it’s real. The only place you see people who look like that is in zombie films, or The Mummy. Mummies are real–you can see some in museums, right?
And everyone knows zombies are real: it’s commonly known in Hollywood that during the filiming of Day of the Dead , George A. Romero had two houngan medicine men on the set making the legendary “zombie’s cucumber” paste for making people into the living dead. He also employed teams of men to comb the local cafes and diners for desperate young actors, whom he kidnapped, buried alive, and then had made into zombies.
Asked later why he resorted to such methods, he commented that he was straining his budget, and this was a great way to get around paying Actor’s Equity scale, as AE refuses to represent zombie talent, Ryan and Reeves notwithstanding.
Of course the subsequent street protests and riots by his exploited workforce were simply filmed and presented to the unsuspecting public as part of the movie. News outlets were suppressed and all zombie-related activity was dismissed by the mainstream as a publicity stunt, including the legendary Million-Zombie March.
This is at least as factual as the sad history of zombie protest.
UNDEAD RIGHTS NOW!
Thank you.
Aug 07, 2007 @ 01:01:14
Metro is the Norma Rae of Cryptotheology.
Aug 12, 2007 @ 02:42:10
they could have at least made the leaves not so…. leafy…
Aug 12, 2007 @ 02:49:50
Wait for next silly season. We’ll see Fairy 2.0 I doubt not.
Aug 15, 2007 @ 04:49:55
wow i havent been on this thing in a while hello peoples… :D the people who do belive in faries good who ever dont U SUCK !!!!!!!!!!!!!!!!!
thank you
Angel O:-)
Aug 15, 2007 @ 05:41:25
Would an angel have said such a thing? Go wash your mouth out with Seraphim Soap!
Aug 17, 2007 @ 15:02:50
wel how come things like this are never found in countrys where they orionate like ireland when was the last time someone actualy reported something like that there the myths are still alive there and things are constantly being found but they are never given the chance to be much more than a romour they just seem to disapear americans are the only people who seem to actualy find anything so im a little bit sceptical for that reason
Aug 17, 2007 @ 22:02:30
You’re not allowed to be skeptical until you can spell “Originate” and learn enough folklore to realize that the fairies of England are not the same as the Little People of Ireland. Sheesh! Don’t even get me STARTED on Scotland and the Redcaps.
Besides, look at the URL: these people are not Americans. They are Lebanese, duh.
Aug 21, 2007 @ 01:10:17
Erm… He he… Well, I’d say that someone is very good at making little dolls look like mummified fairies.
Sorry, people, I’d like to believe as much as the rest of the world, but hey, facts are facts.
Aug 21, 2007 @ 02:30:45
The fact is, “hope,” that this looks more like a mummified fairy and less like any doll I’ve ever seen. Facts is facts: which does it resemble more to you?
Aug 21, 2007 @ 03:02:24
I honestly truely KNOW it’s a fake. If fairies were real, they wouldn’t be called “fairy tales” now would they?
Aug 21, 2007 @ 03:11:31
So now you’re claiming that fairy tales are fake, too? Talk about conflation!
Aug 22, 2007 @ 00:58:33
I think that athiests made them up to give God NO credit what so ever. Wasn’t it he that made everything in seven days? The people who didn’t believe that God was real, they made up fairies to make a point, we can’t see God but we can’t see fairies either. Humans are cowards, we don’t like to think we’re alone, so our minds automatically find a reason to think that we aren’t alone, so again, that’s probably why lonely people made up the creative creature.
Aug 22, 2007 @ 06:22:14
You’re a fairy agnostic? How can we believe anything you say, then? You can’t see fairies the same way you can’t see God, so your skepticism is strangely selective.
Aug 25, 2007 @ 17:48:02
shut up!!
fairies are real and so is that!!
thank you =]
Aug 25, 2007 @ 19:38:33
That may be true that i’m a fairy agnostic, and I haven’t seen God BUT I have felt him and sensed him and I have NOT sensed or felt a fairy. . . and I would like to believe in fairies, I love fairies, they’re beautiful, whimsical pieces of art. . . but that’s the sad thing, they are just lovely art, nothing else.
Aug 25, 2007 @ 23:44:22
Aw hell – everyone knows the only mummified fairy was Quentin Crisp!
Aug 26, 2007 @ 04:13:51
fur: you can’t prove any of it. And I have both sensed and felt fairies. They’re all over my neighborhood, in fact, generally dressed in designer jeans.
Aug 26, 2007 @ 07:51:03
I would have to say this is Quite Interesting…I cant really say that I Believe this Photo But yet yu never know what is Really out there we are not alone in this Universe…
Aug 26, 2007 @ 07:52:31
Indeed. Hard to prove fairies don’t exist…or someone would have done it by now, eh?
Aug 26, 2007 @ 23:44:27
whoever doesnt beleive in fairys is wrong fairys are very much of a real person just extra small and has beautiful wings…!
i do beleive in fairies,i do,i do
Aug 27, 2007 @ 01:45:32
Don’t listen to the h8ers.
Aug 27, 2007 @ 02:04:59
This post is going to be older than the hills if it keeps on going like this!
Aug 27, 2007 @ 02:23:37
Well, all I know is that it’s probably more fun trying to find some sign of wee winged folk than it it to find some semblance of sense and humanity in the world today.
Hey, that haunted house thingie is starting to fit really well today . . . .
Aug 27, 2007 @ 02:29:39
Are you the ghost of a fairy, FFE? Formerly Fairy, EEK!
Aug 27, 2007 @ 02:32:58
I can disprove that assertion easily and with the full agreement of all fairies – I have no taste in clothes, interior decorating or furnishings. And I look like shit in a bustier, ballet slippers and wings – you haven’t seen me handling any Disney World advertising chores, have you? Eh? Eh?
Aug 27, 2007 @ 03:07:38
Prove it. Upload some pix.
Aug 27, 2007 @ 16:14:59
ican’t bleave that fairys are real i thought they were just a mith but it looks so life like so i am going to say SWEET!!!!!! but i do know that giants were real awhile ago but i never knew this was real.!!!! i would like to know if i was a fairy in my past life. well cool
Aug 27, 2007 @ 18:16:56
wow, it looks really real, but im not sure if it is real, i thought faries where a myth but this has convinced me enough to tell all my friends!
Sep 01, 2007 @ 04:41:53
WOW!! they are real…my grandmother still doesnt beleive it! shes soooo stubborn….I would like info on how to get a job lookin for things like that faires and such…its so facinating.e-mail me to let me know how to start ajob like yours!
nikkiv16@rock.com
Sep 01, 2007 @ 04:43:19
wow they are real!!! i really want to know how to get a job finding fairies and fossiles…that is awsome!!
Sep 01, 2007 @ 05:42:34
I’m not sure there’s a living in it. You could search Monster.com…hey, there’s gotta be a connection, don’t you think?
Sep 02, 2007 @ 14:52:25
WOW THATS SO COOL!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Sep 02, 2007 @ 16:01:37
Lemme guess – you’re using this post as spammer bait, right? Or else it’s become a focal point for some new-wave Dark Ages?
Sep 02, 2007 @ 23:36:34
No, I just like trollbaiting. 166 comments and counting…the WordPress record is 500, but this was only posted in April. I want to see where it goes from here.
Sep 10, 2007 @ 09:42:37
omg lol
if this is real its surtainly unusual and fairly freaky lol
z
Sep 10, 2007 @ 09:44:02
Indeed. If it’s a fake, it’s so good it deserves to be famous anyway!
Sep 12, 2007 @ 03:51:17
DAMN THAT LOOKS REAL BUT I STILL LOVE FAIRIES AND FARIES SHOULD STILL BE IN OUR IMAGENATIONS;)
Sep 12, 2007 @ 04:09:12
And our gardens’ bottoms!
Sep 12, 2007 @ 09:42:39
First blog ive ever read, not much of a reader, not much of a fairy believer to, but this kind of evidence could make Mr.Roger’s shit a brick. But then again, i think its real cos you have to believe in it, i mean come on, with out fairytales about dragons,fairys,and all the other sparklely bullshit, people would stay in a world with george bush as a president….now tell the truth wouldnt you want dream of fairys instead of hearing george bush and watchin Carlos Mencia stupid ass on television every nite? i pick fairys, cos GW is a retard and CM isnt mexican…
Sep 12, 2007 @ 16:05:52
i think the story is fake at first i thought it was real im pissed because i do truly belive in fairies and many other ppl do as well i think it is a mean april fools joke to the people who do belive and i am going to laugh one day when someone does find a real one!
Sep 12, 2007 @ 16:41:03
also to the hoaxer whom made this fairies arent all cute they are very hostile vicious creatures who dont take to kindly to humans and i hope you never run into a real one because you wont even know wut hit you i assure u they are real and if you dont belive me go walking into the woods at night alone and lsten for there bells i know ppl who have truly seen them whether u belive me or not BEWARE OF THE FAIRIES
Sep 12, 2007 @ 22:01:36
“Whom???” Back at your schoolwork, young lady!
Sep 17, 2007 @ 00:49:02
Actually, this hoax was created by a magician’s artist. He creates incredible artwork, but he himself said that it was all a joke.
Very well put-together, but all fake. Check it out on Snopes.com
A lot of people say that he’s just saying its a prank to get less publicity. i say, hey, believe what you will. Everyone could use a little magic now and then, right?
Sep 17, 2007 @ 01:04:59
Snopes…I’ve already debunked some of their bunk. We all know about Snopes ’round these parts. We do not listen to the unbelievers!
*claps hands*
*sez yeah*
Sep 17, 2007 @ 16:48:38
wow i bet you didnt expect this much attention when you published it. I love fairies i think they’re awesome. I can’t beleive how angry people are getting on here! That split personality Smuggles dude/chick got dead pissed off and then wanted your help on spelling! Fricken hell! Some people are wierd and come on you guys! Some of you relly need to learn how to spell!!! A fourteen year old can spell better than you! (and i know cause i’m the 14 year old who can spell better than you) :P lots of love
Ashmee
Sep 17, 2007 @ 20:40:37
Let me add to the chorus:
They certainly are real. Not a day goes by that I don’t have to shake one out of the ashtray out on the porch, or clean the mush out when they fly into the fans, or pull one away from the cat (those little bones are hollow and light, but they can cause havoc in a cat’s oesophagus).
Oh–and it’s kinder and cleaner to spray them. Unless you get them on the first blow, you wind up having to step on their heads, which is tricky while they’re flopping around trying to get airborne again.
In fact, they seem to have overpopulated the area, and if anyone can help me find the hive and kill the queen, I’d appreciate some advice right here in this thread.
Sep 17, 2007 @ 23:08:39
i think it’s CGIed it can’t be real…..can it?
Sep 18, 2007 @ 02:45:31
Metro, I think Shakespeare wrote a play about that.
Emily: of course it’s real! They’ve even got a police evidence bag!
Sep 18, 2007 @ 03:11:34
A police evidence bag?
You mean, like a rape kit?
Sep 18, 2007 @ 04:17:51
No, the whole thing was IN the police evidence bag. So it was evidence. I guess they were investigating whether or not it had been murdered. You can see it in the pictures.
Sep 18, 2007 @ 18:01:38
Well I am still skeptical. Since when was hair preserved? If it were not for the hair I would believe this. Where is this supposed to have been found anyway?
Sep 18, 2007 @ 18:19:07
@SG
Surely it would be a very sloppy investigation if they didn’t check to see whether it had been raped as well as murdered?
Sep 18, 2007 @ 22:57:25
Actually, hair decomposes very, very slowly. That’s why zombies still have most of their hair.
Metro, a good point.
Sep 18, 2007 @ 23:02:20
Everything I learn I learn from Law & Order. Scary, huh?
Sep 18, 2007 @ 23:10:32
There are worse places to get your information. You’re better off than those American Idol addicts.
Sep 21, 2007 @ 07:45:51
Sorry to break this to you guys but this is fake, some guy made it as april fools joke and sold it on ebay. nice try tho.
Sep 21, 2007 @ 07:52:37
It’s pathetic the way you lot make these outrageous claims without any proof. You’d think you’d pay a bit more attention to the facts, which are conspicuously absent from your post. Where is your corroborating material? All I see are claims.
Sep 21, 2007 @ 16:05:54
please don’t take away all my dreams, of course fairies are real… BELIEVE
Sep 26, 2007 @ 20:06:43
I am a roman catholic woman. And although fairies are not spoken of in the church (as I am sure that they have considered fairies part of the ‘occult’) – I DO NOT consider myself to be a robot of a council of secretive men somewhere in the hills of Rome who ‘decide’ around a long table discussion, what is right for me to believe. In fact, I just so happen to believe in a God who is capable of creating ANYTHING HE WANTS, and that includes FAIRIES. And after combing through other religious texts, it is noted quite often that God is capable of doing ANYTHING HE WANTS, WHENEVER HE CHOOSES to do so. Now, without reading any further, can any of you who comes from any religious or spiritual background argue with that last statement?
I mean, when you think of the vastness of the universe, who the heck are ‘we’ to say what can exist or not? Don’t forget, that we, too, were once ‘thoughts’ breathed into existence by the awesomeness that is GOD. Having said that, if an innocent child (or an adult, for that matter) ‘thinks’ they exist, then what is stopping God from choosing to grant that miracle? Oh yeah, I forgot- Because in a round-about-way, some of you said He can’t.
We are arrogant to think that HIS AWESOMENESS stopped with ‘us’. The same wonderful ‘us’ that kills, steals, gluttons, rapes, and even chooses to turn away from Him. Do you think He is satisfied only in His creation of ‘us’? Why can’t we believe that He is capable of creating things of beauty such as fairies?
Just because we can’t always see them, doesn’t mean that they are not there. Most religious texts speak of angels. Yet I’ll bet most of us have never seen one. Does that also mean that they, too, do not exist?
I heard somewhere that fairies can only be seen by the pure at heart – a gift from a God who has been abandoned by the rest of us caught up in the rat race of life.
Look, I know, we all have to grow up sometime. I am 31 years old. I am a successful business woman. Back in my University days, I studied world religions, psychology, and philosophy. But growing up doesn’t mean we have to curse at others with foul language like the ones in this forum who ‘chose’ to speak poorly and condemn those whose hearts still beat with a faint innocence.
Don’t you think that life would be that much more easier if you choose to believe that anything is possible at the hands of God? It’s not about who’s “too cool” or who’s “too childish”. What it really comes down to is it’s a matter of choice: Do you believe, or don’t you believe, in a Great God? Well, because I NEVER question God’s awesomeness, I choose to believe…. that fairies EXIST.
Sep 26, 2007 @ 20:24:05
By the way, I’m not sure why a lot of you are huffing and puffing over this particular mummified fairy having ‘leaves’ for wings. Being an avid fairy follower, I have learned that fairies come with a variety of wings – Butterfly wings (most common), translucent and irridescent wings (like a dragonfly’s), and wings that resemble ‘leaves’ for ambiguity. They are, after all, nature’s angels.
And, although I am not quite sure about the authenticity of the photos, someone here mentioned it would be more believable had the corpse had no hair. Well, having studied Egyptology, I can tell you that hair in a mummified state can remain well preserved. Even after the body has long been decayed.
Sep 26, 2007 @ 22:11:24
Well said, Shanara:
“I believe, and there is nothing that can convince me otherwise. No argument, no question, no fact.”
I believe fairies are just as real as God is, and that those among us who are Believers are a unique breed. Thank you so much for your affirmation of my belief!
It is also true, and I know this from personal experience, that hair on a head can be preserved even after soft tissues such as the brain inside that head have long since rotted away.
Sep 26, 2007 @ 22:14:27
That’s true: baldness is the least of your problems.
Sep 26, 2007 @ 23:54:04
True: and blondeness the least of yours.
*mwah*mwah*
Sep 27, 2007 @ 03:27:09
At least I’m a REAL blonde.
Sep 27, 2007 @ 18:43:17
My cousin kathy knows everything there is to know about fairies, she would know if this was real or not..she has fairies all over the place. She is a fairy!!! go Kathy, tell us…is it real???????
Sep 27, 2007 @ 19:05:36
well my cousin seems to think i know what this is, well im thinkin its not a fairy,im thinkin its a demon from hell, they float around to make people do stupid things this one just got caught in the physical realm….hows that glenna?
Sep 27, 2007 @ 19:08:34
Wow, a demon?!? I’m going to ask my shrink!
Sep 27, 2007 @ 21:43:33
It is a truth universally acknowledged that a young man in possession of a good fortune must not be in need of a Fairy, especially a dead Fairy from Derbyshire, the est of Counties
Sep 28, 2007 @ 01:38:18
He can usually find them at retro dance clubs, from what I hear.
Oct 01, 2007 @ 13:02:09
i have seen fairys with my freinds and i am 10 i belive and so should YOU
Oct 01, 2007 @ 17:15:24
i think its kinda creepy but itz belivable i am 12 and i do(nt)belive in fairys lol is it true or not ?????????????????????????
Oct 02, 2007 @ 22:18:53
no one has pruf that fiarys are made up but now we have pruf there real why are all of you stell not beliving!!!
Oct 03, 2007 @ 02:30:30
Because you’re not using the power of the spell checker. USE THE FORCE!
Oct 04, 2007 @ 23:11:10
omg- might eb copy right or a fake but ill test it for now i dont know weather or not to belive but ther has bin evadence befor so yea…if it is fake itz a very good fake then xD
Oct 04, 2007 @ 23:28:56
Yes, and deserving of a post on its own, wouldn’t you say?
Oct 05, 2007 @ 03:29:08
THIS IS SO BULL I DON’T BELEAVE THAT THIS IS REAL.GOD SAID NOTHING ABOUT FARIES IN THE BIBLE. COME ON PEOPLE IF THERE WHERE FARIES WHY CAN’T YOU FIND THE LEFT OVERS OF A DRAGON OR A UNICORN OR EVEN A FOSOLLISED DRAGON EGG? WHATS WRONG WITH YOU!!! DON’T TAke AWAY PEOPLES DREAMS OF TINK!
Oct 05, 2007 @ 03:48:31
ICANT HEAR YOU CAN YOU SHOUT A BIT LOUDER?
Oct 05, 2007 @ 11:40:17
Isn’t Kant spellt with an initial “K”, not IC
I’m sure Kant would have believed in a Fairy discovered in Derbyshire – after all, he believed in the Autonomy of Human Theoretical Thought
If you can’t believe an ENGLISHMAN, who can you believe ?
Mr Brown and Mr Blair don’t invalidate this – they’re Scotchmen
Oct 05, 2007 @ 12:54:13
I would not dare to tell Englishmen what they could think of this.
Because God knows…It wouldn’t do any good.
Some day I’m sober I will post the justification for Kantian Teleologism, which should be impossible which is not.
Seriously,wait for it. I’ve been working on it for 20 years/
Oct 05, 2007 @ 13:15:42
Mr G. EAGLE: I am not yet ready to reveal my reasons for Kantian teleologism so I cannot, as yet, support efforts to explain Kantian deontologism. I would hope that you have patience…
Oct 05, 2007 @ 17:46:42
I’m placing a wager that this comment thread reaches 300 by the end of November. What say you?
Oct 05, 2007 @ 18:48:20
@Stiletto
It might. But RC shouldn’t expect any help from me.
Oct 05, 2007 @ 21:57:35
I never do.
Oct 06, 2007 @ 11:13:30
Mais peut-etre le Monsieur Metro will favour (err … favor) us with his prediction as to whether this thread will attain 300 hits before or after or (as the case may be) simultaneously with Senor FFE telling us what happened to poor PeeWee or (in the alternative) with a certain Marchionesse’s striking 1 million hits
Tot siens
G E
Oct 06, 2007 @ 11:38:07
I’m behind schedule. I should have hit it at the end of September, given the pace I was at this summer.
Thank GOD for Britney sex tape rumours. I can rely on the pervs: they at least will never desert me!
Oct 06, 2007 @ 15:11:09
No, we never will, Raincoaster! We do not always comment but we are always watching! When your ship is about to sink it is us who will throw you a life raft!
Oct 06, 2007 @ 16:46:55
Better drowned than duffers
If not duffers, won’t drown
Unfortunately for this Fairy, it had not the requisite life-raft, but fortunately for Believers, its remains were preserved in the anoxidant liquid of a deep Derbyshire Lake
Oct 06, 2007 @ 19:57:54
I do consider myself non-dufferential at the very least.
Oct 16, 2007 @ 08:02:32
Poor Tinkerbelle has not aged well at all. The years have not been kind.
Oct 16, 2007 @ 09:41:02
She obviously bought the cheap drugstore moisturizer, poor thing. And Disney didn’t give her much of a pension after all this time, either.
Oct 17, 2007 @ 16:22:00
I beleive that this is real, no matter what the so called “creator of the remains” released to the public. I know that taxadermists create things like this all the time that looks unbeleivably real (e.g., the remains of a ‘jackalope’ or ‘winged cats’) but i just can’t beleive anyone would do this as a prank. surely the man realised that such a discovery would have set off a series of horrable events twords any living specimins caught, and put such off as a prank. kind of noble, yet unbearably stupid on his part. The world needs to realise that beings such as faries, dragons, and seamonsters are evident in every cultures history world-wide, and that there is no connection between said cultures. this in itself provide sturdy evidence that the beings in question exsisted at one point in time or another.when you really think about it, it is entirely possible for faries and dragons to have evovled out of something just as human beings did- and just died out do to mankinds innability to let be what it doesn’t understand. Discovery channel made a program about dragons, and explained every aspect about them in rational, and physically possible terms- even the ability to breathe fire. so these things ARE and i repeat-ARE POSSIBLE. anyone who thinks that they aren’t should go and read a few science books- there are annimals that are “real” that are MUCH more bizzare than any kind of “mythiliogical beast”…
Oct 17, 2007 @ 23:19:28
Indeed, the Giant Squid was thought to be completely imaginary until a decade ago. Liberte! Egalite! Calimari!
Oct 18, 2007 @ 15:25:51
your unbeleivable(not in the bad way)
Oct 18, 2007 @ 20:47:01
But you’ve GOT to believe. Disbelief almost killed Tink…if people stop believing in me, what will happen???
Oct 19, 2007 @ 13:58:25
i love fairies and i don’t know if this is for real!!!
please tell me that it is very true!
Oct 19, 2007 @ 14:34:16
Yes, it is true, and if you send money to my PO Box all your dreams will be fulfilled.
Oct 22, 2007 @ 00:27:15
Wow you are all a bunch of fairies! hears one more towards 300
Oct 22, 2007 @ 00:32:39
i believe in fairies even though i have not been blessed with the sight of one. it matters not if this one is real it matters if you believe! thoughts are matter and you create all the time. so to all those who dont believe ha! they exist!
Oct 22, 2007 @ 00:34:16
yah shes a fairy for shur i bet!
Oct 22, 2007 @ 00:35:03
yeah well then your a fairy lover!!!
Oct 22, 2007 @ 00:35:59
oh yah i would deffenatly love that fairy jessi all night long i bet shed love it
Oct 22, 2007 @ 00:36:53
i love you too babe…
Oct 22, 2007 @ 00:39:13
gahh so my fiance loves me……….. shes still a fairy. i should know 8)
Oct 22, 2007 @ 00:41:00
i only come out at night, its safer that way. and now you are closer to 300 than you ever were before.
Oct 22, 2007 @ 00:41:56
yeah she comes out of the closet at night….. it scares me
Oct 22, 2007 @ 22:08:30
Y’know, it’s true, the more fairies you have, the closer you get to 300, or at least the cast thereof …
Oct 22, 2007 @ 23:55:06
Then I’m at the front of the lineup.
Oct 29, 2007 @ 21:48:41
I want to believe in fairies.. but it’s kind of hard in this dead world.. Not enough fantasy, not enough magic.. But in my so strong imagination (which I live in most of the time) there are many different creatures.. but not fairies, unicorns or gnomes.. Wonder why? I love them so much.. And they doesn’t even include my fantasy.. Which is on Andromeda.. With the whole Anime-world.. And me.. *dream*
Oct 29, 2007 @ 22:04:53
Why should Andromeda be fairyless? If it’s your imaginary world, go ahead and put them in there. It has atmosphere, right?
Oct 30, 2007 @ 00:42:53
You know, ya’ll should believe in the power of Raincoaster. This thread proves she will go on forever.
Oct 30, 2007 @ 02:52:16
Thank you. As does the one about the poisonous spider!
Oct 30, 2007 @ 23:24:02
Well is the fairy a male or female? Is it gonna be released to the public or what? Have you ever seen a live fairy?
Oct 30, 2007 @ 23:49:44
Not sure about the gender, but if you click on the Fairy category you’ll see the post about the finder trying to sell it on EBay.
Nov 01, 2007 @ 13:11:51
Her Grace la Marchionesse de WitchHampton under Buzzard de la Zouche “This is totally legit.”
Warum, warum, varroooommmm
Why does an anxious Citizen anxiously check his Wallet for his Credit Cards, upon hearing these menacing mots from a friend of Mesonychoteuthis hamiltoni
Nov 01, 2007 @ 22:28:04
I have no idea. Why, you can see the police evidence bag for yourself, and if you still doubt, you had the opportunity to purchase the remains on eBay. I can only conclude that doubters refused the opportunity to do so lest they be faced with the wrongness of the conclusions to which they have jumped.
Nov 12, 2007 @ 17:40:42
that is a littel sad. but it is cool that you found one.ever senc I was littel I whanted to be one.
I told you thay were reall
Nov 18, 2007 @ 19:28:31
I like fairies and tooth fairies yay if the tooth fairy is real then that thing is!
Nov 18, 2007 @ 19:31:42
you guys are such losers! That picture up top is so fake it’s not funny!
Nov 19, 2007 @ 18:14:26
Fake? Can you back that up with proof, buddy? I rather think you can’t.
Nov 24, 2007 @ 19:27:33
I am still very young, not even in my twenties yet. So i would believe in faries no matter what… and there is proof somewhere out there, we just cant open our eyes to see it. Pay attention, next time you gou out somewhere where its moist, or wet, like the reinforest, you might spot one. Trust me… :(
Nov 24, 2007 @ 19:31:59
You know my name i use, mystery girl, theres a purpose behind it. There are many mysteries out there. If we listen to the facts, we WILL fins them. Take fairies to be exact. Someone cant make something like them up! The photo of this fairy is very convincing, and now i believe in faries more then i did before… thank you for helping people realize the truth behind the “fantasy world” i’ll be checking around, so see ya soon…. maybe
Nov 24, 2007 @ 19:32:29
The reinforest? Are fairies into bondage?
Nov 26, 2007 @ 21:25:07
Faries do exist to all of those dumb asses out there the only reason why they stopped showin is cos people stoped believin in them and all of u ppl that think u r so high and mighty can all go to hell….
Nov 26, 2007 @ 21:55:51
There are lot of fairies down there, now that you mention it. Liberace, for one.
Nov 27, 2007 @ 22:27:23
Yeah, this does look really cool. I do believe in fairies and vampires and werewolves and mermaids. But what really very annoys me is that as soon as something like this comes up there is one annoying loser who has to put God in the picture frame, OH look what god did HE GAVE US A FAIRY CORPSE!!!!! God punished us by killing the fairies, yeah ok, give me a break. 200 hundred years ago people who believed in god would have tried absolutely everything to cover up the existence of something like this, because according to them humans were as high as it gets. Screw that. You just say God did this because it sought of been proven and you people dont like to look stupid, and im not an atheist, i believe in religion that remembers and loves nature, like the norse gods and ancient egyptian gods. But those were all desrted by those who sought to make up a story that would benefit man kind and not the world we live in. If anything will prove this science will, so leave the scientists ALONE (IM A TEENAGER AND I CAN SEE CLEARER THAN YOU). Juts let anyone love the fairies, prank or not, because its people like you that killed them in the first place.
Nov 28, 2007 @ 11:15:52
I will always believe in fairies raincoaster cos I live in Derbyshire and I’ve seen them. Those wings r totally fake though-they would have decomposed ages ago
Nov 28, 2007 @ 11:31:16
Hey raincoaster this is an amazin thing u got goin here but I can’t believe it goes on for so long-just about fairies, y can’t people just believe, they’re real!
Sarah r u Sarah Barrett?r u in Lower 5 G?
Nov 28, 2007 @ 11:34:08
Yeh, y, r u Ben Hunter? How cum ur not @ school?
Nov 28, 2007 @ 11:41:57
Yeh, y, r u Ben Hunter? This whole fairy thing is so weird, I no peeps say it’s not true but they haven’t proved it yet an I still believe (an not cos I’m catholic or anything)so mr smuggles an his bf can fuck off
Nov 28, 2007 @ 11:45:20
Yep, I’m off school cos I feel like it, I notice ur not in 2day either. I no u have better things to do an all raincoaster but r u here? stiletto? anyone?
Nov 28, 2007 @ 11:48:06
ur not symba from lion king u no ben an u could always talk to me about somethin like, I dunno, fairies?
Nov 28, 2007 @ 16:20:28
Is this real? I always thought fairies were supposed to be pretty little things that floated around like merry little nobs getting in the way and sprinkling fairydust in your hair. Bugger… that would be annoying. Anyway, if it was mummified wouldn’t it’s wings be, like, mutilated?
Nov 28, 2007 @ 19:12:34
This is a dried fairy; its wings dessicated rather than wither away, because of the unique properties of the immediate area in which it was found.
Zombie fairies; there’s a thought! Somebody call Romero!
Nov 28, 2007 @ 20:42:26
WOW!!!!! this is soooo real ..i cant believe that fairies are real! I will believe in them forever!!!
Nov 28, 2007 @ 20:49:31
hey are there fairies at Albany, New York or in the town of -Schuylerville?? please I need to known because I believe in faires and all my life i’ve been dreaming of seeing one, and making things that could be useful for them!! :)
Nov 28, 2007 @ 20:53:37
Your Grace
What do they teach children in these American Schools these days !!!
In Derbyshire (the best of Counties), everyone knows that fairies are indeed “pretty little things that float around sprinkling fairy-dust in your hair”, while they are alive
- at least, Derbyshire Fairies don’t go round eliciting disguised Anonymous Political Donations, from Property Developing Millionaires
BUT death brings on many changes for Fairies as for other Creatures
G E
Nov 28, 2007 @ 21:04:42
their not teaching us about fairies!!..but that would be pretty cool though!!:) I chose to believe in them! oh and just to tell you I know like verything about fairies and they DO NOT! go around srinkling fairy dust on your head! Fairy dust is only used for majic…they dont use majic on humans!
Nov 28, 2007 @ 21:39:31
Brooke, I can tell you’re not Irish. Read your Padraic Colum!
http://en.wikipedia.org/wiki/Padraic_Colum
Nov 29, 2007 @ 00:57:24
The reason one rarely sees such well-preserved fairy remains is that they are often significantly altered by their passage through the jet engine; or in the more rural areas the digestive systems of dogs and cats.
I had thought to encourage them to take up residence locally, perhaps even establish a breeding colony, by leaving out the traditional bowls of milk. However, this attracted more cats, which as I noted are death to fairies.
Seeking something sweeter, I eventually discovered ethylene-glycol-based antifreeze. While I haven’t sampled it myself, several resources assure me it’s quite tasty. I’ve been leaving it in a dish on the back porch for several weeks now, and the fairies are lapping it up at a rate of knots!
They have yet to establish a colony–in fact I have yet to catch one feeding. However the local predator population seems to have declined, which I regard as a hopeful indicator.
Nov 29, 2007 @ 19:30:25
Ah, now that’s using your noggin.
Nov 30, 2007 @ 04:14:18
Ok, this thread must die!
Nov 30, 2007 @ 08:32:48
… die ??
Warum + waroom = Varoom
[Y + Y = Booming Climate Change]
The Fairies will not go away because these Evolutionizing pScientific Materialists keep unleashing into the atmosphere Bowls of ethylene-glycol-based antifreeze, which (like Disguised Donations to the Labour Party) are hardly Carbon-neutral
G E
Nov 30, 2007 @ 15:43:46
hey…
well…
i got a shock!!!
i am really intrested in all these….
however i don’t think it’s true…
could you please send me to my e-mail adress some more details and evidence by the scients????
thank you so much anyway….
Nov 30, 2007 @ 19:46:39
yeah im not Irish, im French and part Indian!:)
Nov 30, 2007 @ 22:06:03
I’m too lazy to email people, and too stubborn to let this thread die before 300 comments! Onward! 500, I say! 500 or die!
Dec 01, 2007 @ 09:00:00
Your Grace
In the Life or Death of a Thread, it is important to ask the Right Question
It is the Right NUMBER that we should seek, not this nagging Anxiety for Evidence nor this worried speculation about the impact of ethylene-glycol-based antifreeze (“Fairy Booze”) on Canadian PermaFrost
Surely the Right Number is :
NOT 42
Nor “0, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 144, 233, 377, 610, 987, 1597, 2584, 4181, 6765, 10946, 17711, 28657, 46368, 75025, 121393 ……”
Inspired by the sagacious Guido Fawkes’ longest thread, I commend a number beyond :
71 x 5
Yr Grace’s obedt servant etc
G E
Dec 01, 2007 @ 09:06:45
Hmmmm, it’s been weeks since I visited Guido: has he been seeing a lot of action lately? I know the “Peter Hitchens vs ‘Peter Hitchens’” thread got over 200 comments.
Is he getting Italian mathematicians to comment nowadays?
Dec 01, 2007 @ 11:43:48
Her Grace la Marchioness de W under B de la Z
Your Grace
Here in the little Auld Country, Guido Fawkes is (as always) vastly worth a Visit
Senor Guido’s famous thread achieved the almost Magic Number of [(71 x 5) - 1]
Currently, Senor Guido is doing a brilliant Job over “DonorGate”, where our New Vicar (Herr Braun) is being embarrassed by (apparently) doubtfully reported/recorded Mega-Donations to his Working People’s Clerical-Party
I dinnae ken what all the fuss is about – I’m sure the US Republikans raise their Funds on a Grander, more Brazen & Shameless scale, without anyone complaining or suggesting that criminal offences are being committed
However, all this DonorGate fuss means that our Vicar has not been able to enact enhanced Protections, much-needed by Local Fairies – hence their mass-emigration to the Canadian Pacific Rain-Forests where so many are falling as premature prey to Tree Octopodia & Cats/Dogs and ethylene-glycol-based-antifreeze-Addiction
I have the honour (err… honor) to remain your Grace’s MatheMagically-challenged Servant etc
G Eagle
Dec 01, 2007 @ 19:57:29
Tree Octopodia would never prey on fairies if they had warm-blooded tourists to gnaw on! Send more!
Dec 03, 2007 @ 08:17:53
my god u guys r funnt as
Dec 03, 2007 @ 08:26:33
Please leave us another comment with your thoughts. Bring your friends, too! Only 21 more till we hit 300!
Dec 03, 2007 @ 09:01:01
Your Grace
Can (or is that a mis-type for Cant) seems not to have completed his Sagacious Komment
Perhaps the Britisch could fly out their Cabinet with all their assistants & other high-paid lackeys (err …. patriotic hard-working Public Servants, the best in the World)
Stressed & troubled folk would of course have to fly Business Class, if only to keep out Poor Seekers-after-Truth (“Journalists” like M Metro et Senor FFE) whose Employers don’t run to Business Class flights
They need the peace & quiet of such lovely Countryside to quietly co-ordinate how to Spin against the DonorGate misREPRESENTATIONS, away from the unWelcome observation of Gentlemen and (in these enLightened times) Ladies of the Press
However, having banned Fox-Hunting in Inglaterra (and at the stroke of a frivolous pen, destroying 250,000+ jobs in the UK Countryside despite its heavy levels of unEmployment) the danger is that they would eat raw Tree Oktopodia as a succulent delicacy, as alternative to Battered Panda Steaks
On reflection, perhaps we should get Mr Bush to send more Americkan tourists
Your Grace’s obedient servant etc
G Eagle
Dec 03, 2007 @ 09:12:14
I, myself, can‘t count. 15 to go!
There are 250,000 professional fox hunters in the UK? I had no idea!
Dec 03, 2007 @ 14:22:51
I think your Grace means 14 (or is it now 13)
Dec 03, 2007 @ 16:23:41
I’m given to understand that it’s, what?, 13 comments to go before you overtake the comments count set by Guido Fawks and his ‘Peter Hitchens’ thread?
And this thread is “proofs were brought forward and each, in turn, mocked. Fossilized fairies. Mummified fairies. Even, in the ultimate legitimization that Western society offers” So, no relation to the Guido thread then? Related Fairies? No related fairies.
I might be in error so I think it expedient to say absolutely nothing about Peter Hitchens or fairies or any relationship between the two.
Dec 03, 2007 @ 16:24:55
I just hope Peter Hitchens doesn’t drink Red Bull
Dec 03, 2007 @ 16:25:21
and I sincerely hope he isn’t dead
Dec 03, 2007 @ 16:26:02
Do ‘Mummified Fairies’ have to be dead?
Dec 03, 2007 @ 16:27:33
Anyway, I understand that fairies are annoying little sods full of mischief.
Dec 03, 2007 @ 16:28:03
They probably blog.
Dec 03, 2007 @ 16:29:41
Well I’ve done my bit and even got a warning message for it for posting too quickly which I thought was impressive considering I know sod all about fairies!
Dec 03, 2007 @ 17:00:04
That was some impressive spamming there!
I wonder what all these people expect to find when they google for it…
Dec 03, 2007 @ 20:20:55
I don’t know: Liza Minelli’s ex-husband?
Dec 03, 2007 @ 20:21:23
Three more, people…don’t fail me now!
Dec 03, 2007 @ 20:42:53
Liza Minelli’s ex-husband is a fairy??
Actually that I would believe.
Dec 03, 2007 @ 20:48:34
Which one of the many?
Dec 03, 2007 @ 21:10:18
At least two: that Broadway choreographer (who saw THAT coming, eh?) and David Gest, the wax figure.
Dec 03, 2007 @ 21:13:16
Ding, Ding, Ding! 300! Now where are my Spartans?!?!?!?!
Dec 03, 2007 @ 21:45:22
Your Grace
Noch ein grosser Sieg mit 301 Treffer
but
As Obi Ben Kenobi’s freond so sagaciously opined :
“There’s always a bigger fish”
Senor Guido’s thread ran to 354 posts !!!
Yr Grace’s obedt servant etc
G Eagle
Dec 04, 2007 @ 04:30:49
Hmmm… hard to tell whether this is real or not…
Dec 04, 2007 @ 04:34:01
G Eagle, now what am I going to do with this Champagne?
The record on WordPress is 500, I believe. I think it was Laurie Kendrick that had that.
Dec 04, 2007 @ 08:09:55
Your Grace
Well done
[sotto voce]One is reluctant to make any remark that might be construed as insulting to Spartans, but perhaps your Grace could be urged not to get too friendly with your Friendly-Neighbourhood Spartans
These were the Guys who used to shew such tender regard for their Wives that they murdered those babies who did not shew sufficient of the robust Potential of Muscular Christianity
and while some of our Better, most incisive Journalists struggle with their Employers’ Wise Judgments & Generous Remuneration packages
the Spartans used to (without warning) declare War & go round murdering their own Loyal & Quietly-Behaving Employees (“Helots” or in the 1860′s Confederate Vernacular – “Slaves”), just so that the Helots [Greek-Speaking yokels] would know they would get far worse if they ever chose to become revolting – eg by voting Democrat or supporting Leveller opinions or learning Latin
G E
Dec 04, 2007 @ 08:14:48
But, but, I was BORN revolting!
Dec 04, 2007 @ 09:49:54
Hee hee, brilliant Mr Eagle Sir :-)
Yeah I too was born revolting; revera linguam latinam vix cognovi.
Dec 04, 2007 @ 09:59:56
47 to go! We’ll get there!
Dec 04, 2007 @ 10:59:40
Easy peasy.
Incidentally, HWMNBN has published an apology from a correspondant at the end of todays post, the delivery of which to blog readers is so smug it’s vomit inducing. The apology makes the one painfully extracted from me look positively shy in it’s brevity. Can we send HWMNBN faeries for xmas? No. I should eschew these thoughts and sleep.
I know a bank where the wild thyme blows,
Where oxlips and the nodding violet grows,
Quite over-canopied with luscious woodbine,
With sweet musk-roses and with eglantine:
There sleeps Titania sometime of the night,
Lull’d in these flowers with dances and delight;
And there the snake throws her enamell’d skin,
Weed wide enough to wrap a fairy in
Dec 04, 2007 @ 11:16:22
You COULD Scrooge him, if you felt like it.
http://www.scroogeyourself.com/
Dec 04, 2007 @ 12:02:55
Oh that’s brilliant I love that, thanks. Best not send him anything though it just invites bile by return – I just delete his emails now without reading, it serves for a much happier life. He has got my phone number, eek!
Ellee Seymour has a post: ‘Publish and you are damned!’ about unfortunate blog posts and I couldn’t resist this comment:
And as if by magic we can see an apology for a blog post published on Peter Hitchens’ blog at the end of todays post about the film The Golden Compass.
The presentation of this apology to blog readers is so smug it’s vomit inducing. But do not imagine that I do not admire his skill with words, and my personal admiration for him is positively Shakepearian in it’s poetry; like that of Titania for Oberon. But when he launched the strong voice from his chest, and words came driving on the air as thick and fast as winter snowflakes, then, as Odysseus, he could have no mortal rival as an orator!
Sadly I do not have the beauty of Helen of Troy but, it seems, all of the effect.
Dec 04, 2007 @ 13:08:17
Cooee, Raincoaster – please read the second email I’ve sent you and would you confirm by reply? Many thanks x
Dec 04, 2007 @ 14:42:00
And the third.. message I mean:
Lady dear, if fairies may
For a moment lay aside
Cunning tricks in elves play,
‘Tiss at happy Christmas tide.
We have heard the children say-
Gentle children, whom we love-
Long ago on Christmas-Day
Came a message from above.
Still, as Christmas-tide it comes around,
They remember it again-
Echoes filled the joyful sound
“Peace on earth goodwill to men!”
Yet the hearts must child-like be
Where such heavenly guests abide,
Unto children, in their glee,
All the chill year is Christmas-tide.
Thus, forgetting tricks and play
for a moment, lady dear,
We will wish you, if we may
Merry Christmas, glad New Year.
Dec 05, 2007 @ 02:42:34
Philipa: is he stalking you? Maybe Boris could help: Boris loves press!
Ellee is an awesome blogger, someone I HAVE to get to more often. And of course, this post rocketh severely.
Dec 05, 2007 @ 09:44:50
I’ll email.
Indeedy, this post doth rocketh.
Dec 05, 2007 @ 10:22:11
Hotmail? Give me a day to check it: I’m virtually entirely gmail nowadays.
Dec 05, 2007 @ 16:39:06
Oh soz, don’t have your gmail but reply sent to your reply so hope you pick that up. Will ask for your gmail next time.
Anyway, just got the children Shrek 3rd, will look out for fairies but the main one plays a character that looks spookily like a young Boris the beautiful.
Dec 06, 2007 @ 02:30:57
raincoaster AT gmail DOT com.
What did young Boris look like? It’s a concept around which I cannot wrap my brain.
Dec 06, 2007 @ 08:30:34
C’est une Concepte que on ne desire pas wrapper around la Brainne
Dec 06, 2007 @ 08:32:02
Exactement.
Dec 07, 2007 @ 20:40:00
Mon dieu Mr Eagle!
I think it was Vogue who ran an article featuring the Bozmeister and I particularly remember a pic of him aged about 21 in which he looked uncannily like ‘Charming’ from Shrek2, only not gay and with a better voice and a backbone, obviously.
PS: thanks Raincoaster, thankyou for your decision. I am indeed calming down, slowly. Handing in my assignment helps. It’s Rousseau next – goody :-))
Liberty, fraternity, property??
Dec 07, 2007 @ 22:00:53
Rousseau, an excellent antidote!
Property? I don’t think Rousseau was a Tory!
Dec 09, 2007 @ 18:06:55
‘parently the soundbite was originally ‘liberty, equality, property’ as it was essentially a bourgeois revolution but I will look into this and report back..
Dec 09, 2007 @ 21:35:06
“Everywhere, Men are born Free,
mais les Dames do the Cooking et the Washing-Up
Rousseau was rich enough to be able to afford to be a Socialist – presumably Cruella de Blair et M. Le Brun are similarly embarrassed with riches
What happened to Rousseau – did he live long enough to have a Blind Date with Mlle de La Guillotine ???
Dec 10, 2007 @ 06:24:44
I thought he turned into a painter?
Dec 10, 2007 @ 13:45:35
Composer I think, he died a natural death and I think he dumped his children in an orphanage. Dominic Lawson did quite a good piece on men who bang on about liberty and family and whose behaviour is quite the opposite.
Dec 10, 2007 @ 21:51:25
Dominic Lawson, however, too often supports those who don’t even do the first.
Dec 11, 2007 @ 14:11:22
I’m reading my Tom Paine book at the mo but may treat myself with a book on Rousseau for crimbo. I want to get Simon Schama’s book on the French revolution but do you know it’s cheaper and quicker to buy it from Amazon than it is from my local mall?! They didn’t have anything I wanted in my local bookshop, it was full of pap; biographies of footballers and z-list wannabes, penny dreadfuls and celebrity chefs.
I declined the offer of a free book on wizarding claimed to be aimed at children though it was beautifully presented with pentagram and spells and free parchment. No fairies though :-(
Dec 11, 2007 @ 22:02:09
Tom Paine? You sure do like a depressing read at Christmas!
Dec 11, 2007 @ 22:43:28
I prefer the Halliburton film version of A Christmas Carol. It’s just like the Alistair Sims version, only they play it backwards so that it has a happy ending.
Dec 11, 2007 @ 22:57:24
Cheers me up when I can escape the TV. That’s what a lot of people do here you know – just eat, drink and watch TV, with relatives they’ve managed to avoid all year, it’s the talk of the playground; everyone’s having a good whinge and getting it out of their system so they can smile through gritted teeth at the bitch their brother married or the mother-in-law that hates everything through her painted pink smile. Luckily my relatives are ok – they like quiet when the very loud TV is on so I go in the back with my babes and play till bedtime then read Tom Paine and I’m asleep within 2 pages!
Dec 11, 2007 @ 23:11:14
That’s not what happens to me, Philipa: I generally throw Tom Paine across the room and then write really bitchy comments on Tory blogs.
Metro: if Cheney were to be visited by the ghosts that Haliburton has created, he’d be kept busy till New Years at least!
Dec 12, 2007 @ 11:13:57
Would that be a crisis of Con-seance?
Dec 12, 2007 @ 18:23:49
Just saying this, how utterly stupid!
Fairies are a figament of childrens imagination.
AND THAT’S COMING FROM A 13 YEAR OLD!
Dec 12, 2007 @ 19:12:32
Char “…. figament of childrens imagination …. ”
All Children are of course very welcome in this Kindly & Tolerant Space … even perceptive and sagacious faery-unbelievers/skeptics
SchPelling is the burden of Adolt imagination and it improves with age, at least prior to dementia setting in
Was it Galileo’s ADULT imagination that came up with the misconception that the Earth goes round the Sun
… whereas inspired by Einstein, 20th Century Physicists kNow all Motion is relative
…
Dec 13, 2007 @ 05:16:44
Rach, how do we KNOW you’re only 13? How do we know you exist at all? We have to take it on faith, I guess…
Dec 13, 2007 @ 12:09:26
Mr Eagle – “all motion is relative” – you’re not kidding! That’s all some relatives talk about.
Can’t bitch on Tory blogs at my folks as it turns Mum into something sounding like Terry Jones from the Life of Brian, which admittedly can be a laugh but only once.
I don’t think ‘Rach’ is a child of 13 at all. She might be 14 at which age everything is stupid. Bless. Or she might be a 220lb trucker named Duane who’s in denial. I think we need more proof, at least on the fairy front.
Dec 13, 2007 @ 12:17:53
62 left!
Yes, everyone knows Duane is a fairy!
Dec 16, 2007 @ 06:42:42
wow i dont know what to think.
when i lived in texas when i was in 2-3 grade, me and my best friend tasha DID see fairies at our school, at my apartment, in her yard, basically everywhere! one day we were exploring and we came across a tree with a bush. we peeked inside and saw a colony of fairies! the leaders name was laurabella, and she was about to have a little baby fairy! i would go there everyday and see them. they showed the their ruines, and cloths. laurabella had white wings and dress, and she “said”(couldnt talk to us ut signed to me) that she was going to name the baby fairy after me, and that she would visit me. but when i moved to socal in 3 grade, there were no fairies and nobody beleived in them. im in high school now, and laurabella and her baby have never come to see me.
maybe it was just our imagination? idk but this has convinced me otherwise! this looks so incredible!
Dec 16, 2007 @ 09:39:24
I have a very strong premonition that you haven’t seen the last of laurabella and her baby.
Dec 16, 2007 @ 13:31:18
Your Grace
It is a Truth universally acknowledged that educating females can have unexpected (as the Mond=Tochter indicates) consequences, as the years advance
Without female education, we would be deprived of those glowing Jewels in the UK Governmental Firmament
These Ladies have brought such glamour und political effectiveness – such supporters (as they gobble up their massive Government expense allowances) of Mr Blair, until he moved on to a higher plane of existence
eg Mrs Jack Dromey (err in Canuckistani – Ms Harriet Harman)
eg Mrs Ed Balls (err in Antipodean – Ms Yvette Cooper – even as we type, she is doing more to wreck the English Housing Market with her “HIPS” packs, than the combined Greeds of the US Sub-Prime Mortgage Lenders and Northern Rock)
eg Mrs David Mills (err … Ms Tessa Jowells)
eg Mrs Tony Blair (Cruella Booth aka Cherie Antoinette)
eg Mrs Derek John Gadd (… Ms Ruth Kelly) – the member of Opus Dei who is a pre-eminent contender in a well-populated field for the prize of most light-weight Education Ministers – the sort of woman who would exclude Faerie as a subject in the Englisch National Curriculum, as well as criminalizing Catholic Adoption Agencies
Dec 17, 2007 @ 02:28:53
355 comments is the goal? I can see the whites of its eyes.
G Eagle, don’t be so narrow-minded. I saw Guido’s “Tory Totty” thread, and the pickings there don’t look much more promising, either aesthetically or politically.
Dec 17, 2007 @ 19:27:45
Your Grace
… but I am so much older than you – allowances must be made
AND Your Grace et Mr AerChie can luxuriate in not being narrow-minded, when your Countries’ affairs are so well presided over (of course under our Gracious Queen. God Bless her) by those awefully nice Chaps Mr Harper & Mr Rudd
but even wide-minded Colonials et exColonials would be endorsing this SECOND BLAST OF THE TRUMPET against the MONSTROUS REGIMENT of WOMEN … if Canada & the USA was under the Government of the afore=mentioned Ladies
Perhaps this explains why Gordon currently looks so …..
Lucky for your Grace that your Grace had not registered to take a UK Driving-Test, in readiness for Britain’s leading Bloggerist asking Canada’s leading Bloggerista for remunerated help – if you had, your personal details might well be in the hands of the US mafia
Mrs Derek Gadd has now apologized in the House for losing the personal details of 3-million Learner-Drivers – perhaps we should ask FFE (our distinguished US Correspondent/Investigative Journalist) to try to recover them – apparently they went missing on a Hard Disk in the USA
However, if your Grace’s name is indeed amongst the “3 million”, I suppose your Grace could go on a UK Witness-Protection programme, with a New Hidden identity
… err … but perhaps this would not be such a good idea
International Criminals could well have now acquired the Inland Revenue’s “lost” 25-million personal files, which include the assumed names & locations (& National Insurance tax numbers) of all those on the UK’s Witness Protection Programmes
Harrumphus, harrumpha, harrumphissimum
Yr Grace’s obedient servant etc
G Eagle
PS Me miserum – still another 12 to go … und I see I have included not Mrs Ian Ducat in the Schedule of Illustrious Ladies who so illuminate British political Life
Dec 19, 2007 @ 11:35:06
I knote the abundunce of posts from a certain G Eagle of whome many tails are tolled. He no longer has credibility as he, above, on Octembere the fiveth, referred to “Scotchmen”. And he was not referring unto the makers of a form of uisge beatha named Laphroaig. He was referring, insultingly, to guid honest Scotsmen. Undoubtedly he is blinded by his foolish detestation of the followers of Keir Hardy. He has shocked me into correct spelling.
Someday soon, he could well be attacked by an enraged sporran and kilt! And all the Derbyshire Fairies in the world will not save him!
Ask not for whom the belle tolls – - – !
(344?)
Dec 19, 2007 @ 14:29:14
No Sir, can it be, Archie, that Mr Eagle has made such a mistake? It must be so and a heinous error it is to any scotsman to be sure. I predict that if the word gets out the little wee haggi will be hunting oot the poor man. Beg forgiveness Mr Eagle for a haggis with a mission is a sight to behold.
Crivens!
Dec 19, 2007 @ 20:04:22
Indeed, and he seems to be blaming the US mafia on the female of the species. Given my neighborhood and gender, this is not inclined to endear him to me.
He must have gotten up on the wrong side of the porridge this morning or something.
Dec 20, 2007 @ 01:59:40
Oh waily, waily, waily, Sweet Philipa, as you are already a member of the Grey Eminence’s “Monstrous Regiment of Women”, I fear your opinions may be ignored, as he seems to be taking on the attitudes and habits of that other grey person, the Wintersmith. But let him be in nae doot! Nae King! Nae quin! Nae Laird! Nae Master! We willna’ be fooled again! For we are the Wee Free Men!
And we will cut off his porridge!
Dec 20, 2007 @ 02:47:00
Don’t you need a license to do that? It doesn’t matter; the NHS has a twenty-month waiting list for porrigectomies.
Dec 20, 2007 @ 05:22:39
Oh Aye? I’ll jump him to the top of the queue and I will perform the
dismembermentoperation with a blunt spoon!Dec 20, 2007 @ 06:06:46
Let’s wait and see: with all porridge-related medical conditions, it’s best to give them 48 hours to solve themselves before bringing in the hoses.
Dec 20, 2007 @ 14:42:41
Ach no Archie, the Wintersmith is no grey, he’s white and bites like the frost on your face and stings your eyes and steals your breath in the wind. He dances like snow in the breeze and threatens like thunder. He has the power of the Earth and is tamed by the brightness of a sunny smile. Nae lad, Mr Eagle’s not like the Wintersmith, we can easily cut off his porridge.
But as Raincoaster decrees – 48hrs before bringing in the hoses. (why hoses? you’ve got a spoon, what more do we need? – it must be a haggis thingy, ah waily waily, not the haggis beastie)
Dec 20, 2007 @ 20:46:17
Her Grace La Marchionnesse de WitchHampton under Buzzard
Your Grace
Doomed
We’re all doomed
In January 2009, in her remoteness outside the London Congestion Zone, residing within a Racing Pigeon’s flight of Shepherd’s Bush, even the Lady ApilihP will be endorsing the SECOND BLAST OF THE TRUMPET when oor Hilary is moved into 1600 Pennsylvania Avenue … and insisteth on passing the Port from the Left to the Right
Doomed – we’ll all be reduced to drinking Aqua Vitae in the Gallic – och, hoots, man
Just think of the US Spelling=Imperialism which now (even before oor Hilary’s Advent) creepeth even into this Blogge Eruditissimum, withstanding not that it is read by so many Ladies and Intelligent Children and by Monsieur Metro
Porrige …. Neighborhood …
and BTW
Freond is not a Spelling Mistake – it’s Anglo-Saxon
and
the korrekt spelling of Equine in the Plebeian Vernacular is “hoRse”, nicht “hose”
Doomed – is Jesus to return and the World end before we ascend to the Magic Number [71x5]
I have the honour (… ummm … honor) to remain your Grace’s 352nd obedient servant etc
G Eagle
PS Le Chevalier Aerchie’s Petition to Save the Whale (err … in AntiPodean – Waily)
NOW is the time for All Good Bloggers to visit Aerchie & Sign the Petition to save Motherhood, Apple Pie and the Cetaceans NOW
Dec 20, 2007 @ 22:19:37
I would always pass the port to the left, unless I was sat on the hosts right. Hilary is Boz’s choice but I have never endorsed her nor would I. Jesus isn’t to return, he never left – we are only doomed by our own actions, especially those actions that court the wrath and displeasure of the dreaded Haggi..
oh waily waily!!
Dec 21, 2007 @ 00:31:06
354, my friends.
G. Eagle, when is Arthur coming back? That’s what I want to know!
Dec 21, 2007 @ 00:42:20
Shrek’s got the annoying little rascal
Dec 21, 2007 @ 00:44:36
What is this Shrek of which you speak?
356!
Dec 21, 2007 @ 00:53:41
Why aye, the big green beastie!
Do you not have green beasties in Canada?
Hey I saw a prog on the bears in Canada moving into the towns of ski resorts to feed. They were magnificent creatures but people would happen upon them and then take pictures and the bears would amble off – you’d be in more danger in London! Well you would in hackney.
Dec 21, 2007 @ 02:35:58
We have only Ogopogo.
But yes, we have bears, but they’re not that harmless. People routinely mistake them for chow-chows, which is a mistake. One eedjut decided to have his kid feed a honey sandwich to the bear…which was a grizzly. Now they call the kid “Lefty.”
Dec 21, 2007 @ 12:26:06
Yes the teddy bear image does rather give the wrong impression. Sounds like the kind of dumb parent you see pushing the pram, with baby, into the road whilst themselves waiting safely on the pavement to cross.
Sadly my babe, the junior journo, has had to come home from school with a raging temperature. If you have any influence with the fairies I’d like to have her well for at least Xmas please. The annoying thing is that out of hours medical care is non existent in this country unless you go to A&E.
Dec 21, 2007 @ 12:43:52
Fairies rarely heal people, in my experience. They DO cause a lot of fevers, though, so maybe they’re watching what you type here!
A&E? The Arts and Entertainment network? I don’t think they can help. This mythical country where doctors are on 24 hour call over the holidays? It does not exist, and never has. Just read A Junky’s Christmas; even the drunken sot of a doctor in that one wouldn’t take calls on the holidays.
My sister used to work switchboard in a hospital, and she suggested that rather than bring sick kids in, parents call in and ask to speak to a nurse, who could make the determination of whether or not it would be better to bring the child in, with all the waiting around that entails, or to try a bit of on-site triage and see if the child improved.
Dec 21, 2007 @ 12:45:22
360, by the way. I have seriously beaten Guido Fawkes, proving once again that people are really interested in who’s really a fairy.
Dec 21, 2007 @ 17:50:01
360 – well done!
Managed to get my babe to a doctor so she’s on antibiotics. But in all fairness this mythical country where doctors are on call 24/7 is in fact the Accident and Emergency dept in any NHS hospital in the UK. My son spent xmas from ambulance to A&E to ward one year and they tried so hard to make it fun for him with presents and a santa who had to wave from the door of his isolation room. ‘Daddy’ wouldn’t even come onto the ward but this stranger ho ho’d to every child. That mattered.
Dec 21, 2007 @ 19:13:00
You mean where “residents and interns” are on call 24/7!
And yes, they really do try hard in children’s wards at Christmas. It’s heartbreaking for them to have to be in there at that time.
Dec 21, 2007 @ 21:50:36
Her Grace La Marchionnesse de WitchHampton under Buzzard
Your Grace
Doomed
We’re all doomed
Yes – 364 – but is the Gentle Laurie’s 500 record to remain safe
Doomed – bring on the Horses
I have the honour (… ummm … honor) to remain your Grace’s obedient servant etc
G Eagle
Dec 21, 2007 @ 22:07:24
I have yet to see the post in question, so I remain skeptical. Besides, at this rate it’ll just be passed by this thread in June or so.
Dec 22, 2007 @ 16:52:00
We do our best.
Happy Christmas all :-)
Dec 23, 2007 @ 07:19:19
Merry Christmas! Maybe next year I can come over there and wish you Merry Christmas in person. I’ve decided to become rich; wish me luck.
Dec 23, 2007 @ 09:20:53
Check this out
http://www.crypticmedia.com/content/fairy-caught-flying-in-house.php
Dec 23, 2007 @ 09:24:45
And this
Another Fairy Caught on Film?
This anomalous flying, glowing object was photographed by reader Neil Wallace at Spofforth Castle, North Yorkshire, England. “Perhaps there is more to this faerie thing than meets the eye!” Neil says. “I was the only one there and was braving out a night time photo shoot. Spofforth Castle is reputed to be haunted by a young maiden who committed suicide supposedly by falling to her death from one of the towers, and has been frequently seen walking the grounds in and around the castle.” You can see the full photo in the Paranormal Gallery.
Dec 23, 2007 @ 09:52:57
Aha! New life to the controversy! Thanks!
Dec 23, 2007 @ 11:50:59
I wish you the best of luck and you would be most welcome here!
Dec 23, 2007 @ 11:56:10
Thanks! I shall keep you posted (although I did once show up at my friends’ house, having idly boasted of doing so months in advance. Such a shame it was two-thirty in the morning and they didn’t quite have the strength to appreciate the joke.
Dec 23, 2007 @ 11:56:30
)
Dec 23, 2007 @ 20:23:31
fairies are real and I’m 15 stupid people who do not bielive in fairies are stupid.
Dec 23, 2007 @ 20:40:13
But surely the fact they are stupid makes them stupid? Or am I missing something here?
Dec 23, 2007 @ 22:54:31
And we shall not comment on the intellectual level of people who spell it “bielive” of course.
Dec 24, 2007 @ 00:13:58
that looks so sad
:(
Dec 24, 2007 @ 00:15:55
it looks so sad like sam said
:(
Dec 24, 2007 @ 04:42:10
Well, it IS dead. You’d be pretty sad, too. Fairies don’t normally die at all; this one must have been killed in a battle or some accident.
Dec 24, 2007 @ 04:52:20
Old age?
Dec 24, 2007 @ 05:41:21
Nope, fairies never die of old age. They’re immortal! Maybe it was killed by a curse?
Dec 24, 2007 @ 09:59:29
Bonjour, la Vestre Grace
The puir wee Lassie – she seems rather thin
Peut-etre, elle est morte parce que elle a mangée de trop de Porridge avec le salt et pas de beaucoup de sucre tres nummé et nourishant et fattenant
Cause of D’Eath = Dieting & Eating Disorder
Is that what made your friend the Mesonychoteuthis Hamiltoni float to the surface off New Zealand on Monsieur AerChie’s Blogge
Dec 24, 2007 @ 15:56:23
Ah, that would explain it rather well. Perhaps we are looking at Kate Moss’s great-great-great-great-great grandmother?
As for the ways of the Colossal Squid, they are mysterious even to the fairies.
Dec 24, 2007 @ 17:21:41
i know fairies are real.I have a fairy that keeps an eye on me.i also have a sister in law that can see them.just coz u don’t see them,doesn’t mean that they are not real.u can’t see love but u know that it’s there!!!!!!!
Dec 24, 2007 @ 21:19:57
Her Grace La Marchionesse de WitchH etc
WHERE EAGLES dare
La vestre Grace
Noel Joyeux et Best Wishes pur l’Annee Nouvelle
Quand vous estes plus riche, we shall hope in 2008 to see you in Inglaterra – je puis recommender la Cooking de la Magicale Mdm Grise-Aigle
La vestre Grace’s servant obedient etc
G E
Dec 25, 2007 @ 08:43:38
It is time we worked harder at mummifying the Guido Personage. Preferably long before the day after November 4th, 2008.
Dec 25, 2007 @ 18:49:10
What do Grey Eagles cook? Bald Eagles eat a lot of salmon…I shall do my best to become rich enough to annoy in person on two or more continents by this time next year.
Archie: it looks like we shall leave Guido in the dust long before then. Although I think he’s more of a cinder than a mummy, unless my history is all wrong.
Dec 27, 2007 @ 03:18:53
There are always things that were told which have for some reason passed down the line as tales. No one knows if they were real, but who knows what our past bred! With science or without it, you can’t always prove something right. It’s possible that fairies do exist, or at least existed long ago. It’s also possible that they do without scientific evidence because science isn’t always on our side- nor 100% correct. The truth is hidden within the past, and sometimes science can’t find it. So maybe the fairy there is real. Maybe it’s not. Maybe fairies have existed long ago. We may never know throughout the life of this planet. But to have a possibility takes a step closer to the proof. You can’t say something’s real, or say it’s not real- no matter how much evidence there is, because you don’t control the fate of this planet’s life (historical to present) nor do you know all of it’s past. Science is so difficult that we can never understand everything about this planet to stay short, but think about what the universe has that will take forever to find! That would make my head hurt…
If you’ve seen one- then there’s a chance that they’re real^.^
Dec 28, 2007 @ 14:11:54
i think these pics are fake. <3
Dec 28, 2007 @ 18:58:34
Science is not difficult – it is the observation and analysis of the natural world. Getting it right is the difficult bit. It IS possible to ascertain what is real – the light in the fridge routine is a con spouted by men to confuse you long enough to get you naked.
Mr Eagle Sir – porridge with salt in? Ugh!
Happy New Year Y’all!
Dec 28, 2007 @ 19:54:43
Her Grace La Marchionesse de W’Hampton under Buzzard de la Zouche
Your Grace
I flatter mysen that the Lady ApilihP und this Eagle agree on so many things – at least, we seem to be of one mind on the merits of EgdirroP con sale [pSalt]
BUT as Trinity observed to Neo, it’s the QUESTION that DRIVES us
Much may be admired for sheer talent und a good voice … mit [with] opinionation circumscribed mit such an Economy of Language, but we must not let the veracious Dame Bassey so drearily distract us, however welcome may be such une Visiteuse si distinguée
UND it is not what Eagles cook – peut-etre it is plus interessant to know what MDM Eagle cooks [... mmm .... yummy gooseberry phoule ...]
Rather as Pythagoras perceived, it is THE NUMBER
Elle n’est pas 391 – c’est plus prochaine a [2x2 * 10x10] + <1+101, ut vincimus la Gentille Laura’s Blogge-Record
Je reste le Vestre Servant
L’Aigle Gris
Dec 28, 2007 @ 22:21:42
Patience, my friends. All things in time, but few before the New Year at least.
Dec 29, 2007 @ 04:14:43
All you need is Faith, Trust, and Pixie Dust!
Dec 29, 2007 @ 20:16:37
Or if those don’t work then a shedload of money usually does the trick.
May we all have everything we want in the new year :-)
Dec 30, 2007 @ 03:44:51
im 9 years old and i belive it. 1 because i rote to a fairy and they said they were 6-8 inches tall. i left my note on my drive and did NOT tell my parents. no lie
Dec 30, 2007 @ 18:57:43
yes i right to the fairys no lie but their is evedance this is fake. but if their was no evedance i would belive it
Dec 30, 2007 @ 19:02:49
I’m sorry I didn’t understand that – should there be a hyphen in eve-dance? Do fairies dance on new years eve? You’ll have to let me know as I can no longer be bothered with all that auld lang syne stuff – grim.
Dec 31, 2007 @ 07:09:41
Yes, fairies dance on New Year’s Eve and all full moons and Christmas, too. But they don’t touch haggis; the mere taste of haggis would make them mortal!
Dec 31, 2007 @ 20:49:18
Haggis is yummy but chasing them always makes me dizzy.. and it freaks me out when they turn and start chasing YOU! ARGH! Hey enjoy the dance if you get the chance but be careful ;-)
Jan 01, 2008 @ 10:18:31
Her Grace La Marchionesse de W’H under Buzzard de la Zouche
Your Grace
The Lady ApilihP has achieved a Milestone of Wisdom
It is a Truth universally acknowledged amongst the Cognoscenti of Occult Mysteries :
Doomed
We’re all Doomed
The Hunter must always BEWARE, lest the Hunter becometh the Hunted, on the Way to painfully-becoming Late (= Dead in Botswanan or FruhStuck for a Gaelic-speaking Haggis)
A Haggis most Ravenous is indeed an anxious Sight – but just think hWat it must have been like before Caledonia was inhabited by Homo pSeudo Sapiens, WHEN Giant Haggises (in Gaelic Haggoi) roamed the Land in Quest of Beavers, Panda Cutlets, Raw Squirrels and pSalted EgdirroP to afford a varied Diet to the Plump & Greedy
AND BTW
Exactly what did this Late Fairy have to do with D B Cooper – is it true that the Body was discovered with used $20 dollar bills from the early 1970′s
One would not like to think ill of a Derbyshire Fairy
Your Grace’s obedient servant etc
G Eagle
Jan 01, 2008 @ 22:58:37
well i sorta blive in faries but yur right they should stay in our head but i showd it to my dad but he said its a load of s***(poo) but im not botherd to what peeps think stacexxx
p.s maybe the bbc said it was april fool coz the FBI told them 2 just maybe
Jan 01, 2008 @ 23:58:08
I believe DB Cooper was on the run from the murder of this poor fairy; it would explain so much! Stacy’s on the right track, insisting on a BBC-FBI conspiracy to cover up the truth.
Philipa, the thought of being chased by a wild haggis will now haunt my dreams.
402!!!
Jan 02, 2008 @ 05:13:15
I want to be chased by some wild haggis.
Jan 02, 2008 @ 20:59:53
WOW YOU CAN SO TELL THE WINGS ARE OLD LEAFS FROM A TREE =) KINDA DUMB TO TRY AND FAKE FARIES OUT . aND THAT DEAD LITTLE BODY , WHERE THE HELL DID YOU GET THAT FROM ? IN A MEXICAN PARADE OF EL DIA DE LOS MUERTOS? HAHA J.K
Jan 03, 2008 @ 01:25:37
There are no fairies in Mexico, silly! Because they have no mushrooms, they can have no fairy rings. Simple logic.
Jan 04, 2008 @ 16:02:11
Raincoaster I saw this and thought of you.
Shame xmas is over – don’t tell me, like men, you prefer the real thing, even if they are a bit dead?
Jan 05, 2008 @ 08:23:26
I prefer the real thing to imaginary except in certain circumstances, such as being sung to by a witch underground while Puddleglum tries to remember something important.
Jan 05, 2008 @ 12:31:03
Hee hee, excellent. Have I mentioned Quasar 9′s blog? He’s got a post up at the mo about magic circles concentrating energy and some pretty pics from outer space. Apparently stars have a heartbeat! Don’t think that’s gonna help a dead fairy but there you go.
Jan 05, 2008 @ 16:11:26
haha…it looks so real….shame…..it could of made a lot of money if it was…
Jan 07, 2008 @ 05:29:56
Oh my god there is a real fairy in that picture? :O i will pray for that fairy and wish i can see the fairys i wish i can see them i believe in them i sereiosly do!!! please tell me how to see a fairy! please i want to see them :’( :’( :’(
Jan 07, 2008 @ 05:32:48
If some one is making a joke about a real fairy! THEN STOP!!!! i want some one to stop that pranks i wanted to see them and i wanted to fine somthing from a fairy! we dont want pranks anymore i want to see a real fairy please i want to see it!!!
Jan 07, 2008 @ 05:48:53
OH MY GOD SOME POEPLE DONT EVEN CARE ABOUT FAIRYS AND THEY DONT BELIEVE IF YOU DONT BELIEVE THEN DONT MAKE PRANKS LIKE A SKELETON OF THE FAIRY AND I WISH THAT WOULDENT HAPPEN IN APRIL FOOLS I JUST WISH ALL I WANTED IS TO SEE A FAIRY AND FOUND A DISCOVERY ABOUT THE FAIRY WHAT HAPPENS SOME ONE FOUND THE FAKE FAIRY AND THEY BROUGHT IT TO DESCOVERY CHANNAL AND NOW THEY FOUND OUT IT WAS FAKE THEN A MEN OR A WOMEN THEY WILL CRY! CRY! CRY! SOME ONE WAS TRYING TO FINE A FAIRY FOR YEARS I DONTK NOW WHO BUT SOME ONE MIGHT DO IT FOR YEARS NOW AND I FEEL VERRY SAD RIGHT NOW SO STOP RIGHT NOW SO YOU WILL FINELY KNOW IT WAS REAL! GOT IT!?
Jan 07, 2008 @ 07:53:13
MARIE WHY ARE YOU YELLING? Take an exlax and relax!
Jan 09, 2008 @ 22:18:22
wooooow i cant belive it i really do belive in Faries and i love them!!!!
Jan 09, 2008 @ 22:20:33
I LOVE FAIRIES AND WELL ME AND MY FRIEND ARE MAKING A HOUSE FOR THEM AND A PROGECT!!!!!!!!!!!!!
Jan 09, 2008 @ 22:45:44
Fairies don’t live in the Projects, yo!
Jan 09, 2008 @ 23:31:48
Why not, Rain? Fairies are equal opportunity!
Jan 09, 2008 @ 23:49:27
This is true, but as Fairies live in a monarchy, they rely on the King to provide housing, which he does in the form of barrows, etc. Low-rent, low-rise, these are not part of the Fairy dwelling experience.
Jan 10, 2008 @ 00:36:06
The wings are leaves! O.o
Jan 10, 2008 @ 03:10:33
Not at all; as you can see in the renowned Flower Fairy books, many fairies have somewhat leafy- or blossomy-looking wings. It’s the most natural thing in the world.
Jan 11, 2008 @ 23:59:40
okay so here it goes.fairies are like angels rite? if so i beleive. yet the picture is alittle skechy.i can’ say it’s fake nor real.the body looks real……but the wings don’t look real. anything is possible.well…..almost everything
Jan 12, 2008 @ 01:53:08
Anything except Tom Cruise being straight.
Jan 12, 2008 @ 04:43:24
I CANT CALM DOWN BECAUSE EVERYONE ALWAYS MAKES PRANKS ABOUT FAIRYS! :’(
Jan 12, 2008 @ 04:45:44
IM GOING TO SEARCH ONE FAIRY IS REAL! I HATE FAKE FAIRY FOR PRANKS THATS NOT FARE!!!! IM GOING TO SEARCH ONE ONES AND FOR ALL!!!!! IM NOT GOING TO GIVE UP I WANT TO SEE A FAIRY SO MUCH AND IM GOING TO FINED IT AND IM GOING TO TELL THE DESCOVERY CHANNAL!!!!!!!!
Jan 12, 2008 @ 05:04:37
Everyone? Always? That doesn’t leave much time for running the Vast Right-Wing Conspiracy, does it?
Jan 12, 2008 @ 15:52:00
hahaha…..no, it doesn’t
Jan 12, 2008 @ 15:52:47
i guess
Jan 12, 2008 @ 21:26:29
if fairies dnt exist (which they do!!!!) then why years ago before camera trickery did those two little girls get pics of those fairies? and yes they admitted some of them were fake but thy also said that some were real and photography analysists studied those photographs and said the wings in them were moving how did two little girls who had never picked up a camera before manage to do that? also people believe in god so what so wrong bout believing in fairies, unicorns and such like? i dont believe in god but i dont go critcising everyone, i dont get everyones big problem. FAIRIES EXIST GET OVER IT!
Jan 12, 2008 @ 21:27:45
ps i believe in fairies and i’m clapping for them!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Jan 13, 2008 @ 00:25:27
People believed Liberace was straight, too.
Jan 13, 2008 @ 03:07:03
Why are you clapping for them?
Jan 13, 2008 @ 03:27:22
People clapped for Liberace, too. It was a more innocent time.
Innocent of standards.
Jan 13, 2008 @ 21:20:31
yea somewhat.have you guys seen that new pic of another claimed fairy shot on that new place?
Jan 14, 2008 @ 01:29:34
I have two dead fairies on this blog: one mummified, one fossilized. Have you got a link to the one you’re talking about?
Jan 15, 2008 @ 03:21:34
If its kept secret then how do you know about it?>
Jan 15, 2008 @ 03:32:48
Nothing can be hidden from raincoaster!
Jan 15, 2008 @ 18:28:45
Oh good grief, Liberace was a fairy??
No I can’t believe that, fairies have some taste and use magic and pixie dust rather than plastic surgery and rhinestones.
I think all the flesh they cut off Liberace was made into Bobby Crush but away from the host it withered and died.
See? Nobody clapped :-(
Jan 15, 2008 @ 19:52:00
i was clapping to keep all the fairies alive that a lot of u are killing by saying you don’t believe in them when given all the evidence they so obviously do
still clapping!!
and anyone that doesn’t believe in them is either too old to be with it anymore or a complete and utter reject that has nothing better to do with their time than sit and play computer games day in day out.
Jan 15, 2008 @ 20:26:26
I agree Pixie dust, you keep clapping!
er.. what happens if you’re an utter reject and too old to be with it but you still believe in fairies? Get sectioned, drugged and put in a home I guess.
Jan 15, 2008 @ 20:44:12
no i don’t have the link sorry
Jan 15, 2008 @ 20:49:19
What have computer games got to do with anything?!
Jan 15, 2008 @ 22:45:15
Quite so. And fairies, being immortal, are the least inclined to the bigotry of ageism.
Jan 16, 2008 @ 02:12:24
UP THERE IS MY AUNTS EMAIL.ANYWAY….I CANT BELIVE MY EYES.IHAVE ALWAYS WONDERED IF FAIRIES WERE REAL.AND IF THEY ARE ALWAYS ALIVE HOW WILL THEY SERVIVE IN WINTER?I HAVE ALWAYS WANTED TO SEE A FAIRY SINCE I WAS SIX I AM 10 KNOW AND IN FORTH GRADE,DIRTY BLONDE HAIR,CHEEK BONES,GREEN EYES,4FT9,AND IWEIGH 90.
I NEED TO SEE A REAL LIVE FAIRIEY.1/15/O8
Jan 16, 2008 @ 02:26:35
HOW COME THOOSE PEOPLE DONT BELIVE IN FARIES?
Jan 16, 2008 @ 02:45:09
BECAUSE YOU USE ALL CAPS! ITS YOAR FOLT!
And everyone knows there’s no such thing as a “fairiey” duh. It’s “Fairy” yo!
Jan 16, 2008 @ 04:16:01
ITS FAKE AND I HATE FAIRIES AND THER BETTER OFF DEAD.
Jan 16, 2008 @ 04:18:29
RAINCOOSTER YOU ARE STUPID AND YOU DONT KNOW HOW TO SOELL.
Jan 16, 2008 @ 04:23:04
PIXIE DUST GET IN YOUR HEAD ITS A FAKE AND I DO HAVE BETTER THINGS TO DO THEN SIT ALL DAY UNLIKE YOU GET REAL ITS A FREEKING FAKE FAIRIES ARE FAKE IF I SEE ONE FLYING AROUND THEN I AGREE UNTILL THEN ITS A FAKE, THEN AGIN I MIGHT JUST HIT IT WITH MY SHOE.
Jan 16, 2008 @ 04:25:14
RAIN COASTER I MEANT SPELL…….HELLO
Jan 16, 2008 @ 04:33:08
KILL TINK
Jan 16, 2008 @ 04:34:12
STUPID COUSIN JOSH TINK IS BADBUT………..
Jan 16, 2008 @ 04:35:41
TINK SUCKS SO HARD SHE A TINK FAN BOOOO
Jan 16, 2008 @ 04:36:22
TINK SUCHS ANDROCKS
Jan 16, 2008 @ 04:37:26
MY COUSIN IS GAY SHE LIKES TINK BUT SHE SUCK ASS ILL KILL HER IF SHE WAS REAL BRB GOT TO KILL LITTLE COUSIN
Jan 16, 2008 @ 04:39:21
I SUCK
Jan 16, 2008 @ 04:40:28
JOSH SLEEPS WITH A DOG
Jan 16, 2008 @ 04:45:08
JOSH HAS A CRUSH ON FERGIE
Jan 16, 2008 @ 04:46:35
NAAAAA SHE JUST FINE AND THATS IT BUT REANNA LIKE BRITANY AND WANTS TO BE LIKE HER NO JOKE HOW LAME
Jan 16, 2008 @ 04:47:36
BRITTT I DO NOT YOU LIKE HER.
Jan 16, 2008 @ 04:48:12
BS YOU KNOW HAOW MANE KIDS SHE HAD ILL PASS.
Jan 16, 2008 @ 04:49:48
JOSH IS SO COOL HES MY HERO
Jan 16, 2008 @ 05:20:36
He’s exactly the same person as you. The tech never lies, dumbass.
Jan 16, 2008 @ 09:02:35
Her Grace the Marchionesse of W etc
Your Grace
SECOND BLAST OF THE TRUMPET AGAINST THE MONSTROUS REGIMENT OF WOMEN
When the Electoral Commission has finished exonerating that terriblY nice Youthful Peter Hain, perhaps the Commission will have leisure & resources to investigate this Mummified Fairy and give her a Clean Bill of Health, as well
Colonials/exColonials will struggle to understand or even care at all about the Kindly exRugby disrupter, who has now achieved true meaning in Life & Respectability by becoming a Minister of the Crown
The tragedy is less that on this occasion young Cephas has quite unCharacteristically shewn a certain “je ne sais quoi” in returning his Election Expenses, while focusing on making the UK Work & Pensions Dept the envy of those US Citizens unable to afford Health Care insurance
After all, the UK Cabinet is full of curiously-insightful Ladies (eg Mrs Derek Gadd, Mrs David Hill etc etc) on the basis of their Membership of the Monstrous Regiment of Women
* A Gentle-Eagle of course does not comment on Ladies’ looks or brains or how this qualifies them for high Political Office
Pete’s real sadness is that (as observed at the heroic Mr Guido Fawkes’s place) Pete spent £100,000 (or was it US$400,000 +) but he could only achieve 5th Place in the Election of Labour Deputy-Fuehrer, behind the Winner Mrs Jack Dromey
I flatter myself that I agree on so many things with the Lady ApilihP (while understanding neither the incisive Lady OttelitS nor that distinguished Equine Mr KStafford), but Pete indeed has alternatives to “Get[ting] sectioned, drugged and put in a home”, if (contrary to expectation) Mr Brown shews enough decisiveness to teach Pete that Political Life can be “solitary brutish nasty and short”
Pete could study for an Open University degree in Fairies … or the UK could appoint to join Mr Mendelsohn as a European Commissioner
Yr Grace’s obedt servant etc
GE
Jan 16, 2008 @ 21:40:12
I’m not quite sure I follow the “Peter Hain is a crook, therefore blame the women” thing. I mean, it’s not as if THAT got by on its looks!
Jan 16, 2008 @ 21:43:32
http://icanhascheezburger.files.wordpress.com/2008/01/funny-pictures-glowing-cat-tinkerbell.jpg
Jan 17, 2008 @ 03:30:37
I love how the “JOSH” banter ceased after you outed him publicly. Buy why, I must ask? Surely he could’ve debated further whether he fornicates with canines? I mean….at least for our amusement, right?
As for the fairy…The first photo must be the famed “mid-masturbation” shot I’ve heard so much about. :)
In the second pic it looks like they are about to roll him into, well you know. Dude, there’s even stems and seeds on the paper behind him!
Jan 17, 2008 @ 05:18:36
I simply assume that ALL people who use all caps exclusively fuck dogs…or are fucked by them!
and yes, I wonder how high you get if you lace your doobie with pixie dust!
Jan 18, 2008 @ 08:25:56
hahahahahahhaha! XD
paper mache and leaves and we have ourselves breaking news!
Jan 18, 2008 @ 08:31:22
UNBEELEEVAR!
Jan 18, 2008 @ 09:41:05
Your Grace
I THINK … err …. i think for your german readers, your grace means unGlaeuber … or is that unGlaublicher …..
and, in a philosophy exam, as for WHY – why not or why not what
es macht man denken, nee
das ist es doch
yr grace’s obedient servant etc
ge
Jan 18, 2008 @ 10:22:20
Our German readers? BOTH of them? You’ll spoil the lads!
As for the philosophy question: define “why.”
Jan 19, 2008 @ 18:25:05
Ok, no offence to anyone who thinks it’s real but… if it was really a mummified faery, why has it still got {pretty clean looking for a faery thats been mummified} hair?
I’m really not trying to ruin anyones ideas on faery existance or anything but it sorta confuses me… Blessed Be! x
Jan 19, 2008 @ 18:59:29
Salena,
You are obviously painfully unaware of the advancements in fairy hair products over the last decade. They’ve got some wonderfully balancing shampoos and some conditioners that are to die for. We are, after all, talking about a “fairy.” Should we not expect it’s hair to be perfectly groomed? You don’t know many fairies, do you? You should probably get out more.
Jan 19, 2008 @ 21:46:28
We believe in fairies its said that every time a child says i dont believe in fairies a fairy somewhere drops down dead they are just little helpers of the earth
Jan 19, 2008 @ 21:58:31
well said, JTK – people like Salena should be ashamed of themselves. They have fairy blood on their hands thanks to their repeated denials.
How many fairies must die, Salena? How many??
Jan 19, 2008 @ 22:20:11
476
Gut gesagt, MeinPferd – Wieviel, doch, Wieviel
[well said, mine Equine, how many indeed]
We all know why the Britisch economy is in a mess – all these Monstrous Women like Mrs Jack Dromey & Mrs Derek Gadd running the Government & criminalising Catholic Adoption Agencies – and not voting for that nice Cephas Hain as Deputy Leader of the Party
Now that they’re all losing their Jobs at Northern Rock, it’s not wonder that so many Fairies have fled to Canada and taken to drinking Monsieur Metro’s ethylene-glycol-based-antifreeze
Das ist es, doch
Es macht man denken, nee
[This is it, init,
It makes yer fink, dunnit]
Jan 19, 2008 @ 23:01:55
wait this explains it! lot of poeple dont believe in them so all the fairys die some poeple or lot of poeple do believe they can see 1 fairy this explains it of course!! :O
Jan 20, 2008 @ 00:12:43
Stumbled over a Canadian group who were obviously fairy motivated.
Yup, we miss you dudes.
Herr Eagle – I don’t know how you could think there might be fairy related individuals in the cabinet – perish the thought!
Jan 20, 2008 @ 07:21:49
That’s why I can’t keep any booze around here. It’s the fairies! I bet they drank all Metro’s vodka, too!
Jan 21, 2008 @ 01:58:18
this is super scary!! :]
Jan 21, 2008 @ 02:13:36
Yes, the unsbashed fairy slaughter that Salena is condoning is extremely frightening.
Jan 21, 2008 @ 02:23:23
Indeed. As is the fact that they’re drinking all my booze!
Jan 21, 2008 @ 13:25:51
The Faerie kingdom is alive and well, if people can believe in miracles, why can’t I believe in Faeries?
Keep the Faery Dream Alive.
Woo, Australia.
Jan 21, 2008 @ 18:06:18
Aren’t the “godless heathens” the people that normally wouldn’t be so skeptical of something like this. It seems to me that a devout religious person would be the more likely party to question the validity of this “fairy”, mainly because we know of these creatures from FAIRY TALES, not religious texts.
Jan 21, 2008 @ 19:11:39
Ah but the very religious know that their truth is the only truth.
And if you’re a Muslim they definately don’t believe in fairies! I think they have another name for them.
Jan 21, 2008 @ 20:03:22
oh i wish faeries were real but… :C too bad… :C:C:C:C:C:C:C:C:C:C:C:C:C:C:C:C
Jan 21, 2008 @ 23:52:58
so i dont really care what that dude who “made” the dead fairy carcass says, even if its real or not, fairies are DEFINATLY real! They are either real in my imagination or really real in this world! I have yet to see one but who cares! I’m going to have fun believing and if they are real then thats one less dead one because i believe, i always have and i always will! I sat here and read ALL of these comments, and i like the theory that they could be some form of angels…who knows…but when people says God didn’t mention them in the Bible, you are right, but did he mention every type of crazy aquatic creature either? I don’t recall, and even though we are the only ones who were made in his image fairies are not in any way human like! =] so thank you, they are real =]
<3 Cally
Jan 22, 2008 @ 00:09:58
Well, SOMEBODY is drinking all my gin, that I know for sure!
Jan 22, 2008 @ 13:59:06
I hope what’s in my imagination isn’t real or I really had sex with… I need more gin.
Jan 22, 2008 @ 16:59:20
Who? Paul Reubens?
Jan 22, 2008 @ 17:42:09
Good painter he was, don’t think he was a fairy though. Maybe he got the fairies to paint for him – he probably hid the gin.
Jan 22, 2008 @ 22:44:50
Philipa, are you sleeping with a Muslim dipsomaniac painter? Do tell all!
Jan 23, 2008 @ 00:44:33
I have always wanted to be a fairy!!!!!!!!! :) Lol!
Jan 23, 2008 @ 07:31:29
Well you still may have the chance, if you live near San Francisco.
Jan 23, 2008 @ 21:11:08
Good grief no! I would never sleep with a muslim, you have to marry the bastards first – I’ve only ever slept with bastards I could get rid of.
(for those who think that a racist remark let me assure you that in my experience all men are bastards, regardless of their ethnicity or religious practice)
Never slept with a fairy though..
..at least I don’t think I have.
Jan 23, 2008 @ 23:23:34
@Philipa – so you are quite comfortable making blatantly sexist comments? Yet you are defensive about making blatantly racist comments. When are you going to begin making blatantly specieist comments and start putting down Fairies?
Fairy-hater! You are oppressing our dreams!
Oh goody – this can now move in a new direction!
Jan 24, 2008 @ 02:50:34
I think this shitts bad ass dude I would if faeries were real as long as they werent hurt & they werent skankishly dressed lol…probably impossible…I WANNA BE A FAERIE!!.or be a draenei from world of warcraft
Jan 24, 2008 @ 09:10:39
Her Grace La Marchionnesse de WitchHampton under Buzzard etc
Your Grace
AerChie hat recht [A. hits the targets yet again]
Doomed – We’re all doomed
498 … Yes – another thread record must be transmogrified
Ducks …. and ever more Qwacking Ducks are coming home to roost, as Gordon Bruin’s Weputation for Economic Pwudence & pwomoting Monstrous (lightweight) Ladies gets ever stranger
…. and ex America semper aliquid novi [always something bizarre from the Land beyond the Rim of the Known World] – oor Hilary gets ever closer to the generous Trough at 1600 Pennsylvania Avenue
In the Best of Colonies, large Animals face the twin threats of Specie-ism und Size-ism, when SMALL (… err … small) predators like Falcons & Beavers get the best posts from the SreggolB most distinguished
AND what about the Workers, including that puir Mesonychoteuthis hamiltoni ending in the forced accommodation of a Giant Kiwi Fridge en route to Japanese Kalimari Dishes with Sliced Whale slivers
Doomed – bring on the Hoses, save the Panda
I have the honour (… ummm … honor) to remain your Grace’s obedient servant etc
G Eagle
Jan 24, 2008 @ 09:48:35
ArchieArchive – you are correct; I have no conscience making sexist remarks, indeed I consider it a sport. In fact I guess many men would agree with me – with regard to the opposite sex let us sport while we may.
Gin helps.
Apparently the fairies keep drinking the gin :-/
Sushi – what language are you communicating in, pray?
I speak Eagle. Save the panda.
(never eaten Panda)
Jan 24, 2008 @ 10:32:51
It’s not racist: it’s religiousist!
Sushi/Chelsea, you can’t be a fairy until you pick ONE name.
Philipa, pandas are buddhist. Would you eat a buddhist on a first date?
DING! 500!!!!!
Jan 24, 2008 @ 11:51:03
@Philipa, I also enjoy making sexist comments but I’m not really sexist, I just like to poke fun at lesser mortals – - -
@His Greyness, the flighty one, How will the hoses stop the Tory promoted globular warning?
@Rain, Pandas are delicious in a white wine sauce.
Gin is but a fading memory. Along with Port and Chardonny. Living in a dry community can be HELL!
(Let’s aim at 600)
Jan 24, 2008 @ 16:37:18
Raincoaster – I wouldn’t eat anyone on a first date, nor the second. Ok I might have a nibble on the second.
Hee hee, Archie – you like to poke lesser mortals?
Jan 24, 2008 @ 18:17:49
raincoaster Dec 20 at 6:06 am “… with all porridge-related medical conditions, it’s best to give them 48 hours to solve themselves before bringing in the hoses”
Bonjour, Herr AerChie
I dinnae ken how HOSES will save the Planet – but her Grace has revealed their efficacy for (among other illnesses) Persistent EdgirroP-itis
C’est tout tragique for such a young man to have run out of White Port – no wonder the Colonies are succumbing to Labour … peut-etre that puir wee Faerie succumbed to a stroke induced by high blood-pressure upon witnessing the last-surviving White Port flagon passing from left to right
Alles Gute
G Eagle
Oh, BTW, in your Place, everyone will enjoy your Shark-Embracing non-Buddhist Oktopus …. but Is it wise or prudent to poke the Lady ApilihP – she may turn her last Tree-Oktopus on you …. unless of course she’s already fed it to some random Buddhist ….
Jan 24, 2008 @ 19:36:23
I never touched that random buddhist – I was framed!
Jan 24, 2008 @ 20:27:17
fake o.o*
Jan 24, 2008 @ 23:12:57
No, I assure you Philipa is entirely real. If she says she didn’t eat the random buddhist, she didn’t eat him and that’s that.
Jan 25, 2008 @ 03:31:20
@Philipa, most of those lesser mortals I poke tend to laugh – so I guess they find it funny – umm – is that what I meant to say? btw, I am not a random Buddhist – I am just random
Jan 25, 2008 @ 03:34:01
Is this poking a sneaky way to tenderize them?
Perhaps this poor fairy was poked to death! It’s all Facebook’s fault!
Jan 25, 2008 @ 03:45:19
@Herr G Eagle, I find oat pudding to be quite a worthy meal – unlike the fowl feuds eaten by the Sassenachs
Jan 25, 2008 @ 06:21:21
Which reminds me to do that Offal Shame banned haggis post.
Jan 25, 2008 @ 13:46:16
Offal Shame – - – grrrrrr
Please do – Pipe him in – my blog needs a stolen haggis – - -
btw, I poked Philipa and now she is speechless!
Jan 25, 2008 @ 17:09:22
elves and fairys are real!
Jan 25, 2008 @ 18:13:10
Well of course they are Patrick.
Archie keeps poking me to see if I’m done but that’ll never happen if he doesn’t turn me over!
Haggis, banned?? Yes that is an offal shame.
Jan 26, 2008 @ 00:04:22
Should I tell Buff you’re poking each other?
Jan 26, 2008 @ 06:13:45
Offal Shame? That is no way to speak of the great chieftain o’ the puddin’ race – - -
Turns Philipa over
Jan 27, 2008 @ 00:02:49
I loved the one boobie limerick Archie – they don’t make ‘em like that any more.
Am I done yet cause I think I need basting..
Jan 27, 2008 @ 01:39:01
Get. A. Room.
This is a fuckin’ KID’S THREAD YOU TWO! Goddam!
Jan 27, 2008 @ 04:18:59
Fairies are not just for kids!
Jan 27, 2008 @ 05:57:24
Are you saying you’re pan-sexual now? Make up your mind, man!
Jan 27, 2008 @ 07:18:33
I’ll explain after the children have gone to bed – - -
Jan 27, 2008 @ 09:17:11
Um… how kids are made?
Sorry Raincoaster, obviously the fairies bring them *hangs head in shame*
Pan-sexual eh Archie? How are the lost boys??
Jan 27, 2008 @ 09:56:38
That’s so funny, because when I was little my parents always thought fairies were trying to take us away. We live in a more enlightened time now, obviously.
Jan 27, 2008 @ 13:23:42
@Philipa, those boys are totally lost! The “Pan” part of the description is quite correct – Nymph chaser by nature, cloven-footed Capricornian by birth – - -
Have some Madeira, M’Dear
@Rain, Many an old wive’s tale contains unexpected truth!
Jan 27, 2008 @ 18:51:14
Raincoaster, I’m crying with laughter, this thread rocks :-D
Jan 27, 2008 @ 22:54:03
Rocking fairies? Pride week isn’t till August!
Jan 28, 2008 @ 01:31:39
i dont believe in fairies
Jan 28, 2008 @ 01:53:29
OMG, does anyone else hear that tiny, distant funeral march?
Jan 28, 2008 @ 02:39:15
Sucks to be you, bethany. I dare you to challenge the existence of fairies after seeing this definitive proof. This will blow your mind.
http://www.youtube.com/watch?v=nsShe6mN7EI
What say you? Shall you continue to deny in the face of prof?!?!?!?!?!
(oh gawd, rain….this is soooo much fun!)
Jan 28, 2008 @ 02:40:38
err….”proof” :)
One more for ya! :)
Jan 28, 2008 @ 02:58:45
Ah, yes. PeterPan. His site had three point five million hits the last time I saw it, and he had just proposed to his “Tink.” At first I laughed at him, but after some reading I’ve actually developed a real respect for the guy. He just loves being this persona, and he means all that pixie peace stuff just the way Oprah means her spiel. He’s a sweet, crazy guy and I admire him for being so public and for accepting that award in the way that he did (google it; I’m too lazy to find the link). Respect.
Jan 28, 2008 @ 10:45:11
Well maybe, but I’m afraid I couldn’t last out the full vid experience – only in America.
I’m a cynical Brit, what can I say? We have people here who live the Elvis experience – knock yourself out (as long as I don’t have to join in).
Jan 28, 2008 @ 14:42:13
Cynical Brits abound – wait, that makes you sound like a Kangaroo – - – (Kangaroo Tail is quite popular with the locals out here in the desert)
Yes, Rain, I am going to my room!
Jan 28, 2008 @ 14:45:04
Non, je ne regrette rien, – Sorry, listening to the Little Sparrow – a definite fairy person.
Jan 28, 2008 @ 17:28:30
Whenever anyone mentions a kangaroo I remember a little ditty taught to me by a reprobate some time ago that starts.. Tie me kangaroo down sport, tie me kangaroo down (shag a wallaby).. and it goes on.
I’ll spare you the rest, the fairies have probably been at the gin and you’ll only get grumpy, Raincoaster.
BTW, how is Snow White, still in rehab?
Jan 28, 2008 @ 23:59:27
Do they abound as well as the Four Hopping Ninjas of the Apocalypse? OMG, are they BRITISH??????
Jan 29, 2008 @ 09:51:26
So many are British somewhere along the line, we used to rule the world you know..
..and we have a Time Lord.
Jan 29, 2008 @ 10:29:03
He’s not British; he’s Galliffreyan, duh. I well remember his conversation with The Brigadier in which the B said, “It’ll have to be one of us, you know, we can’t trust the rest,” and the Doctor paused a moment, smiled craftily and said, “Well, naturally not. The rest are all foreigners!” to which the Brigadier nodded before he caught himself.
Jan 29, 2008 @ 12:39:13
Well slap my bottom and call me baby, you’re right!
Of course.
A smug Cephlapod is so.. other-worldly.
Jan 29, 2008 @ 23:14:58
Cthulhu is not in the least smug; he’s simply ravenous for souls. You’re projecting.
Jan 30, 2008 @ 01:28:29
HOLLY SHAZ!!!!
That’s amazing!!
I believe!!! *bows*
Jan 30, 2008 @ 03:08:06
Welcome. Spread the word. The Fairies depend on you.
Jan 30, 2008 @ 12:35:08
“Well slap my bottom and call me baby”
I was going to until I realised the children were not in bed. Rain is already annoyed at me for corrupting the miners – well, actually they were already corrupt but no one talks about it.
Jan 30, 2008 @ 19:52:03
Archie – blame Thatcher, everyone does.
Jan 30, 2008 @ 21:40:47
Not without good reason.
Jan 30, 2008 @ 21:46:16
I really think this fairy is real so dont forget to name her thinkerbell
Jan 30, 2008 @ 22:05:05
That’s a mighty fine name, given all the thoughts she’s inspired.
Jan 31, 2008 @ 00:52:01
I can’t blame the thatcher – my roof is tiled! I have no idea what is causing the wet spots.
Jan 31, 2008 @ 05:12:25
Cute!
Jan 31, 2008 @ 05:50:02
Archie, I would reply to that, but I have far too much innate dignity.
Jan 31, 2008 @ 09:07:26
Your Grace
THE 2ND BLAST OF THE TRUMPET AGST THE MONSTROUS REGIMENT OF WOMEN THATCHERS
Ich weiss nicht,was soll es bedeuten,
das ich so traurig bin
I don’t understand what the talented Anti-Soviet Deviationist Aerchie-Dude is saying
ABER (err … but …)
Methinks he doth protest too much
There is NO RAIN in the Western Anti=Podes, wherein resides such an incisive & entertaining Promoter of Human=Menacing Pseudo-Animals (Drop-Bears, Desert-Sharks, Tree OktoPodia & the Wild Antipodean Rudd-Creature etc)
ERGO the holes in his roof cannot pScientifically afford the explanation of the Wet Spots on his Floor
… nor can it be spilling White Port over the Cigars after the retirement of the Ladies – ALL the White Port in his Desert has apparently been consumed in a (SCHOCKINGLY) anit-Clockwise direction
WHENCE, as a more felicitous alternative to Mummification, so many UK Fairies have selected Metro-Land as a Target to emigrate to, instead of Van Diemen’s Land
Yr Grace’s obedt servant etc
G E
PS No Kangaroos were hurt or injured in the making of this Post – can the AerChie=Dude give us a similar assurance over his comments
Jan 31, 2008 @ 11:22:43
Perhaps those pussy-eating dragons have bitten off more than they can chew? And a large, invisible, and very, very satisfied Persian cat rests atop Archie’s house?
Jan 31, 2008 @ 18:00:47
Errrr … your Grace – it’s CHESHIRE cats who become invisible
…. but I rather apprehend that Pussy-Munching Dragons predate away from the Western Desert to avoid the witty taunts of the egregious Archie-dude [Homo Sapientissimus AerchiDudius Ferox et Lepidus]….
…. has anyone warned them about the perils of sampling M Metro’s ethylene-glycol-based-antifreeze saucer-offerings
Jan 31, 2008 @ 18:47:21
Er.. Hang on, Archie has a Pussy-Munching Dragon or Achie is a Pussy-Munching Dragon?
I’m so sorry, I’m confused Mr Eagle, Sir.
and who’s the homo-sissy fox?
I thought raincoaster was a fox..
and the fairy was dead (or if you’re in Alabama, deyad)
and archie was downunder…. !
Jan 31, 2008 @ 19:49:34
SRRY DONT BELIVE THAT
Jan 31, 2008 @ 20:04:54
No, it’s true, Raincoaster is a fox!
(I’ve seen the pictures)
Jan 31, 2008 @ 21:57:33
And that fairy is definately dead.
It’s an ex fairy.
Jan 31, 2008 @ 23:30:13
Archie is being haunted by a gigantic Cheshire/Persian cross?
That explains so much.
I’m not a fox. But I’m not a chick either.
Philipa: who did Archie go downunder on?
Feb 01, 2008 @ 05:25:53
Tch! Tch! One does not go down under on. One simply goes down under. And I never name names – except to ET – - –
I am terrified of cross Cheshire Persians. So is my inner dragon.
Feb 01, 2008 @ 05:58:03
But…
Why is your roof wet?
Feb 01, 2008 @ 08:21:13
Jawohl
WARUM ist das Dach [roof] des AerChies NASS [vet] – in a DESERT
und HOW MUCH is it his Inner-Dragon causing Global Warming in the AntiPodes, with the consequent flight of Fairies to the COOLER Environs of MetroLandia, with its high-class cooking even if gin & high-class beer supplies are being consumed
Feb 01, 2008 @ 08:36:01
I cannot tell – the children are not yet in bed, the fairies are listening and they tattle to Father Christmas so I wouldn’t get ant pressies – not a single gift-wrapped pussie, siamese, persian or even manx (although they do not have a tail).
Now, have I changed the subject sufficiently?
Feb 01, 2008 @ 08:44:34
@the nonumlauted MeinHerren GrEagLe, It is true my roof is quite dry for this is a desert. Yet the assumption that it was my roof which is wet was incorrect – the wet spots are lower! Possibly due to the excessive consumption of gin (and in its absence, absinthe). Why, last even I noticed the Port, of a sufficiently Ruby hue, being passed to the starboard. I was forced to leave the room in shock! That such ungentlemanly conduct could be tolerated in these climes where every touch of the true civilisation must be kept and celebrated. I fear there could be a stray Metrolandian masquerading as a gentleman.
Feb 01, 2008 @ 09:46:05
Sorry Raincoaster – in that piccy of you in a bedsheet I was sure I detected a bushy tail, my mistake.
Ah Absinthe – I hhave pahssed ohhhceans hov tihme to see youh; my favourite bad movie.
Archie you’ve changed the subject… back to your wet spots!? Modesty forbids me to comment further on this subject.
Feb 01, 2008 @ 12:39:48
Ahh Philipa, I do apologise for accidentally including you in the discussion of wet spots. May I say categorically to the assembled multitudes that we are just good friends!
There, that should clear your name and restore your reputation – - -
Feb 01, 2008 @ 13:04:12
Archie: you get ant pressies? Are you an ant?
If they never pass the port to starboard, remind me never to book a starboard cabin. It would be such a pain, having to go to the bar for it!
Feb 01, 2008 @ 15:15:01
That ant’s a mistake, emmet!
Feb 01, 2008 @ 16:36:24
Archie, well if you’re going to be like that!! :-|
Feb 01, 2008 @ 20:37:09
Look, I’m sorry but it’s been at least ooh 20 minutes and there has been no…. well.
I don’t know why I shouldn’t be included in a thread concerning DIY (I live alone) or wet spots (I didn’t always live alone yet have now steeled myself to the reality of DIY and have purchased tools), however, i don’t thatch,
but would quite like to be a fairy..
having done the dragon thing.
Feb 01, 2008 @ 22:29:10
“It’s been at least twenty minutes – ”
I’m sorry I rolled over and went to sleep. I was quite exhausted. From so much thatching.
Fairies are nice enough but for genuine excitement you can’t beat a dragon!
Feb 02, 2008 @ 01:48:43
Archie, you’ve obviously never worked in the fashion industry.
Feb 02, 2008 @ 07:31:43
Actually, Aerchie, anyone who chooses to beat a dragon will find the brief remainder of their life filled with a great degree of excitement.
Beating fairies can, so Raincoaster assures me, be fun, but is apparently less interesting.
Oh, and “thatch” is a rather crude metaphor, no? Why not simply go with the rolling granduer of “toupée”?
Feb 02, 2008 @ 08:54:05
How about “merkin?”
Feb 02, 2008 @ 13:56:04
@Metro, The Toupee has been trumped!
@Rain, there are too many merkins just south of your land border!
Feb 02, 2008 @ 14:22:12
Can’t argue with that!
Feb 02, 2008 @ 14:42:28
Damn, I guess that kills this thread – - -
Feb 02, 2008 @ 18:05:17
I like to beat my dragon several times a week. I usually end up with that same “final expression of Tutankhamen” look on my face that you see in the first fairy picture.
Feb 02, 2008 @ 22:51:49
Mein Pferd Stafford
It restores our faith in Equinity that it is a distinguished & witty Cavallo that keeps alive this thread, unlike the Fairy who maintenant is si tragiquement “late”
But perhaps beating dragons was nae the raison for the Prince’s unhappy death-grimace
… there may be une autre explanation pour le mort del Prince Tooting-Common – it may have been the prospekt of oor Hilary moving in to 1600 Pennsylvania Avenue
… but peut etre it was the terror induced by completing a US Internal Revenue Service Tax Return
It makes yer fink, dunnit
GE
Feb 02, 2008 @ 23:02:40
that is sooo not real its probably this artificial plastis head whats next ?? peter pn ?? lol …
Feb 02, 2008 @ 23:09:03
I agree that King Tut would prefer Obama, if only to have a relative on the throne again.
#’s, I can state for the record that neither the fairy’s, nor G. Eagle’s heads are plastic.
Feb 03, 2008 @ 01:15:45
While the Eagle may not have a plastic head, I feel sure that, as an espouser of Republican causes and a denouncer of the abilities of the distaff side, his head my not be filled with much at all. He allows his natural raptorness to take over when discussing the defenceless. Rather than dropping bombs, it may be necessary to export some Desert Sharks to Slough. Providing the Mars factory is protected.
Feb 03, 2008 @ 01:37:14
That’s so important. Good to see we are as of one mind in setting priorities.
Feb 03, 2008 @ 11:13:38
We need to do some research into the amount of plastic in Philipa’s head – I think it may be melting at the moment. And I should send her my patented anti-desert shark talisman.
Feb 03, 2008 @ 11:25:19
OMG!
is dead,’
Feb 03, 2008 @ 12:29:13
She’s pro-Tory, so no doubt she’s experiencing a bit of a meltdown at the moment.
felicia, you’re dead? Whoa, cool. What’s it like on The Other Side?
Feb 03, 2008 @ 14:16:54
I don’t believe you just told me P is a Tory Pro! Or was something missed in the translation?
And felicia is such a Goth!
Feb 04, 2008 @ 17:12:45
This must be Canadian speak, something we Americans have been trying to decipher for a long time.
Feb 04, 2008 @ 17:55:52
Well hey Americans have been trying to decipher the English language ‘for a long time’ and they haven’t managed it yet.
Archie – there is no plastic in my head thankyou, I decided against that operation; sorry to disappoint – do you prefer women plastically enhanced? Raincoaster is right; I’d really rather discuss politics just now. Given my aversion to plastic and the current Tory leader :-/
..he’s no angel but he’s no fairy either.
Feb 04, 2008 @ 17:56:44
Felicia – is anybody there??
Feb 05, 2008 @ 02:22:01
Weird….just saw Stiletto’s commment. I basically said the same thing in the forums yesterday. Yes people, fairies exist in more places than you imagine.
Philipa, was that a rhetorical question? :)
Feb 05, 2008 @ 03:58:16
He’s no angel, he’s no fairy, but he IS a Ken doll. I bet he stole those kids from Britney’s family; they drop them like dingleberries in the Spears clan, they’d never miss a couple more. And apparently Britney’s got an English accent… hmm, where’d she pick THAT up?
Feb 05, 2008 @ 12:29:54
Not a rhetorical question no, if felicia is dead and able to blog then I’ve a few questions..
maybe the first one would be to Raincoaster as she’s the tech expert – how would you ping a dead person?
Raincoaster – I should have said: ‘Raincoaster is right; I’d really rather NOT discuss politics just now’; with the exception of the fabulous Bozmeister I don’t think much of the rest and the Daily Bellylaugh just isn’t funny any more, I wouldn’t use it to wrap my chips.
Fairies are everywhere? So that is where all the socks go, one of every colour and pattern, just one.
Feb 05, 2008 @ 12:50:38
How do you ping a dead person? Easy: use the black Pingoat of the woods with a thousand young.
Vicus has been having some fun with Boris over on his blog lately. Lovely pictures.
Socks, of course, go through the wormhole generated by the vortex of heat and energy in the dryer. I thought everyone knew that.
Feb 05, 2008 @ 18:32:46
Not so. Socks make fine faerie sleeping bags. Just don’t ask where they get their MacIntoshes.
Feb 05, 2008 @ 20:40:39
Ha ha, excellent!
Metro still has it.
He should probably give it back but hey…
Feb 05, 2008 @ 22:18:02
The Ha! the Lady ApilihP says. Well, this is certainly unusual to say the least. I think you might be on to something here. So, I say Ha!
119 x 5 …. Ha !!
and BTW – where do Fairies get their MacKintoshes from
Feb 05, 2008 @ 23:12:06
Alas, puir wee EglAE, I knew him well.
Are you in pain, old friend?
For schurely only an illness of most grievous nature could cause such a vandalism of the Queen’s English.
A preposition is nothing to end a sentence with.
Feb 06, 2008 @ 01:06:29
Quite so.
I think they get them from the Trojans, don’t they?
Feb 06, 2008 @ 01:50:03
WOW YOU GUYS ARE SO REATARDED THATS SOOOOOOOO FAKE!!!!!!!!!!!!
Feb 06, 2008 @ 01:53:22
YOU PEOPLE NEED TO GET A LIFE YOU SMOKE TO MUCH CRACK
Feb 06, 2008 @ 01:58:05
And yet, somehow we’re capable of turning on/off the “caps lock” feature on our keyboards. It’s a fine line between ability and disability indeed.
And for the record, how much is “too much” crack? Is there an okay amount? Can you get some for me? What about for the fairies? They threatened me with harm if I could not produce more crack.
Feb 06, 2008 @ 03:51:44
That kid is “TO REATARDED” for words.
PS 600 Comments! YAY! < — see, now that is a legitimate use of all caps.
Feb 06, 2008 @ 04:45:33
I wonder what my contribution has been? I’m just glad that someone is championing the cause that fairies existed, or existed. I’m ashamed that none of our political candidates have expressed their views on this matter.
I challenge anyone for proof that fairies do not exist.
(Mwwaahhahahahahahaha)
Feb 06, 2008 @ 04:46:12
well, no better excuse for multiple postings than the common misspelling. “exist or existed” in the above. :)
Feb 06, 2008 @ 06:03:09
kstaff, you had comment #600! Also about twenty-five others. An excellent showing for a latecomer to the thread!
I think that Mormon has definitely stated that fairies exist, and they should be illegal.
Feb 06, 2008 @ 11:56:35
I think they are most definately illegal in the UK or they would have been taxed by now. Or maybe they have been made legal under this government – they brought in lots of airy-fairy laws.
I find that the secret of getting more crack and indeed more faries is to expose a big Bottom.
Feb 06, 2008 @ 13:31:52
Oh, Philipa, you should HEAR the British Fairies I know complain about their taxes! “And all going to those fucking schools! Damn Breeders!”
I think you are right about attracting more crack. Or you could just hire plumbers.
Feb 06, 2008 @ 14:27:55
I believe, upon reading, that faeries are actually attracted when the Bottom is actually concealed, rather than displaying large quantities of crack.
In some cases it seems to be acceptable if said Bottom is disguised as an ass.
However, I have also discovered why the faeries have abandoned the Albion Isles in favour of the Great White North: A sufficiency of fairies is often associated with the presence of a Puck.
Which explains so much about Junior A coaches.
Feb 06, 2008 @ 14:38:46
Ah, you see! If you wrestle with a problem long enough all is revealed! The connection between Junior A hockey and the de-Fairification of Albion. Wordsworth would definitely whip up an ode over that!
Feb 06, 2008 @ 17:15:25
Nothing wrong with a good Puck.
Or if you’re a fairy there’s nothing more attractive than a nice ass.
So I’m told.
Metro?
Raincoaster I think he already did as Fairies are not a new thing:
Fairy Land! Thee all men greet with joy; how few,
Whose souls take pride in freedom, virtue, fame,
Part from thee without pity dyed in shame:
But he may have been writing about Italy..(?)
Feb 06, 2008 @ 23:18:50
I believe in fairies
Feb 06, 2008 @ 23:23:44
@Pippa:
Of course I’m not a fairy. I’m a Metro-sexual. Also, not being a member of the Harperite party, I am not fossilized.
Though a nice Bottom always has my admiration; It’s always fun to play with a talented one … So I always consider that an asset. Or is that a miniature donkey? I forget.
However, as a thespian (yes, it’s true, I admit it!), I’m always up for a good Puck.
Feb 06, 2008 @ 23:31:36
Philipa: no WAY did Metro write that! Don’t let him tell you otherwise.
Layla, keep the faith. Belief in the self is the foundation of action.
Metro is usually up for just about anything in my experience. It’s one of his best qualities.
Feb 07, 2008 @ 04:33:26
A compliment?
You must have been dry for a few days now.
Feb 07, 2008 @ 05:31:09
I was going to make a comment about fairies but I realised it would be off topic – - -
Feb 07, 2008 @ 06:06:49
Metro: Days and days and days. It’s like dog years…an eternity, measured in shotglasses.
Fairies? What means this word “fairies?”
Feb 07, 2008 @ 09:37:26
I have no idea, but someone called Peter (who refuses to grow up) seems to like them..
Metro I was always of the opinion you were a Metro-sexual and simply assumed you knew about these things, which obviously you do. I too like a nice Bottom and have enjoyed a good Puck in my time :-) Unlike you though I’m always in receipt and not the giver – ah you theatre folk!
Layla – you believe, therefore you are.. and have to defacate. (Hey, defacation happens!) I too believe in fairies. I don’t believe in Archie though – he’s just a happy thought.
Feb 07, 2008 @ 10:42:48
Metro is very fond of a good Bottom, but methinks you don’t know as much about theatre folk as you claim if you think they’re all tops!
Feb 07, 2008 @ 12:26:30
JUST a happy thought? Do you realise, young Lady P, just how much hard, grinding work there is in being happy? Fairies won’t talk to me, I’m becoming a world champion curmudgeon and Thor is aiming at me! Not that I have any sympathy for Rain. I have been drinkless since last year! Late last year, admittedly, and the drought breaks tomorrow night!
Metro deserves wings – that way he can be a flying Puck – - -
Feb 07, 2008 @ 12:54:46
Canadians of Metro’s persuasion generally prefer buffalo wings. Try catching a flying buffalo some time!
Feb 07, 2008 @ 13:00:08
Archie I’m sure you’re most accomplished at hard grinding and I’ve heard tell that sort of thing becomes more difficult as you get older so perhaps you should have a little rest and a drink, for medicinal purposes. I hope you have a relaxing flaccid drink-sodden tommorow night x
Raincoaster, once again you expose my naivite – I know bugger all about theatre folk.
Feb 07, 2008 @ 13:17:55
You took the words right out of my mouth.
Feb 07, 2008 @ 13:49:53
Be fair – this is about fairies, probably wearing Fairisle pullovers, fairly new ones, so a little fair play would be fairly well in order. Planning for the fairies fairisle fair is fairly well under way.
I need a drink!
Feb 07, 2008 @ 14:55:37
Cripes! I wish you’d taken the words out of Archies mouth – is he quite well do you think?
Taken up knitting maybe..
I can see that knitting can be relaxing but I’d still rather have a good Puck with a nice Bottom thrown in for good measure. A good measure is important – hope you get one Archie x
Feb 07, 2008 @ 15:04:25
Sobriety. Only you can prevent it.
Feb 07, 2008 @ 15:26:57
Oh, I have a good measure – now I hope I get one – - -
I have no intention of preventing sobriety!
Feb 07, 2008 @ 22:30:40
“Good,” Philipa–”Is he quite good, do you think?” Or are you asking something else?
I could also use a drink. This is by way of being a ground state for me. Everyone was born with a certain amount of natural alcohol in their bodies. I just happened to be born two drinks short and have been trying to catch up ever since.
Unfortunately, after a Raincoaster visit it takes quite a while to rebuild the supply chain.
As for good measures, well the women hereabouts say sex is like snow. To a certain extent, I share this view. In that while it’s happening, I never see any fairies about.
Feb 07, 2008 @ 22:56:53
Measure for measure, I think it is rather good.
Feb 07, 2008 @ 23:48:46
Well Metro, I believe Archie is accomplished at hard grinding but of course I have no knowledge of the state of his tools for that activity. I think he should take a good measure, certainly, he seems to be in want of one and I know just how he feels as I indulged in a glass myself this evening, for community.
As for good measures, well the women hereabouts say sex is like snow.
I agree, it never occurs in my neck of the woods! If I remember that far back it was just like snow – something you’ve often dreamed of but the reality is a disappointing wet mess. How do Fairies make little fairies I wonder? Raincoaster will know…
Feb 07, 2008 @ 23:50:41
Measure for measure, my favourite Shakespeare sit-com.
Feb 08, 2008 @ 09:09:25
U know faries are true.There are also mermaids too.
Feb 08, 2008 @ 10:31:16
While measures are needed, I prefer taming the shrew – I once did the lighting for an amateur production of Kiss Me Kate which was Broadway’s version of the play. Wonderful fun even without a Bottom.
Feb 08, 2008 @ 10:48:08
Sex with Metro is like snow? Cold and slushy? It falls from the sky (like the bolt of Tash)? Flakey?
Feb 08, 2008 @ 11:23:04
I’ll have to take your word for it Raincoaster.
You lucky girl, you.
Feb 08, 2008 @ 12:04:21
Flakey? Don’t people usually use some kind of lotion for that?
Feb 08, 2008 @ 13:53:24
You obviously haven’t seen the advert of the girl in the bath.
Which unfortunately reminds me of David’s Marat.
Feb 08, 2008 @ 15:11:57
The girl in the bath – ahhhhh – Chocolate – another Vitamin C!
Feb 08, 2008 @ 16:28:58
Aparently chocolate mimics the effect of dopamine in the brain, I think – kinda simulates being in love, and is an aphrodisiac apparently.
Dunno about all that – it tastes yummy!
Unlike..
anyway, back to fairies..
Feb 08, 2008 @ 16:55:20
ewww is that real?
Feb 08, 2008 @ 18:06:11
Yup! Chocolate is real and sold in a store by you.
Feb 08, 2008 @ 22:06:39
So fairies taste yummy? Now we know why they are almost extinct! It is time your wonderfully left-leaning leaders put fairycide on the law books!
Feb 09, 2008 @ 01:59:56
Damn straight! Is it the Tories that are behind it? Oh my god! Thank god Boris has slimmed down; he’s obviously eating fewer fairies than he used to. I’ve always heard Tories had a fondness for fairies…
Feb 09, 2008 @ 15:39:01
Raincoaster!!!
*pip is speechless*
Feb 10, 2008 @ 04:45:24
Oh, they all went to boarding school. You know it’s true what they say.
Check out Guido’s blog for “Top Tory Totty” of the male and female variety. I’d venture to say that if the Tories were more equal-opportunity in the distribution of wealth they’d have had much more attractive men there. Some of those women are professionally “companionable” if you know what I mean.
Feb 10, 2008 @ 13:34:01
Let’s get this straight, Rain. You are saying that fairies are alive, healthy and swarming in the Houses of Parliament?
Feb 10, 2008 @ 13:41:52
Yes. They call them “researchers” and “Special Advisors.” Check out Guido’s blog!
Feb 10, 2008 @ 13:52:05
Yes but I’m not comfortable with the belief that Boris has eaten any fairies.
I know, I’m English and conservative, pass the macaroons.
Feb 10, 2008 @ 14:45:09
I, also, am skeptical of tales of Boris’ fairy-eating past. What is certain beyond the shadow of a doubt is that since declaring his candidacy for Mayor of London he has lost some weight, perhaps through a change of diet, and he has not been caught in embarrassing proximity to any researchers, fairy or not. There’s a long way to go till the election, though.
Feb 10, 2008 @ 19:27:21
I will always wish Boris well but I hate the thought of him not being an MP and in the house of commons – he should be there IMHO.
Feb 10, 2008 @ 19:30:34
The Mayoralty of London is but a brief interlude on his unstoppable rise to the top, I am sure. Hell, I wouldn’t be surprised to see him standing for EU president, his previous statements (including the book he signed for me) notwithstanding. One day he’ll be in Westminster again, opening Parliament with a crown on his head.
Feb 11, 2008 @ 08:56:56
Her Grace La Marchionesse de W etc
Your Grace
Quelle Night=Mare
The Middle-East Peacemaker ANTONIO becomes Il Presidente dell’Europa (Viele Volker, Ein Reich, Ein Fuhrer, Kein UmLaut) on his triumphant path to Wealth und the repayment of his mega-Mortgage – assisted by Cruella’s modest fees for giving Charity after-dinner speeches in the AntiPodes und elsewhere
BUT to the admiring amazement of his Grandad (last Ottoman-Sultan’s Foreign Minister), one can hope for der Boz-Meister becoming Londinium’s Mayor, in place of Red Ken, on his way to becoming El Presidente dell’E…
BUT where will Ken go – does he have an alternative to replacing ANTONIO as The Middle-East Peacemaker
No wonder Derbyshire Fairies have either given up the Struggle for Life or emigrated to MetroLandia, notwithstanding the Local Fairy-Predators and the perils of drinking from M. Metro’s Garden-Saucers
Your Grace’s obedient servant etc
G Eagle [5x13x2x5]
Feb 11, 2008 @ 13:54:31
Wot Herr Eagle said.
Antonio? *spit* ting!
Feb 12, 2008 @ 00:18:49
DUde its obviously fake look at the wings their Leaves for gods sake. At least try harder… By the way he used doll hair the hair has no dna. However the bones may be made of pigeon or chicken bones. Or maybe wood.
Feb 12, 2008 @ 01:07:33
How do you know the hair has no DNA? Where is your proof? One cannot make scientific postulates without backup evidence. Speculation is amateurish and unseemly.
G Eagle: [5×13x2×5]? I’m a blogger, dammit, not a theoretical mathematician!
Feb 12, 2008 @ 01:13:39
Good FSM! Bob could be right!
Amazing that the insight of a mere (as I picture him) beardless stripling, somehow crippled or deformed in a way that makes manipulation of the caps lock key and basic spelling a laborious chore, could somehow seize upon a detail that has for six hundred previous comments completely eluded older and sometimes wiser heads.
Feb 12, 2008 @ 05:17:09
Herr EaGle (Unumluated), “[5×13×2×5]” Would these be your co-ordinates in the Space Time continuum? By my calculations you should be able to see the vale of fairies from there. From Quentin Crisp (BBQ flavour) all the way to Oscar Willed.
Feb 12, 2008 @ 05:19:46
@Metro! Sir, your blasphemous reference to the ungodly FSM has been noted. The IPU Star Chamber is watching you – - -
Feb 12, 2008 @ 05:48:40
Archie, you’ve tasted the delights of Quentin Crisp? I always expected him to be more flowery…perhaps lavender, with top notes of verbena.
Feb 12, 2008 @ 11:18:27
That may have been in his younger days. Since his cremation he is definitely BBQ flavoured.
Feb 12, 2008 @ 11:35:48
Eew! You didn’t put it in your mouth Archie?
Eew :-P
Feb 12, 2008 @ 13:39:43
Well – yes – but I didn’t inhale!
Feb 12, 2008 @ 14:28:55
I think somehow he’d be rather delighted to have been snorted up like Keef’s dad.
Feb 12, 2008 @ 14:47:34
Gross. Honestly the things a man will resort to when in the desert; if it’s not ‘forbidden love’ with animals it’s getting your mouth around a fairy.
What’s being ‘snorted up’?
No, don’t tell me, probably something revolting concerning mummified remains.
And all for the want of a real woman..
Feb 12, 2008 @ 15:01:43
I really don’t think that the love of a good woman would have suited Quentin Crisp at all. He’d much prefer getting hoovered by some burly Australian.
Feb 12, 2008 @ 15:25:56
Hmn good point. He never dusted, you know, didn’t believe in it.
Feb 12, 2008 @ 21:00:26
Ladies, Quentin’s cremated remains were the original fairy dust – - -
Feb 13, 2008 @ 03:30:09
A big-burly Australian? You mean like Mark “Jacko” Jackson?
Remember him from the Energizer commercials?
“The new energizah, it’s gonna surprise yah…Oi!!!”
Feb 13, 2008 @ 04:57:37
No, I meant Archie. I think he’d be Quentin’s type, don’t you?
I prefer the young Steve Irwin, of course. Solid steel body and a distaste for clothing Those two traits go very, very well together.
Feb 13, 2008 @ 06:49:42
Rejecting the love of old Crisp
And feeling for him not a wisp.
I much prefer tits
Not Pommy halfwits
And lovers who don’t have a lisp!
Feb 13, 2008 @ 07:48:49
Well that pretty much rules out any Brits, eh?
Feb 13, 2008 @ 09:58:40
I feel utterly rejected.
Feb 13, 2008 @ 10:21:14
If you only spoke with a proper Australian accent…perhaps you could take enunciation lessons?
Feb 13, 2008 @ 10:28:31
“pommy halfwits”? I don’t think any accent is going to overcome that prejudice!
Nope, I’m with you on this one Raincoaster: “I prefer the young Steve Irwin, of course. Solid steel body and a distaste for clothing Those two traits go very, very well together” – shame he’s gone :-(
Feb 13, 2008 @ 10:30:35
…err …
[shifting awkwardly from one taloned foot to the next ... and back]
…. Perhaps your Grace means :
“AustrAAAlian”
Feb 13, 2008 @ 10:32:53
Perhaps I do. The mental image of a youthful, skyclad Steve Irwin may have addled me for perhaps a second or two.
Feb 13, 2008 @ 19:58:32
I think that God created everything for a reason, and maybe some poeple don’t beleive faries exist, but who are poeple to say what can exist, we only have one creater and his name is GOD, I strongly believe he created creatures we have not yet discover or found. I LOVE YOU ALEX
Feb 13, 2008 @ 20:23:55
So is his name GOD or ALEX?
Feb 13, 2008 @ 23:49:34
I want to know what a creater is…is it some kind of House Elf? A house elf named God Alex? Freaky.
Feb 13, 2008 @ 23:58:53
‘House Elf?” So that’s what those bastards are!!!!
Creater sounds like a performance enhancing substance to me.
Feb 14, 2008 @ 00:18:57
Maybe Steve Irwin was on it. If so, good stuff!
Feb 14, 2008 @ 11:50:21
@ Philipa; not all Pommies are halfwits – some of them are wonderfully talented. Oscar Wilde, Noel Coward, Queen Victoria, Philipa, Keir Hardie and Gracie Fields. JK Rowlings almost makes it to the list while CS LEWIS and JRR Tolkien are definitely on it. As is Dawn French. A pity about Maggie the roof repairer.
Feb 14, 2008 @ 11:51:30
I have left the desert and have returned to Perth. I watched the fairies holding up the wings all the way and they did a sterling job. Thank you Australian Flying Fairies.
Feb 14, 2008 @ 13:00:30
Glad you’re home safe and well Archie, well done fairies, and yes, I agree with you, it’s such a shame Maggie the roof repairer is now too old to hold office – she’s just what this country needs right now :-)
Happy pointless ceremonial day y’all x
Feb 14, 2008 @ 13:04:00
OSCAR WILDE WAS AN IRISHMAN, you antipodean barbarian!
Here are some Flying Fairies for ya:
Feb 14, 2008 @ 13:36:26
Hee hee love the vid.
Raincoaster is right Archie – Wilde was indeed an Irishman.
And Errol Flynn was an Aussie, mate, crikey!
Feb 14, 2008 @ 13:37:36
@ Philipa – GRRRRRR You are incorrigible! Does that mean you are insatiable as well?
Feb 14, 2008 @ 13:39:48
@Rain, He may have been born a Mick but he was tried under Pommie Law! and Yes, I have so many barbs stuck in me I am a definite, fully qualified barbarian!
Feb 14, 2008 @ 13:54:55
@Archie – I’ve yet to find a man that can stay the distance! (or stay in the room – please no-one tell me I’m scary again as I have no idea what ‘neebling means’ and you won’t tell me)
Well of course he was tried under English law – he was living in England at the time and taking a Lords son up the west-end farce, which was not only asking for trouble but against the law. Doh!
And I too am a Barbarian, I am NOT a Roman – Romani ite domum!! Bloody I-ties.
Feb 14, 2008 @ 14:28:10
yes, the English were like the Americans, always putting their own laws where they’re not welcome.
Boris is a Roman,though, Philipa. I hear he goes Roman every night.
Feb 14, 2008 @ 15:23:58
I won’t ask about neebling provided you don’t ask about farnarkling!
Feb 14, 2008 @ 15:30:36
Volo comparare nonnulla tegumembra.
Feb 14, 2008 @ 16:29:37
Raincoaster:
yes, the English were like the Americans, always putting their own laws where they’re not welcome.
um… you mean like their own country?? Hmn, terrible. And like the Americans??? I reject that comparison completely! The Americans would have been better off with us in charge but they would have the French..
If Boris in anything foreign Raincoaster, he’s a Turk.
And WTF does ‘neebling’ mean? You enjoy the torture, I can tell – may fairies raid your liquor cabinet.
@Archie, Age. Fac ut gaudeam.
Feb 14, 2008 @ 16:35:19
‘neebling’ – I came, I saw, I googled, I got nothing meaningful :-/
I’m trying hard not to laugh – it scares the children.
Feb 14, 2008 @ 20:19:52
That is the difference between those who come from Mars and thoose who come from Venus – I googled, I saw, I came – - -
Feb 14, 2008 @ 23:13:11
Faries come all the way from Mars, and Venus? That’s a long damn way! Through vacuum, yet.
Hmmm. Maybe that explains all that “cosmic dust” stuff the scientists are always rabbiting on about.
Perhaps the fairy above was exhausted? Maybe it isn’t so much mummified as fried by the heat of entry.
Feb 15, 2008 @ 00:38:12
I’m relatively sure England’s laws were unwelcome up the rectums of the greatest writers of the Victorian Age, every last of them.
I haven’t heard of Boris being in anything foreign: he prefers them home-grown.
Metro: so every time someone disbelieves in fairies, one falls to Earth as a meteorite, burning up as it falls? What a metaphor!
Feb 15, 2008 @ 01:37:06
Isn’t it though? That’s why I get paid to write workplace safety crap I’m increasingly convinced no-one bothers to read.
Tell you what, you can use it free of charge. Though I retain copyright under fair use.
Feb 15, 2008 @ 02:06:03
When have I ever used you fairly?
Feb 15, 2008 @ 04:32:13
I like the “fried at the heat of entry” hypothesis. Perhaps we can combine that theory along with one of the theories of how water became so prevalent on Earth. The “ice comet” theory.
We’ll twist it around and make it an “ice fairy” hypothesis. Clearly biblical creatures travelling through space time were bombarding the surface of the planet. The ice debris they “cooked off” or left behind gave rise to our oceans and saturated our atmosphere with water vapor.
In due time a giant monolith appeared and taught man to crush skulls with bones. Years later Genesis would pay homage to this awakening by featuring the Kroft puppets in the video for “Land of Confusion.”
The rest, as they say, is history.
http://www.youtube.com/watch?v=Fen3CePHFAU
Good lord I’m random today! :)
By the way, has anyone thought of doing a “mummified lolfairy” picture?
Feb 15, 2008 @ 06:18:22
Not as far as I know. Hint. Hint.
So, spaceships are made of snowballs? Honest to god, there’s a story about some would-be terrorists who trained in Canada and who were thinking about putting explosives inside of snowballs. I suppose they figured they’d need a getaway dogsled, too.
Feb 15, 2008 @ 07:04:00
700!!
Feb 15, 2008 @ 07:11:14
Git out! And me with no Champagne! Oh well, payday is tomorrow!
BLOG PARTY! BLOG PARTY!
Feb 15, 2008 @ 12:23:48
Only 700 fairies? Lets hope they can recommence breeding and we can get their numbers up further. Forget the champagne, Fairies need toadstools. Special toadstools. With red dots on them!
Feb 15, 2008 @ 13:52:01
You mean Red caps Archie? I’ve read they can be familiar, or was that A familiar.. no matter, 700 is enough for a breeding programme and they can be mischievous little breeders so I understand. There’s hope yet :-)
Feb 15, 2008 @ 13:53:34
Don’t know about Hinkypunks though, I think they are in decline :-(
Feb 15, 2008 @ 14:31:27
Oh yes. Redcaps. I seem to forget a lot of that stuff. Can’t imagine why. I believe I was in the 70′s but I can’t remember that, either. Just so long as I am not a Redshirt!
Feb 15, 2008 @ 14:35:38
Oh Madam, I must regretfully decline as well.
Feb 15, 2008 @ 16:28:18
Archie – Decline whom or what? A fairy?
Or decline generally??
Feb 15, 2008 @ 17:18:18
I am in a general decline – like a hinkypunk – it is downhill all the way. [sob]
Feb 15, 2008 @ 21:10:26
Senor KStaffordPferd
Well done – the Genesis Utube is so clever !!!
Yr obedt servt etc
G E
Feb 16, 2008 @ 03:46:04
Those were puppets?
Feb 16, 2008 @ 13:51:25
Some were puppets – I noticed the roof repairer made a live appearance – beer does wonders to the eyesight – I wonder if fairies drink beer. I hope they have better hangover cures that I do.
Feb 16, 2008 @ 14:02:41
I think I need some of that beer.
Feb 16, 2008 @ 15:20:18
I’m sorry, I drank it all myself. I didn’t even offer any toi the fairies but then they were nibbling on toadstooly things
Feb 16, 2008 @ 18:23:22
Toadstoly things? Like in the attack of the Mushroom people?
Feb 16, 2008 @ 21:09:14
Jawohl
Das ist es, doch
[This is it, i'n'it]
The Ha! you say. Well, this is certainly unusual to say the least. I think you might be on to something here. So, I say Ha!
Feb 16, 2008 @ 21:43:13
@Aerchie:
The thing about the toadstools it that you’re not supposed to nibble them yourself before offering them around …
Among other things, it’ll cut down on the number of fairies you have to share your beer with. Or you could just keep a swatter handy.
Feb 17, 2008 @ 02:43:08
Swotting Fairies? Why? Are they at Hogwarts?
Feb 17, 2008 @ 10:38:12
Hey, we are being lax here people! This post has slipped to #3 in Rain’s list! The Fairies will not be impressed!
Feb 18, 2008 @ 00:54:15
uh oh. There she is. I was wondering why i wasnt finding quarters under my pillow…
in exchange for all my teeth.
Feb 18, 2008 @ 00:57:45
Blame the coefficient of friction of the atmosphere.
Feb 18, 2008 @ 06:07:29
I mean, the US government is talking about shooting down some soi-disant “spy satellite” orbiting above us, but we know what’s really up there.
Thwarted in his ambition to organize a Glorious Democratic War in Iran as he did in Iraq, George the Lesser is striking at the heart of Queen Mab’s territory.
Feb 18, 2008 @ 07:13:20
I wouldn’t want to be him. I heard they’re building the library on a fairy hill. And we all know he can’t stand fairies.
Feb 18, 2008 @ 22:55:48
Yeah, as if the George Dubya Bush presidential library would be too big to be picked up and moved to another location.
Place’d be about the size of a phone booth and would contain nothing but Archie comics and books with chewable cardboard covers. Oh, and a few Sears catalogues with suspiciously worn lingerie sections.
Of course they’d need to keep the collection small, to allow room for the toilet and sink.
Feb 18, 2008 @ 23:40:13
Good heavens, Metro. What does that have to do with fairies? Are you implying something? And on President’s Day, too.
What did the President have on sale from President’s Choice today?
Feb 19, 2008 @ 20:49:45
Pretzels, one can only hope.
Feb 20, 2008 @ 11:11:04
Will this new Presidential Library have lots of coloured pencils so that the visitors can colour in all the pretty pictures in all the books?
Feb 21, 2008 @ 10:11:01
The fairy thread has stalled – FFS clap someone, quick!
Feb 21, 2008 @ 10:12:23
Of course that should have read clap, someone, quick – I wasn’t suggesting… well, anyway.
I do believe in fairies,
I do I do I do believe in fairies,
I do ;;-)
Feb 21, 2008 @ 10:28:15
Raincoaster – I saw this and thought of you – I thought the spiders looked very beautiful.
Feb 21, 2008 @ 10:59:04
Philipa, Archie does NOT have the clap. Shame on you.
“I saw these sea spiders and thought of you” awwwww. Words to warm the frosty cockles of my heart. I hadn’t seen the video, but I did read the article. Thanks!
Feb 21, 2008 @ 11:05:16
I meant it in a nice way :-) and as for Archie, well I have had this rash since…
well anyway, he’s back home and I’m turning to fairies again :-(
Feb 21, 2008 @ 11:37:37
You live in England, where there are always fairies all around you.
Feb 21, 2008 @ 11:59:05
@philipa, I thought I told you not to be rash! I have crayfish, not crabs!
Feb 21, 2008 @ 12:01:43
Archie you’re getting wierd now, crayfish? I think you should embrace a fairy immediately and let them work their magic on you..
Feb 21, 2008 @ 12:04:59
He’d only end up giving the fairy crayfish too.
Feb 21, 2008 @ 12:33:13
There are fairy crayfish? I didn’t know that!
Feb 21, 2008 @ 13:16:06
Well, maybe only 10% of crayfish.
Feb 21, 2008 @ 18:07:43
They have the freaking thing in a lab! and these people who are trying to find out if its true or fake are pro!i mean thik what you think but this looks too real for me.Also ( in a lab )!
Feb 21, 2008 @ 19:37:40
WTF is a dead fairy doing in a labrador?
I think he should be told off and sent for dog training immediately.
Feb 21, 2008 @ 22:08:30
Not only the fairy is in the lab. The OP is in there as well – bloody big dog if you ask me! I wonder if it is part fairy as well.
Feb 21, 2008 @ 22:15:34
It’s probably neutered at least.
Feb 22, 2008 @ 10:51:31
Best thing to do with a dog.
Do you think Archie should be neutered? It’s suppsed to stop them roaming but I just love the pictures and stories of his travels so I’d say no, even with the crayfish. I suppose a fairy could sort those suckers out but I’d still say no – what do you think?
Feb 22, 2008 @ 11:12:03
I don’t think we should neuter Archie. Buff would never forgive us, for one thing. For another, I understand neuters get along well with fairies as well, but are less likely to be invited to stay for dinner. If you want to know what they talk about at those parties, it’s probably best to leave Archie as-is.
Feb 22, 2008 @ 12:18:04
Well yes I’ve seen the benefits of a man being paid to sod off from under your feet (brother-in-law in the Navy) so I’m definately with you on this – Archie should remain un-fairyfied.
He may not agree though and may quite like the idea – give his crayfish something to do; for all we know it’s already happened!
Feb 22, 2008 @ 15:21:47
@Philipa:
If fairies could sort out suckers there’d be no Raincoaster.
While I have never seen fairy in a lab, I have occasionally spotted the fragments of wing or tiny teeth that are the result of fairies ending up in a cat or an owl.
I hasten to point out also, that as an Antipodean, Aerchie may in fact not have crayfish, although Moreton Bay bugs are a likely possibility.
Feb 22, 2008 @ 15:22:53
Um … only seconds after posting that comment the first sentence is mocking me. Need I clarify the squid reference?
Feb 22, 2008 @ 21:48:02
Nope, got that re: the tentacled one. The bugs look a bit frightening and every time I think of a huge crustacean I think of how they scream when dropped in boiling water, I know that’s supposed to be air escaping but… wouldn’t you if someone had dropped you in boiling water?? I like the advice: “demands a racy, dry and crisp wine to refresh the palate. Try a leaner style of young semillon sauvignon blanc blend. ooh! I’ll have a box of that mate! That reminds me of the fosters ad was it? They went to get a load of beer and put a bottle of sherry for the ladies on top of the beer in the truck and it collapsed, so did I, excellent.
I don’t think you get many fairies in the outback…?
Feb 23, 2008 @ 05:39:57
Babies. Babies make the same sound; it’s just the air escaping.
Feb 23, 2008 @ 07:18:02
For shame–to think of doing that to a baby. Everyone knows babies go with a boistrous red. Try a nice heavy merlot. Oh, and barbequeing keeps the wild flavour better than boiling.
Feb 23, 2008 @ 07:56:51
I live in the city: we only have battery-raised babies around here. Besides, you wouldn’t eat a free range Downtown EastSide baby, would you?
Feb 23, 2008 @ 17:56:21
Hey, you can’t make an omlette without cracking a few babies.
Feb 24, 2008 @ 01:00:36
Battery raised babies – Good, good , good vibrations – - -
Feb 24, 2008 @ 01:03:57
Veal should always be pan-fried!
(From the preface of “To Serve Man”.)
Feb 24, 2008 @ 04:01:21
I’m always confused about which fork to use, particularly when someone says, “Stick a fork in him: he’s done!”
Feb 24, 2008 @ 11:40:44
I prefer to use the “flesh falling off the bone method”. I have found that four out of five fairies use the same method, but we can’t show you their faces.
Feb 24, 2008 @ 14:09:34
‘To serve man’?? No thank you!
Quite right in not showing the faces of fairies – give a man a mask and he’ll tell you the truth, and I’m sure the same applies to fairies.
Feb 24, 2008 @ 23:21:49
Alas, in serving man, there is little discrimination between the sexes.
Feb 25, 2008 @ 08:31:23
On the contrary; it’s one of the few times I don’t object to sexism. “No, no, the book is quite specific. THAT is a man, THIS is a woman. You wouldn’t make pizza with “potato sauce” would you?”
Feb 25, 2008 @ 10:50:10
Raincoaster’s right Archie, and when it comes to serving either I’d really rather not see a future where the words ‘do you want fries with that?’ becomes my mantra.
Feb 25, 2008 @ 12:07:35
It is not the mantra that concerns me – it is when they are the last words heard – - –
“To Serve Man” is not a social etiquette manual – it is a cookbook!
Feb 25, 2008 @ 12:32:16
I’m not seeing the problem, Archie. There IS no “To Serve Woman” book, is there? Voila, no problem.
Feb 25, 2008 @ 13:21:04
Yup! Slap another sucker on the barbie :-)
Remember the scene in Green Fried Tomatoes and the Whistle Stop Cafe..
Feb 25, 2008 @ 15:01:16
Eating fairy dangerous for man
Feb 25, 2008 @ 16:14:34
Yep, saw that. Eating fairies has always been very dangerous, even before the spread of AIDS.
Feb 26, 2008 @ 00:24:06
I checked the “prankers” website and this is what it said, copied and pasted-
The 8inch remains complete with wings; skin, teeth and flowing red hair have been examined by anthropologists and forensic experts who can confirm the body is genuine. X-rays of the ‘fairy’ reveal an anatomically identical skeliton to that of a child.
It goes on, too. I DEFINETLY believe in fairies. raincoaster, I love this picture and now I have proof to my soul that fairies actually excist. Thanks for inspiring me with my manga/anime!
♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥
Falling thru the sky
♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥
And here is the link if all of you people want to check it out. Goodbye!
http://images.google.com/imgres?imgurl=http://raincoaster.files.wordpress.com/2007/04/dead-fairy-closeup.jpg&imgrefurl=http://raincoaster.com/2007/04/01/mummified-fairy-remains-found/&h=543&w=410&sz=50&hl=en&start=34&um=1&tbnid=ughnPcDNORMl6M:&tbnh=132&tbnw=100&prev=/images%3Fq%3Dfairy%26start%3D20%26ndsp%3D20%26um%3D1%26hl%3Den%26rls%3Dcom.microsoft:en-us:IE-SearchBox%26rlz%3D1I7GZHZ%26sa%3DN
And, this has the image attached to it that brought me to this place.
This time, I will sign off. Goodbye! (for real)
Feb 26, 2008 @ 01:24:59
There you go, doubters. PROOF!
Goodbye, and do let us know where you get to when you fall through the sky. What’s on the other side?
Feb 26, 2008 @ 13:12:51
I fully believe in fairies. I have socialised with them and I like their sense of humour. I only wish my girlfriend looked as good as they do when they are glammed up.
Feb 26, 2008 @ 19:09:39
But I do! Wings and everything!
Feb 27, 2008 @ 02:29:13
Well, we have yet to see THAT photographic proof. But the odds are good.
Feb 27, 2008 @ 13:39:54
When I’m wearing wings I can roller skate and wear tight white jeans and little flirty dresses in the disco, and ride a bicycle and do loads of things I couldn’t do before – wings are great!
Feb 27, 2008 @ 15:24:44
I used to be able to do all that; we called it The Eighties.
Feb 27, 2008 @ 18:06:19
Lucky me; I’m only in my forties. However some days I can empathise real well, especially after cheap chardonnay the night before :~} I blame it on the fairies – they won’t steal cheap white wine.
Feb 27, 2008 @ 23:23:04
There is your mistake – ask them to steal cheap red wine! A cheap merlot is always better than a cheap chardonny.
Feb 28, 2008 @ 00:48:57
I’m with Archie, but alas the fairies seem to prefer spirits. It must be the volatility.
Feb 28, 2008 @ 03:59:50
if you click on the picture where it shows the entire fairy, it will take you to another website, on that website if you scroll all the way down in red letters it says that it’s just a fake and the winner of some contest will get the ….action….figure thing…. so yeah. just thought you buttholes should know.
Feb 28, 2008 @ 05:44:18
Hey – we have a poster without a butthole!!!!
Now that IS an interesting thought – without a butthole he must be absolutely full of sh1t!
Miguel – are you totally constipated?
Feb 28, 2008 @ 05:50:04
Actually, Miguel, if you look at that site closely you will see that the retraction was printed some days after the original article. This could indicate a genuine retraction or it could be that he was contacted by the fairies and told to retract! Now, have you any proof, one way or the other?
Feb 28, 2008 @ 09:47:17
So the topic is now Miguel, his butthole, sh1t and retraction due to constipation. I recommend a curry, Miguel mate. Eat in a curry house no Indian or Pakistani ever would and results are guaranteed, especially on a monday night. Go for the phal and you’ll fly to the bathroom as if with wings. It’ll give the waiters a laugh too.
Feb 28, 2008 @ 09:51:33
I’m sorry you’re with Archie Raincoaster as I was hoping you’d be with us in the UK earning lots of money for doing very little (so the job description seemed to read). When I get my poor person pension (lottery win) you’ll have a first class round the world ticket and can see us both.
And anyway, Archie isn’t talking to me; I am in the wilderness of Archie’s private attentions – I blame the fairies.
Feb 28, 2008 @ 12:38:50
Eventually I shall be with you. If Cameron gets in, I figure I can get some cash out of his “Off the Dole, Into the Dosh” programs, teaching useless skills like Blackberrying and so on. And I’ve got the EU passport eligibility, so that’s bonus points: I can even work legally.
Archie isn’t speaking to you? I think it’s just that he’s concentrating on Miguel, who is as Archie so rightfully noted, full of something and it’s not pixie dust.
Where has that Eagle gotten to?
Feb 28, 2008 @ 13:08:24
Bonjour, your Grace
Cet Aigle is vishing dat he were in his Forties
Yr obedt servant
G E
Feb 28, 2008 @ 13:16:21
Ahh, young Philipa, I am not aware of not speaking with you – I have just come (sic) from making a comment on the latest of your postings. I have been rather quiet for the past couple of days but that was due to f**king real life! There isn’t a fairy to be seen out there at the moment. It is too hot and the humidity wrecks their wings! I think they have migrated.
Feb 28, 2008 @ 13:24:22
GE: Please don’t regret the passing of years: they are proof positive that you don’t give up easily, if nothing else. Besides, everyone loves a distinguished older raptor. No doubt Archie will make a pun on that in his next comment…
He has apparently been very busy f**king, or so he says!
Feb 28, 2008 @ 14:46:03
Ahh that explains it – I asked Archie privately if he missed anything of the desert even though he’s glad to be home; answer is obviously no, F*ck all! And yep, we’ve got all the fairies – Raincoaster was right (again!) there’s loads of ‘em over here. Cameron may need a Fairy co-ordinator. I’ll leave that one to you Raincoaster.
Mr Eagle Sir – ‘everyone loves a distinguished older raptor’
Feb 28, 2008 @ 16:10:21
Oh yes, I’m a hag from WAAAAY back. I’m terribly popular with fairies.
Feb 28, 2008 @ 17:14:07
I guessed you were part of the hags movement – creating high quality, innovative online environments that are aesthetically pleasing are one of the keys to HAGS success. You provide one of the largest ranges of virtual adult fun environments catering for a range of ages and abilities, from the traditional conservative & UniPlay/MultiPlay (in an election year) through to your innovative Agito collection for the hard-line left-wingers who spend a lot of time alone. Raptors are made as welcome as those with the softest of tentacles and most fragile of wings and other things.
You’re a star and maker of pleasures – what can I say?!
Feb 28, 2008 @ 17:20:44
Oh, pshaw! I’m blushing, and that looks TERRIBLE with the overall green cast to the tentacles.
Mar 01, 2008 @ 21:21:56
looks like burned barbie doll ;o)
Mar 01, 2008 @ 21:30:56
Can’t be; where are her tits?
Mar 02, 2008 @ 11:29:05
Oh! Do you want them back?
Mar 02, 2008 @ 14:03:24
Happy mommas day big blog momma.
And Archie, give Raincoaster her tits back, you’ve played with them long enough.
Mar 02, 2008 @ 16:25:21
RAIN’S Tits? I thought they were yours!
Oh, dats unleft – it is England’s Mother’s Day – We don’t have that in the antipodes until May.
Mar 02, 2008 @ 20:38:26
Long live the Mothman!
~m
Mar 02, 2008 @ 23:47:19
I had a fairy hit my winshield while driving home last night. It was still half alive when I pulled over so I just drowned it really quick in a nearbye creek. I figured that was the humane thing to do.
I started driving home and realized my mistake. I turned around, recovered the drowned fairy corpse, and drove immediately to the nearest freakshow, where I promptly sold the remains for a $250 profit.
Mar 03, 2008 @ 01:50:04
Now Philipa will want to know if it had Rain’s tits – - -
Mar 03, 2008 @ 02:03:42
Well I wasn’t going to say anything, but now that you mention it I do remember thinking the fairy had fantastic tits. I admit. I copped a feel as she struggled for breath. They were sort of squishy.
Mar 03, 2008 @ 09:01:35
Your Grace
2ND BLAST OF THE TRUMPET AGAINST THE MONSTROUS REGIMENT OF …
We approach another numerical milestone – it is refreshing that ===m should again shew a WISDOM beyond his youthful years by introducing such an elevated intellektuel tone with his suitably serious asperation
but one must ask serious pScientific Qvestions :
Wer ist der Mothman ?
UND
WHY are there apparently 2 widely-separate Mothman populations in West Virginia (wherever that is) and Charleston
Isn’t Charleston in South Carolina – the place where the YANKEES commenceated a certain infelicitousness with the Cotton States, in days when the Republikans seem to have been quite left-wing
…. and is it really the Amerikan Way to be content with such a lowly profit of $250 (£80 sterling) – wouldn’t he have got more by selling it on e-bay – British MPs (& their taxpayer-funded relatives) are much greedier
Yr Grace’s obedt servant etc
G E
Mar 04, 2008 @ 01:58:36
so, like, is this forreal….or is it just some lame ass shit again?
Mar 04, 2008 @ 05:56:36
Yes, Amy, there are fairies. They exist as certainly as love, and generosity and devotion exist, and you know that they abound and give to your life its highest beauty and joy. Alas! how dreary would be the world if there were no Fairies! It would be as dreary as if there were no Amy’s. There would be no childlike faith, then, no poetry, no romance to make tolerable this existence. We should have no enjoyment, except in sense and sight. The eternal light with which childhood fills the world would be extinguished.
Not believe in fairies! You might as well not believe in Santa Claus!
Mar 04, 2008 @ 06:18:27
Oh, just accidentally, in the absence of the hostess with the mostest, I will arrogantly post the 800th comment on this most excellent post.
Fairies Rule!
Mar 04, 2008 @ 10:38:48
Fairies do indeed rule.
And as for the hostest with the mostest – has she in fact been visiting Britain?
Mar 04, 2008 @ 11:24:47
So, kstaff is a necrophiliac fairy-molester? The things we learn about our commenters every damn day!
Mar 04, 2008 @ 19:48:26
This is so totaly absolutly fake ok but before everyone gose all death to the non-beliver i do beive veri mutch so i just dont think this is real there are fairies out there
sorry for any spelling mistakes i reali cant spell
bibi :)
Mar 04, 2008 @ 20:20:23
Boy howdy can you ever not spell. “Kiki” is spelled with K’s, not B’s! But if you are Kiki of Kiki and Herb you can spell it any damn way you like; drag queen’s perogative.
Mar 04, 2008 @ 20:36:59
Hey tht was harsh and KiKi is a name i pick up wen i was lik errrrrm 4 coz i couldn’t say out eles and it stuck
bibi=byebye lol
cya
Mar 04, 2008 @ 20:48:46
You can’t be bibi and Kiki: you have to be one or the other. I don’t make up these rules of the intertubes, I just report them.
Mar 04, 2008 @ 20:49:29
point made its kiki ok
Mar 04, 2008 @ 21:20:26
I am heartened and, indeed, even humbled at having helped you work through this identity crisis to a point of full personhood and resolution. Go forth, Kiki, and comment proudly!
Mar 04, 2008 @ 21:23:58
thank you oh great one for enlightening to the erroe of mi ways i will take your advice and go forth
Mar 04, 2008 @ 21:58:53
Is there no end to the miracles? SEE?!?!?! IT MUST BE A REAL FAIRY: IT’S MAGIC!!!!
Mar 05, 2008 @ 02:42:38
Indeed, but Kiki will not truly be enlightened until he hath molested a dead (or dying) fairy. Only then can true wisdom be reached.
Regarding West Virginia/Charleston – one of the peculiar things about West Virginia (beyond the literacy rate compared to the per capita volume of firearms registrations)is that it contains both a “Charleston” and a “Charlestown.” In other words, to my knowledge, the Mothman believing populaces are within the same stately lines of demarkation.
Mar 05, 2008 @ 16:00:18
Maybe it’s a tesseract, a warp in the space/time continuum which occurs in the presence of Mothman?
Mar 05, 2008 @ 16:52:00
then id rather not reach true wisdom thx
Mar 05, 2008 @ 17:09:02
As I was once told by this gorgeous guru (gura? guri?–Female type, anyway):
“No-one belives the truth anymore unless it’s attractively packaged.”
Which explains why so many people refuse to believe in this fairy. I mean, would a little moisturizer have hurt?
Mar 05, 2008 @ 17:17:29
but just cause this fairy isnt real dosn’t mean there not out there and its still guru
Mar 06, 2008 @ 02:42:53
Metro’s just not into elderporn. Ignore the narrowminded so-and-so.
And fairies are VERY out there; at least, all the ones I know are.
Mar 06, 2008 @ 07:16:03
You know, that puts all your “Great Old Ones” postings in a totally new light.
Of course your obsession makes sense; You will soon be an Old One yourself,if the ancient proto-Aramaic script written in an odd, dusty red ink upon the spider-skin parchment of your birth certificate is to be believed.
Mar 06, 2008 @ 16:44:54
Hardly: thanks to my terrarium-like living conditions in this haven of dampness and darkness, I look years younger than my age as my skin retains a fetchingly moist pallor.
Mar 09, 2008 @ 15:19:42
Re.”Regarding West Virginia/Charleston . . .”
Another peculiar thing about West Virginia – there is (or probably was, by now)actually a 7-11 franchise in the town of War. No faeries there, but I did find a burrito two months past its expiration date.
Mar 09, 2008 @ 22:14:40
Expired burritos tend to give me gas. As a child, my mother would claim the “flatulence fairy” had come to visit my stomach.
We should do some cheaply made, badly edited, home video and claim it’s further proof of fairy existence. I’m thinking some stop-motion claymation animation would be fitting and proper here.
Mar 10, 2008 @ 05:32:08
There’s a War in West Virginia? I didn’t know there was oil there!
Mar 10, 2008 @ 05:44:13
It is Bush and his geographically challenged advisers. They thought that was where Chavez was acting as President!
Hey, they were close – right capital letter and right hemisphere. They are getting better.
Mar 10, 2008 @ 08:12:20
Wah, Ahh do declayare, Miss Scarlet RegenCoaster
Wasn’t it OIL that made those demm Yenkeees to impose Democracy on Texas and those demm Rebel States in 1861
Yr obedt servant etc
G E
Mar 10, 2008 @ 10:50:23
Actually, oil didn’t really become an issue between the north and south until the kinfolk said “Jed, move away from there.”
Mar 10, 2008 @ 10:56:20
Well, the South needed oil for their panzers and luftwaffe, so the fairies had suggested they occupy West Virginia.
Mar 10, 2008 @ 11:46:42
Wait, I’m confused – are we talking Bavaria or the southern U.S.?
Know how you can tell you’re in southern Germany? They all sing Deutschland uber Y’alles.
Mar 10, 2008 @ 18:28:11
FFE, that Beverly Hillbillies reference was one of your best, but the second comment was not too scruffy either.
Just as long as nobody tells McCain about Alberta…
Mar 10, 2008 @ 19:09:27
Too late – McCain thinks Alberta is the peach capital of the world.
Mar 10, 2008 @ 19:15:23
ir is it that McCain thinks the main export of Alberta is hair clippers?
At any rate . . . weeeeeeeee doggies!
Mar 11, 2008 @ 01:11:33
Okay, those two went over my head. Or under it. Either way, what a time to be out of gin!
Mar 11, 2008 @ 01:51:38
It’s hell being a semi-literate American . . . .
Alberta peaches
Weeeeeee doggies: Jed Clampett’s favorite exclamation
Alberta clipper
There’s fodder for “John McCain is soooo dumb . . . .” jokes for you.
Mar 11, 2008 @ 21:50:56
MeinPferd der Graf KStaff
Just think
If those demm Yenkees hadn’t invented the Internal Combustion Engine for their Shermans and if Mr Lincoln hedn’t bin able to use the Internal Revenue Service to finance the Yoo Ess Army Air Force to make life so unPleasing for those kindly Chaps in der LuftWaffe
Yes, Sirreee, Virginia would’a kept West Virginia & its hosses and Robert E Lee would’a captured 1600 Pennsylvania Avenue with his Cavalry and painted it GRAY, a more congenial colour ( … errr … color) for the Fairy-Kind and Texas would have been in the Confederacy, instead of getting its revenge by sending Multiple Bushes to the White House
Well, this is it, init
G Eagle
AND America
Mar 12, 2008 @ 02:50:25
FIRST: Apologies if my responses to this thread are less frequent. Having recently passed the 800 comment barrier, it has also recently passed the ability of my browser to easily comprehend and/or open it. Nonetheless, remain assured that I am devoted to the cause of Fairy Realism and indeed only two days ago purchased a book on some chick called Opal who claimed to be in touch with the fairy realm. I shall report back once I have finished her memoir. She does look damnably familiar, like an atavistic survivor of some prehistoric cult or, come to that, a blood relative.
SECOND: I wasn’t under the impression it was the US Airforce, but rather the Army and Marines, that made the difference. The real air heroes of WW II (and I say this as the offspring of a Canadian Air Force Master Sergeant) were the British. No?
Mar 12, 2008 @ 08:12:57
Your Grace
Yes
Apparently, 40% of RAF Bomber crews came from the Dominions (Canada, Australia/New Zealand & Zuid Afrika)
…. but of course in 1939, folk in these Dominions (with complications in Zuid Afrika) regarded themselves as British and many continued to do so even into the early 1970′s
AND as an Equal Opportunity Bloggerizer you are, we trust, equally devoted to Fairy unRealism
Yr Grace’s obedient servant etc
G Eagle
Mar 12, 2008 @ 11:57:08
Damn, she dragged me back in . . . .
Axccording to the results of the Strategic Bombing Survey, U.S. precision bombing generally had little real effect on the war except when aimed at the oil industry/POL infrastructure. British strategic bombing again had little real long-term impact on Germany’s industrial capacity except when aimed at the POL. And most everyone knows that the Soviet advance into the oil fields of Rumania may have had a far greater impact on Germany’s oil supply.
That said, American and British bomber crews suffered the most fearsome losses of any Allied aircrew over Europe, with the possible exception of Soviet air personnel and the Luftwaffe’s fighter force.
Imagine being a Lancaster or Halifax crew blotted out by a Me 110 or Ju 88 nightfighter, or the experience of seeing your B-17 or B-24 disintegrate around you as your plane and a staffel of FW 190s close at almost 600 MPH.
But yes, one has to give credit to the RAF/FAA/Commonwealth/European pilots who hunkered down and defended the Home Islands in 1940 and on.
And the U.S. Navy pilots who were the ‘first team’ in 1941-1942 against the Japanese.
And the Russian pilots who managed to survive and succeed after the events of 1941.
Plenty of credit to go around
Mar 12, 2008 @ 17:34:43
Buon Giorno, Senor FFE
We should be cautious about accepting the Strategic Bombing Survey’s suggestion that U.S. precision bombing generally had little real effect on the war [admittedly, except when aimed at the oil industry/POL infrastructure]
Admittedly, US Precision Bombing was not very precise … and it seems that our German Friends did not really take ze War seriously enough to massively boost Weapons Production, until the Allied Bombing Campaign (and perhaps losses on the Russian Front) began to impact heavily
BUT just think :
1. Vast Quantities of Men, Artillery & Aircraft were diverted to defend Germany – how much damage would they have done if the Germans had been able to use them on the Russian Front, where a Russian Victory was far from assured until late 1944
2. How much greater in volume & effect would German Arms production have been, if the Bombing had not caused massive damage/distraction to German Factories & Transportation Facilities
3. Allied & Occupation Morale must have been massively encouraged by the fact that the omni=triumphant, omni-successful Germans were seen to be suffering massive retaliation – we were actually able to fight back
Tot siens
G E
Mar 12, 2008 @ 18:05:01
M. Eagle,
Granted, the psychological value of strategic bombing was undeniable, and it tied down a great deal of materiel and manpower. But its effect in bringing the war to a quick close is less clear.
I’ve been of the opinion that the most effective strategic use of airpower was the combined effect of Coastal Command, Army Air Force and U.S. Navy four-engined heavies and escort carriers against the U-boot threat. In that role, there was a much more dramatic effect in opening the sea lanes to vast quantities of shipping to support the operations against Germany and Japan.
Of course, breaching dams and putting continuous stress upon industry and transportation nodes didn’t hurt us either.
Mar 12, 2008 @ 18:05:29
and where’s dose fairies now?
Mar 12, 2008 @ 18:28:56
Jawohl
und vot indeed about dose Fairies … und let us not forget that dos Fairies were ready to swoop and decimate German Tank Produktion, if only dose USAAF Chappies had paid just one more visit to the Schweinfurt Ball-bearing Factory
G E
Mar 12, 2008 @ 21:56:51
Well, it’s clear that Fairies, like Switzerland, were entirely neutral throughout the War. This could have been very different, had the Germans hit a few specific locations in, ferinstance, Cornwall.
Mar 12, 2008 @ 22:08:21
… or Kalifornia
Mar 12, 2008 @ 22:35:52
True: there are lots of fairies in California.
Mar 12, 2008 @ 23:36:25
coolio! i BELIEVE!!! oh and sorry for the no-caps. i never get to do that… i totally think it’s real. fairies RULE!!! i spend all of my computer time searching for pics of fairies. oh yes, and Raincoaster, u rule, and mr smuggles/mr sum or whatever u call yourself, COULD YA USE ANY MORE CURSES???? jeez. and yes USE YOUR SPELLCHECK!! it DOES exist! i have an imaginary friend and she’s a fairy.
Mar 13, 2008 @ 00:08:50
See!!
Mar 13, 2008 @ 01:56:12
At least 40 of my dorm neighbors in grad school were fairies, and they dressed better than did my girlfriend. Go figure.
Mar 15, 2008 @ 12:32:44
My favorite use of WW2 airpower is when the antiquated WW1 “swordfish” of the RAF nailed the Bismarck’s rudder.
There’s just something about bi-planes attacking pocket-battleships that I find appealing.
Mar 15, 2008 @ 16:59:39
MeinPferd der Graf KStaff
The Bismarck Campaign was a classic example of the efficacious& gratifying deployment of superior sea-power
The 35,000 ton Bismarck was more than a match for any individual Britisch Battleship
eg the Britisch insisted on sending the Prince of Wales into battle with civilian contractors on board before its construction was completed – predictably, its guns ceased firing at the most embarrassing moment, even without the encouragement which our German friends were so eager to give
eg HMS Hood looked impressive, but appearances =flattered only to deceive – the Britisch had “economized” by failing to instal armour (… err … armor, in der Amerikanische Dialekt) at the rear and never got round to remedying this in the almost two decades of leisure that they had before 1939
UND the Bismarck had more than its fair share of luck
eg a lucky plunging shot hit the unarmoured rear of HMS Hood, just before she completed her turn to face her armoured front towards the Bismarck
ABER [but] bad luck, if you have enough of it, eventually evens out UND buffoonery in sufficient volumes eventually becomes a strength
We kept on attacking and sooner or later the blows were going to be effective
eg HMS Hood’s broadsides did not hit the Bismarck, but a shell did minor damage to Bismarck’s oil tanks, which became an increasing inconvenience as sea-water mixed with oil which thus became unusable
UND
Apparently, our German Friends could not believe how slowly the Swordfish were flying
Also [ergo], their sophisticated anti-aircraft guns were aimed in front of the Swordfish, at points where they thought the Swordfish would reach, but which the Swordfish weren’t fast enough to reach in time to collide with the German shells
and a lucky torpedo hit the Bismarck’s rudder, slowing her down and crippling her steering
Of course, any fairy on board could have told the German Kapitan of his peril and how to counteract the Swordfish, but one of the downsides of murdering large numbers of decent human beings & Fairies is that the Fairies had been terrorized off the Bismarck and were not there to give timely warning
Well, this is it, init
G Eagle
Mar 15, 2008 @ 21:11:49
“buffoonery in sufficient volumes eventually becomes a strength”
I think I just found my new motto.
Mar 15, 2008 @ 23:06:18
Good motto
but I wouldn’t attach it to WW2; people died and I wouldn’t attach any buffoonery to my relatives who fought in that war. War is nasty and bloody and horrible and many die horrible deaths, yet they still go out and fight. People are fighting and dying now in Iraq due not to a buffoon but a lying ambitious politician, may he never know a days peace. But he is not at the front line and won’t die. And that just makes me angry.
Mar 15, 2008 @ 23:21:18
And it is often buffoonery. I’m re-reading Flashman, the first one when he was in Afghanistan, and the monstrous slaughter because of stupidity would break your heart.
Mar 16, 2008 @ 08:35:52
But the stupidity is not from the men dying on the front line, it is from the lying git who caused the bloody war.
Just wanted to write that again just in case any people in other countries, like Australia or the USA, were harbouring warm cosy feelings over the Bliar bastard.
Sorry back to fairies..
Mar 16, 2008 @ 09:04:19
Oh, trust me, everyone in other countries has long since forgotten about him.
Except Iraq, of course.
Mar 16, 2008 @ 13:38:34
Funny – I thought Philipa was talking about our own head shrubbery.
I always revel in the irony that we helped create the monster of al Qaida in our own headlong rush to give the Soviets in Afghanistan a taste of Vietnam. Yes, we had an obligation to go into Afghanistan and finish that particular rat hunt, but no one in power here was going to own up to the real reason for that and 9/11.
As for Iraq? Well, I wouldn’t give Bush any credit for being particularly smart or intelligently ambitious. A buffoon, certainly, and led by the nose by avaricious, venal buffons with a level of animal cunning only marginally above most roadkill.
Mar 16, 2008 @ 14:40:37
oh WOW this looks like real shit I love fairies and unicorns are real too they have a breed of sheep or goat that have one horn that could be it and dragons? pfft. Comodo Dragon guys they do exist and when the stories have been passed down from generation to generation, their going to change thats how it happens just to show they ARE real better believe it.
Mar 16, 2008 @ 16:42:44
FFE has a point and I have to agree with *mysticfairy* – both Bush and Bliar look like real shit.
I think Unicorns are a moot er.. point, however..
Mar 16, 2008 @ 18:06:56
I’ve never heard of a “Comodo Dragon” before. Perhaps in light of the discussion of naval battles the noted *mysticfairy* was referring to a Commodore Dragon?
Although I can find no record of such on the HMS Hood crew list, nor on that of the Bismark.
Perhaps it was a slight mis-spelling? Those with connections in Ry’leh might be able to inquire whether Lord Dagon holds staff rank.
Or perhaps mf refers to commode dragons? Celebrated fantasist Terry Pratchett has noted that it is necessary to close the lid on the privy so that the dragon of unhappiness should not fly up one’s bottom.
He also notes that there was probably no such creature until people began believing in one.
Hence the picture above has been evolving, as more and more belief in dead, dessicated fairies accrues, it must be becoming more real. Therefore we should all believe in it …
Mar 16, 2008 @ 18:14:24
Nothing to do with faith on the dragon front (every man should have one) shutting the lid on the privy does not prevent the dragon of unhappiness flying up one’s bottom, although opening ones mouth too loudly does attract the little beast I’ve found, shh-it just happens, wherever you are.
Mar 21, 2008 @ 10:47:59
Ahhh, look at that. Now that those noisy humans have quietened down, all the fairies are sleeping. It is so sweet.
Of course the terrible Afghanistani situation which was causing the pesky humans to raise their voices could have been easily solved had the Empire not fallen and had Sir Sidney Ruff-Diamond and the kilted Third Foot and Mouth regiment been dispatched early in the conflict, the problem would have been solved!
The environs of the Khyber Pass have been decidedly unpeaceful for centuries. Why do the politicians of today think they can solve the problem now?
While Blair (and Howard) may have been gullible in respect of Iraq, it should never be forgotten that it was Bush and his cronies who told the bigger lies; told them first and told them loudest!
Now, let us tiptoe out and leave these fairies to their well deserved rest.
Mar 21, 2008 @ 11:30:16
Archie, let us hope no-one directs them to the works of Flashman. Nothing good can come of that.
Mar 21, 2008 @ 23:06:48
My great-uncle Flash was a cad
With ladies he was quite a lad.
Despite his great shame
My hero became.
Is that why I’m evil and bad?
Mar 22, 2008 @ 08:02:49
Yes. And why we love you.
Mar 22, 2008 @ 08:05:12
Also: mysticfairy, nobody who knows me doubts for a moment the reality of dragons.
Mar 22, 2008 @ 09:40:29
Ah so
As Chinese Ploverb say :
Do not despise the Snake
Who knows, she may grow into a Dragon
Mar 22, 2008 @ 10:16:53
Careful…I’m on painkillers and apt to be unpredictable. Uh. As compared to usual.
Mar 22, 2008 @ 11:38:50
Does this mean your unpredictability is unpredictable? So that, at unpredictable moments you will become predictable, or is your unpredictability totally predictable? And is predictable unpredictability true unpredictabilness?
Inquiring minds, once they have resumed normal service, wish to know.
Mar 22, 2008 @ 12:56:10
Her Grace, la Marchionesse de W etc
Your Grace
Jawohl
Enquiring & UnEnquiring minds alike DEMAND the right to know the ANSWERS to the Questions raised by the People’s Sage AerChius Dudius … or is there only ONE Answer and if so, what is the Question
… and, if you were a US Citizen, how would all this IMPACT on your choice of Demokrat Candidate for November
eg do you vote for oor Hilary with her reassuring Anglo-Saxon name and her undoubted appeal to US Dragons, but she seems to be a little fierce (this might lose the unMummifed Fairy Vote)
OR
Do you favour the Kindly Mr Obama, who presumably knows that Kenya is near Somalia but neither are in the Amerikas
This is all very Vorrying, with all those US Fairy Hunting Carriers in the Gulf
Yr Grace’s obedient servant etc
G Eagle
Mar 23, 2008 @ 19:18:44
WAT???!!!
i got lost at the unpredictable shindig
now i’m totally lost!!
so again i say WAT???!!!
Mar 23, 2008 @ 19:24:56
pleez re-explain to me cuz my brain hurtz
does anyone else’s??
i forgot to say
FAIRIES ARE DA BOMB!!!!!!!!
Mar 24, 2008 @ 00:02:04
@puppyluvz, I only ask the questions which must be asked. It doesn’t mean I understand them
Mar 24, 2008 @ 01:17:38
If I were a US citizen I would without hesitation defect.
Puppyluvz, thank you for informing us that you are confused. We, having read your comments, agree.
Archie: it’s hard to predict.
Mar 24, 2008 @ 12:35:10
omg this is sooooo cool!!! fairies rock!!! i’ve seen one before but wasn’t exactly sure and now i know for definate!!
also…well done on all all these comments, i hav bean shockingly entertained this last day and a half reading them!! lol. you do realise if it keeps going you’ll make it to a year running??
St. Calum
Mar 24, 2008 @ 12:56:58
Well you will get there first, St Calum. I’m only walking there!
Mar 24, 2008 @ 13:07:40
good point. not the athletic type myself! lol.
Mar 24, 2008 @ 19:39:26
Just so ya all know; I ain’t a liar. I’ve seen many fairies before…….. and once, about a week ago…… I saw a unicorn. The first fairy I saw was a cute little fella who just so happened to be in my hallway at about 11:12 p.m. The second time I saw a fairy was at maybe nine o’clock p.m. She was a very pale skinned fairy with black hair down to her knees. She was surrounded in a cloud of darkness…. I KNOW she had magical abilities.
I believe in fairies more than I believe in my brothers. :)
Mar 24, 2008 @ 19:41:39
Raincoaster…….. I worship you!!!!! You believe in fairies and are soooooo wise! Please respond to my previous post.
Mar 24, 2008 @ 20:02:20
Okay, I’m calling BS here and guessing that “fairy believer” is Raincoaster not logged in. :)
Mar 24, 2008 @ 22:16:13
Makes sense – she has been very unpredictable of late. Or so I have predicted – - -
Mar 24, 2008 @ 23:44:28
It certainly was not me. I’ve never seen the Fairy of Darkness, and I know for a fact that ALL fairies have magical abilities.
I’m quite sure this thread will go longer than a year. It’s the #1 source of search engine referrals to my blog, for some reason, other than “Britney Spears sex tape”.
Mar 26, 2008 @ 03:42:20
Thanks guys!!! I was SOO totally lost and had no idea what was being said but now I understand and yes I’m a US citizen.
FAIRIES R DA BOMB!!!!!!!!!!
and r way kooler than anything ever
i wish i could see one :’)
i’m jealous of any1 who has :(
Mar 26, 2008 @ 03:47:31
o yea
archie stop confusing me with ur predctable, unpredictableness!!!
GOSH ur so predictably, unpredictable at he most unpredictably, predictable times!!!!
Mar 26, 2008 @ 08:49:49
At SHE most unpredictably, predictable times. Please keep your genders straight: both this fairy and I are female, obviously. Just look at us.
Mar 26, 2008 @ 13:37:18
Sorry!!!! I meant to say THE most unpredictably, predictable times.
Mar 26, 2008 @ 14:35:17
unpredictable wat im lost
Mar 26, 2008 @ 14:36:44
+ wat in the world does puppyluvz mean
Mar 26, 2008 @ 14:38:15
i beleive that the fairy remains are creepy they give me thr shivers
Mar 26, 2008 @ 14:39:45
Yes, the fairy remains are creepy but do u believe in fairies?
we all want to know!!
Mar 26, 2008 @ 14:41:31
AND puppyluvz doesn’t have to mean anything i’m not stupid so i won’t use my real name!!!
DUH!!
:)
Mar 26, 2008 @ 14:43:52
maybe thats why i didnt use my real name
so im not stupid anyway u put it ill always say the im not stupid
Mar 26, 2008 @ 14:44:19
What does redmonk mean?
HMMMM!!!
Mar 26, 2008 @ 14:45:43
qwertyuiopasdfghjklzxcvbnmkghrtkjgyhdfjkshgkldfkhvliryiutjrehwklhfnksdnsdghjtghreblflirtfgjhynbnwillghjghjfjjflirtvfnxckjfhrkjbfnbvvbgfjdg
Mar 26, 2008 @ 14:46:23
wat??
Wat???
WAT????
Mar 26, 2008 @ 14:49:57
well there is a red monkey on top of my moniter so i thought that enstead of my real name because u never know if there is a computer haker on
Mar 26, 2008 @ 14:53:22
i dont even understand wat i said yet i laugh at my self HAHAHAHAHAHAHAHAHAHAHAHAHAHA!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Mar 26, 2008 @ 14:54:58
hurry up peop[le!!!!!!!!!!!!!!!!!!!!!
Mar 26, 2008 @ 14:56:00
is anyone on cause i think that im the only one on
Mar 26, 2008 @ 14:57:38
whatever
Mar 26, 2008 @ 14:58:41
im scared because at the jewel osco strp mall people are geting beat up for no reason
Mar 26, 2008 @ 14:59:49
WAT R U TALKIN BOUT
WAT STRIP MALL
WAT JEWEL OSCO
WHAT
Mar 26, 2008 @ 15:01:20
that creepy isnt it
Mar 26, 2008 @ 15:02:07
well i gotta type in the 900th comment so i gotta hurry
Mar 26, 2008 @ 15:07:01
i will now post the 901st comment
fairies are da bomb
FAIRIES are da bomb!
FAIRIES ARE da bomb!!
FAIRIES ARE DA bomb!!!
FAIRIRS ARE DA BOMB!!!!
yay
;)
Mar 27, 2008 @ 00:30:13
Thanks, guys! We are now unofficially the longest comment thread I have EVER SEEN. Maybe Gawker’s Foxy Brown one is bigger but I haven’t seen it therefore it doesn’t count, right???
900 comments and less than a year old! Couldn’t have done it without you all; hell, you did most of the heavy lifting.
Mar 27, 2008 @ 02:58:37
YAY
Longest one u’ve ever seen!
HMMM…
I’ve seen one before that was more than 1,100 and it was only up for 6 months. Thats where it stopped though. No one else said any comments and it just ended so i hope u guys can do better than that and i hope it keeps going and doesn’t end like that one did.
GOOD LUCK!!!!
KEEP POSTING COMMENTS!!
i know i will :)
Mar 27, 2008 @ 03:29:37
i have a question.
Why is it when people draw fairies or you look them up on the internet they are made up to be like they are the most beautiful things ever?
I mean it.
If you look up a fairy image on google you will find unaturally skinny, huge breasted women!
WHY?!?!?!?!?!
AND why are they so close to nudity?
Put some clothes on them!!!!
ITS NOT RIGHT!!!
raincoaster and anyone else who reads this please tell me because no matter how hard us women try we can’t and won’t ever look like that.
Plus, why do women have all of the looks standards!
we have to be skinny with big breasts or we are looked down upon. With guys you can be fat an lazy with gray hair and no one cares. If you think I’m lying look on the news. The guys can look however they want as long as they’re dressed up, but the women are very “perfect”.
WHY?!?!?!
Its not fair to the women!
IT NEVER HAS BEEN!!!!1
So please tell me raincoaster and anyone out there who agreez or disagreez.
I honestly from the bottom of my heart want ot know why us women have to be so “perfect”.
It makes me sick jsut thinking about it because I’m very tomboyish and I know I don’t live up to those standards.
Mar 27, 2008 @ 04:05:52
Well that’s easy. Women are not fairies: fairies are supernatural beings and so just as men don’t look like angels and kids don’t look like archons, women don’t look like fairies. Only a fool would expect them to.
Google image search is managed by pervs. It’s true!
Guys cannot look however they want without consequence. Fat, ugly guys are prone to being called fat and ugly. If you think that’s not true, you need to re-establish the balance in the universe by telling someone about a fat, ugly guy you saw. It’s only right and just.
Mar 27, 2008 @ 15:02:49
If you look on the news the guys are classified in two diferent catagories.
The young newbies, and the old fat guys in suits.
Seriously.
Maybe its only in America, but those are the two types of guys on there.
I’m not only talking about the fairies though. Women have always been treated as lower beings compared to men.
I wasn’t saying men had no standards for looks either, but women have more than I can count and it makes me mad. If women have that many so should men. Its only fair.
So again I will ask why do women have all the standards for looks?
Mar 27, 2008 @ 15:19:49
puppyluvz thats just hullaryous HAHAHAHAHAHAHAHAHA!!!!!!!!!
Mar 27, 2008 @ 15:20:38
i personally dont think that the fairy remains are real
Mar 27, 2008 @ 15:24:38
does any one else have the same feeling but they might just be real there is a slit possibilite that they might be but they might be fake fairy believer what do you think im pretty sure that you’ll say yes i think that fairys are real
Mar 27, 2008 @ 16:14:58
The thread appears to be slowly disintegrating into lolspeak. “Im in ur peet bogz, messin wif ur theerez.”
As to the reality of fairies, if I may borrow from the immortal Mr. Pratchett:
Mar 27, 2008 @ 17:20:38
WHAT METRO?!?!?!?!?!
Well redmonk if you don’t believe the fairy remains are real, do you think that fairies themselves are real?
If you think that fairies are real, than why do you not believe that the remains are real?
Mar 27, 2008 @ 17:21:30
what i don’t understand
Mar 27, 2008 @ 17:23:11
well i said that the might be real but the might not some times i believe in fairys but some tomes i don’t
Mar 27, 2008 @ 17:24:38
WHAT?!?!?!?!
PLEASE RE-POST YOUR COMMENT AFTER USING SPELL-CHECK
Mar 27, 2008 @ 17:27:54
well i said that they might not be real, but they might be
Sometimes i believe in fairies, but sometimes i don’t
It all depends on my mood
Mar 27, 2008 @ 17:28:59
well Puppyluvz what do u think?????????????????
Hmmmmmmmmmmm
Mar 27, 2008 @ 17:29:52
so is anyone else on beside me and puppyluvz
Mar 27, 2008 @ 17:31:42
How can you believe and not believe in fairies?
You have to choose one or the other, not both at the same time.
So do you believe in fairies or not?
Mar 27, 2008 @ 17:33:14
well ill believe it if i see it
Mar 27, 2008 @ 17:33:51
Do you believe in GOD?
Mar 27, 2008 @ 17:34:21
well yes i do so be quite
Mar 27, 2008 @ 17:35:45
Well have you seen him?
Mar 27, 2008 @ 17:37:13
yes in my dreams acculaly
Mar 27, 2008 @ 17:38:21
no acucally
Mar 27, 2008 @ 17:39:58
Well how do you believe in him if you havent seen him?
I believe in fairies and God and I have seen neither.
Mar 27, 2008 @ 17:40:46
well i have
Mar 27, 2008 @ 17:42:03
Right tell us about this then please.
Mar 27, 2008 @ 17:43:02
well then ok
Mar 27, 2008 @ 17:43:31
it all started back at the farm
Mar 27, 2008 @ 17:44:00
I have to ask first which have you seen God or a fairy?
Mar 27, 2008 @ 17:44:57
what farm
where is this farm
Mar 27, 2008 @ 17:46:51
i’m redmonk
Mar 27, 2008 @ 17:47:53
Well “mr. carpender/redmonk/my sister” please finish your lying story. we all would like to know what you saw on this made-up farm.
:)
Mar 27, 2008 @ 17:48:20
i was trying to be funny but it didn’t work and id like to say sorry to Puppyluvz
Mar 27, 2008 @ 22:30:16
it’s ok
you know that if you wouldn’t have told me at our house that you were my sister i would’ve never known!!
sorry for talking about nothing raincoaster!!
:’(
Mar 28, 2008 @ 02:11:49
Big though this comment list is, it still has a way to go to catch up with the 1533 comments which PZ Myers has attracted in the past 7 days with his tale of being expelled from “Expelled”
However, I don’t think that will have the staying power of the Fairies :)
Mar 28, 2008 @ 13:04:01
wow
Mar 28, 2008 @ 14:50:21
Wow, that is a lot of comments for only 7 days but it will never last as long as ours. Fairies are a big deal, whatever that is isn’t a big deal. So we will last long and we’ll get more comments than anything EVER!!
Mar 28, 2008 @ 17:25:44
i have to agree wit puppyluvz thats a lot but this site can beat ‘em easy
GOOD LUCK!!!
Mar 31, 2008 @ 03:16:34
its funny, i came across this site just as i was (still am btw) drawing a fairy xD
is this real? a part of me wants to believe it is, but then again, it could be made of plaster and the locks of hair could be some u just cut off and pasted on her skull
i do believe in fairies though
and elfs, and all sorts of magical creatures
and i dont care if that sounds noob, lol
fairies rock
Mar 31, 2008 @ 03:49:56
Ah, it’s time for my periodic Quentin Crisp comment . . . .
Apr 01, 2008 @ 01:50:45
FFE(former frontier editor),
I’m sorry to tell you this but I have never heard of Queen Crispin. I do not know why that is, maybe because I’m American, maybe not. You seem to know who they are so I am asking you to please tell me.
Thanx,
Puppyluvz
Apr 01, 2008 @ 02:12:26
Psh. I just love how you say the fairy is 2 inches tall, but when viewed held in hand it’s much longer than that. Are you even sure you know how long an inch is?
Apr 01, 2008 @ 19:34:37
Tear down all of our hopes and dreams. First Santa, then tooth fairy, then easter bunny,Whats next? GOD! You guy’s should the imaginary things. Take that for Ha. Bye the way I am twelve years old. Thanks for the dream crushing.
Apr 01, 2008 @ 23:10:35
And just think, sweet young Isabella, the worst has yet to come. You’ll get married one day and found out that you’re barren. And then you will concede what the rest of us long suspect – that God is dead.
MuHAHAHA!
Apr 02, 2008 @ 00:07:08
GOD IS DEAD?!!!
NOOOOOOOOOOOOO!!!!!!!!!!!
all this time I thought I was praying to a guy that is alive.
wait a minute…
God has to be dead to be in heaven so that means he’s partially alive right?
I’M SO CONFUSED!!!
and does anyone know where raincoaster has been?
she hasn’t posted any comments in quite a while…
Hmm…
Apr 02, 2008 @ 00:11:10
Puppyluvs – Quentin Crisp was an English fairy, now defunct, however hard you clap or believe in fairies – they come, they go :-(
Echo – when held in the hand an inch is always longer.
Stiletto what a joy you are but if God exists at all then he can’t die. Surely you missed an evil cackle on the getting married bit? The prospect of an unappetising buffet lunch for people she doesn’t know and never did like when she met these distant relatives as a child, all getting drunk on her budget while her shiny new husband sweats his way through ABBA and YMCA until finally passing out in the hotel room with as much passion for her as a dead fairy.
Apr 02, 2008 @ 00:26:56
Raincoaster is also an illusion.
Apr 02, 2008 @ 02:40:51
Aw c’mon Puppyluvz! I’m an American and I heard of Quentin Crisp years before the Internet.
http://en.wikipedia.org/wiki/Quentin_Crisp
Apr 02, 2008 @ 06:31:39
I am indeed an illusion. An illusion with a computer so b0rked it won’t open this thread most of the time. My apologies; it is heartening to know that I’m missed, if only because you want to keep your eye on the cougar in the room.
SG, what’s worse is you get married, find out HE’s a fairy. That’s the worst.
FFE, no pun? NO PUN? I’m shocked!
And it’s a well-known fact that fairies appear larger in photographs. They’re magical, duh!
Apr 02, 2008 @ 10:46:13
okay, okay.
Crisps – betcha can’t eat just one!
Apr 02, 2008 @ 12:30:35
totally myth!!!
all believers are mentally sick.
Apr 02, 2008 @ 18:24:09
FFE – eew! Laughing out loud but… ha ha haa
Apr 02, 2008 @ 18:45:35
hahah you guys are all crazy, I love it!
And don’t worry puppyluvz here in ottawa there is a sign on one of the churches that clearly states “Jesus is alive” haha no joke, I laugh everytime I pass it :P
And as far as this fairy goes…it is clearly a fake, but that doesn’t mean somethig doesn’t exist, especially because you say the word and everyone gets an image, if something isn’t real on any level then how can so many peole know what you are talking about. There is always a little truth in a myth. When you lose the ability to believe in anything magical at all or possibilities you have a sad sad life my friend :P
Apr 02, 2008 @ 19:46:01
I’m shocked at these as hoc dismissals of the fairy. Don’t you people see the EVIDENCE bag? That means the cops were investigating. I see no proof opposing the reality that this fairy is real. None. Offer it up if you’ve got it.
FFE: I certainly couldn’t eat even one.
Apr 02, 2008 @ 23:11:40
Glad to hear from you again raincoaster.
FFE: Quentin Crisp looks like the grandad on the movie “Luck of the Irish”, but thank you for giving me a site to look at even though it was wikipedia.(YUCK)
Stealth: Love the name and thats kinda funny because the bible says he died and the God subject confuses me because he is and isn’t alive at the same time, he can’t be killed which means he’s alive but he is up in heaven which is where dead people go.
So is he alive or not i need a straight answer, not a maybe at certain times, but a yes or no.
Please tell me
:)
thanks
Apr 03, 2008 @ 09:56:51
Puppyluvz – he is alive in spirit but not in body on earth, yet he is all around us. Watch the film ‘Nuns on the run’ – Robbie Coltrane does a good explanation in that.
Apr 03, 2008 @ 22:09:52
Oh God Tony Blair is launching his ‘faith foundation’ this year you can ask him.
Apr 03, 2008 @ 22:25:19
I have faith that his foundation is sound; he just needs to add some bench presses and yoga, and ditch the wife.
Apr 03, 2008 @ 22:26:54
I thought Cherie was the motivation to pray for some sort of divine intervention . . .
Apr 04, 2008 @ 13:10:13
In a humble attempt to immantise the Eschaton I note that there is now a post on Quentin Crisps
All Hail Eris! All Hail Discordia (No hemp scrip was exchanged in the posting of this comment)
Apr 04, 2008 @ 13:31:14
Test. This is only a Test If it works, I’m really, really sorry! :)
Apr 04, 2008 @ 15:43:47
I just found this site and it is Fabulous! Fairies are most assuredly real, I live next door to 2 of them and they are also Fabulous! Many are Queens and most have wonderful taste. NOT tasty (mere humans are not allowed to taste of the fairy lest they be drawn into the realm of Fairy forever, and I am trying to keep this clean…) I have asked one of the Queens to sprinkle those commenting with magical spelling dust and I was told to impart this one bit of wisdom: “I before E except after C or when sounding like A as in neighbor or weigh.” IM’ing is going to be the death of the Queen’s english.
Apr 04, 2008 @ 21:58:49
@dissfunktional; I think you may have upset the fairies with that one – they don’t have testes!
Apr 05, 2008 @ 01:12:57
Lady Mags, we need more fairy poetry in this world. That brought a tear to the eye.
Archie, what do you mean? Of COURSE fairies have testes. If there’s a Queen, there’s got to be a King, too, no?
Apr 05, 2008 @ 01:15:09
Quentin was the King of the fairies?
Oh Puck!
Apr 05, 2008 @ 01:16:25
Oh!
My!
GAWD!
It’s ELVIS!
ELVIS IS THE KING OF THE FAIRIES!
Apr 05, 2008 @ 01:25:00
[looks closely] Nope , that is some guy named Trent!
Trent is the KING OF THE FAIRIES!
Apr 05, 2008 @ 01:50:58
I think you may be right!
http://www.lolnin.com/?p=180
Apr 05, 2008 @ 02:58:40
See, I’m not just a pretty face – or as I have been told, not EVEN a pretty face!
Apr 05, 2008 @ 03:05:53
Which one are you in the picture? I think Trent is wearing the cloak.
Apr 05, 2008 @ 12:04:05
The dark one floating at the rear – - -
Apr 08, 2008 @ 01:19:23
How do we know this is a fairy?
Maybe its a pixie.
Do any of you know for sure its a fairy or is it just that calling it a fairy is the first thing that came to mind because it is more talked about. Pixies do exist. So do fairies.
Apr 08, 2008 @ 01:21:05
http://students.ou.edu/R/Rhiannon.Roblyer-1/storye
check out this site and tell me for sure if that is a fiary of a pixie if you can raincoaster
Apr 08, 2008 @ 01:22:55
http://students.ou.edu/R/Rhiannon.Roblyer-1/storyextra.html
sorry it didn’t copy the whole site
visit this site and tell me if this is a pixie or a fairy if you can raincoaster
Apr 08, 2008 @ 02:13:36
Oh, pixies are a whole OTHER issue. I’ve got a post about pixies coming up soon and we shall deal with them at that time.
That, in the picture, is DEFINITELY a fairy. Those Academic and Pre-Raphaelite painters knew their metaphysics.
Apr 08, 2008 @ 04:22:01
Well, if I married for money, it would be a dream come true! And if he were old, it’d be almost too good to be true! No wifely duties if you know what I mean. Plus I’d have the most styling house in town!
We both could take on lovers – he just better stay away from MINE.
Apr 08, 2008 @ 04:51:33
That’s my retirement plan. Go to Palm Springs, where all the rich showbiz gays retire, find a doddering Catholic with a mother complex, and ask him how he wants to meet his mother in Heaven. With “Mom, I was fucking the pool boy” or “Mom, I just got married!”
He wins, I win. Mom wins. Everybody’s happy.
Apr 09, 2008 @ 02:18:18
Marrying for money is totally the way to go.
Stilleto, if all the young women married older men for their money who would be left for the older women?
Or should we just forget the older women since they would probably be dead in a few years anyway?
Apr 09, 2008 @ 04:01:56
If the system is enforced, the older women will turn into rich widowed cougars and be bonking all the very young men.
OR
They could settle for the companionship of fairies. They wouldn’t be the first women to do so.
Apr 10, 2008 @ 01:13:49
HA HA HA HA HA!!
Honestly I wouldnt want to marry a fairy no matter how rich(or cute) because if it was true love I couldn’t put him through my death since they live forever or for a really, really, REALLY long time.
PLUS one of my standards for guys is that they have to be near my height(at most a few inches below) or taller than me.
Apr 10, 2008 @ 01:16:46
They also aren’t allowed to have any powers I don’t have.
Examples: flying, magic doing, ect.
Apr 10, 2008 @ 02:31:00
Well, fairies CAN do magic; just look at the makeover of Ashlee Simpson!
Apr 10, 2008 @ 23:10:24
Even they don’t have that much magic(or the ones who did it weren’t very good).
I would be jealous if they could do magic and I couldn’t.
Apr 10, 2008 @ 23:10:59
That’s why I won’t marry a fairy.
Apr 11, 2008 @ 01:43:46
Hey, fairies MADE Bette Midler’s career.
Apr 11, 2008 @ 21:34:23
O.k. I still won’t marry one.
:P
Apr 12, 2008 @ 00:21:18
More for me. Fine.
Apr 12, 2008 @ 00:49:02
“That’s my retirement plan. Go to Palm Springs, where all the rich showbiz gays retire, find a doddering Catholic with a mother complex, and ask him how he wants to meet his mother in Heaven. With “Mom, I was fucking the pool boy” or “Mom, I just got married!””
Tread carefully in Palm Springs. My very conservative Republican friend vacationed there and ended up calling an escort service and ordered up one of each! This after being rejected by a couple in a hot tub.
Very strange things happen in Palm Springs!
Apr 12, 2008 @ 01:36:05
Sounds like my kind of place, actually.
Apr 12, 2008 @ 08:07:35
I have come to the conclusion that fairies such. And they are proud of their technique!
Apr 12, 2008 @ 08:09:26
SUCK! Not Such!
Apr 12, 2008 @ 08:24:34
You’re giving coded messages in German and you expect me not to notice? FAUGH!
Apr 12, 2008 @ 17:33:42
Your Grace
Germanisch ist es nicht, because it would have read “suchEN”
Perhaps it is Thai – Thai is a language remarkable
eg the same word (pronounced something like “mew”) means “Cat” or ” Horse” or “No” – apparently it depends on the tone used for the word
Not many people know that
but perhaps it explains how the Thais avoided being colonized by the French, who have difficulties pronouncing their own Froggisch, let alone deciphering Tones
Yr Grace’s obedient servant etc
G E
Apr 12, 2008 @ 23:43:13
Looks like someone has their hands Thai-ed
Apr 15, 2008 @ 01:34:36
I want an obedient servant!!!! \/
..
__
My dog isn’t very good at that so its not fair.
I WANT AN OBEDIENT SERVENT!!!!!!
please? :(
Apr 15, 2008 @ 01:46:40
First, you have to get a blog. Then you have to be polite to G Eagle. If you’re really lucky he might bust out the Latin, too.
I, myself, always say “cat” or “horse” when I mean no.
Apr 15, 2008 @ 21:41:45
I agree – I have a blog and Mr Eagle’s comments are a joy, not that I speak Latin, or can remember much german – in fact I had occasion to remember some german and ‘geschwindigkeitsbegrenzung’ sprang to mind, at great speed. As I’m in the UK I’m amazed I didn’t get fined for thought crime over the national prescribed rate.
Apr 15, 2008 @ 22:52:30
Well really, how many times every day do we use ‘geschwindigkeitsbegrenzung’ eh?
Come on, people: ONE MORE COMMMENT!
Apr 15, 2008 @ 23:03:14
oH woow is amazing!
Apr 15, 2008 @ 23:03:16
oH woow is amazing!
Apr 16, 2008 @ 10:30:11
Are you over a thousand now on this thread? This month is the year anniversary of this post.
Let’s go for two? ;)
Apr 16, 2008 @ 12:28:12
Yes, a thousand and three I believe. The sky is the limit!
Apr 17, 2008 @ 19:57:50
No it isn’t.
Apr 18, 2008 @ 21:26:22
Philipia is right the sky isn’t the limit.
Neither is the moon.
Or the stars.
Can you guess what is?
Apr 18, 2008 @ 21:36:11
The ground.
Apr 18, 2008 @ 21:47:02
More like the gutter.
Apr 18, 2008 @ 22:31:00
Gordon?
Apr 19, 2008 @ 21:14:30
This is FAKE! look at the wings! if this was real they would not be there! there would only be bone and thats a maby!
Apr 20, 2008 @ 01:37:25
Again, as always, nothing but empty claims. I see no proof to back up your outrageous statements. Where can you show me an x-ray of a fairy indicating that the wings have bones? Do butterfly wings have bones? I think not.
Back to the drawing board, fraudster!
Apr 20, 2008 @ 06:08:07
The drawing board … where one has, presumably tacked down the specimen preceeding dissection?
Although I think the wings may, in fact, have bones. One of the local owls regurgitates pellets at the foot on one of our trees, the pellets usually contain quite a number of small bones.
Since owls are voracious predators, and nocturnal for the most part, their daily prey would include a fairy or two from time to time, fairies also being nocturnal (when did you last see a fairy in daylight?).
Therefore some of those bones must be fairy bones, QED.
We could possibly do a skeletal reconstruction, and in the process provide the world with it’s third known fairy sample. If anyone out there is particularly good at jigsaw puzzles, I could mail you some of the owl pellets.
Many of them strongly resemble those malted milk easter eggs (I think the steady consumption of fairys is responsible for the bright colouration) so you’d have to take them apart very carefully to avoid them crumbling.
Apr 20, 2008 @ 06:47:34
Metro, I haven’t seen any fairys in daylight. But then again, none at night either.
Yet, about the malted easter eggs thing.
I think my dog ate the fairy.
Apr 20, 2008 @ 07:41:29
@Metro, Owls have nightly fare, not daily fare.
And this false pumping up of the comment numbvers is obviously for the fairies – - -
Apr 20, 2008 @ 11:21:06
Wait- are you saying that OWLS lay those coloured malted eggs? Ewwwwww, gross!
Apr 20, 2008 @ 18:27:44
My Dad said something about malted eggs although I don’t quite remember what. He is an owl expert. I should tell him that the owls supposedly lay them and see what he thinks.
:)
Apr 22, 2008 @ 23:18:06
He told me I was crazy and all of you guys are crazy for believing in fairies and owls laying malted eggs. He also says he hates malted eggs and he can make that picture of the fairy using a program on his computer. I still believe it’s real though.
Apr 22, 2008 @ 23:51:47
He sounds like an embittered old man. Tell me: can he PROVE owls don’t lay malted eggs? Oh, sure, he’ll probably try to shortcut and bamboozle you by proving they lay regular owl eggs, too, but that is NO PROOF they don’t lay malted eggs as well.
As for his claims of computer fraud ability, I say the proof is in the Photoshop: let’s see what he can do.
Apr 22, 2008 @ 23:59:52
this feller wasn’t made via photoshop. i know that for a fact. i can prove it.
Apr 23, 2008 @ 00:56:49
Presumably the buyer will come forward at some point to clarify. I heard there was an autopsy as well; pretty hard to slip a fake past a coroner!
Apr 23, 2008 @ 03:09:53
Fairies not only exist but they keep us young!
Look at the dis-believers – they are all old! And getting older!
Apr 23, 2008 @ 03:51:00
That is undeniable. And no-one would call either of us “Mature” would they, now?
Apr 23, 2008 @ 11:50:24
A second childhood is a wonderful thing and full of magic
Apr 23, 2008 @ 12:19:54
Owl experts? How exactly does one get qualified as an “expert” on owls? Did he go to Temple University or something?
Apr 23, 2008 @ 19:58:27
He has owl the facts?
Apr 23, 2008 @ 20:53:05
Raincoaster, you’re a hoot!
Apr 23, 2008 @ 21:01:09
Takes pun to know pun.
Apr 28, 2008 @ 20:04:09
Your Grace
3rd BLAST of the TRUMPET AGST the MONSTROUS REGIMENT of TRENDY LEFTIES
Doomed
We’re all Doomed
Troubling events around the World may render Fairies desperate enough to resort to forced migration to Metrolandia
1. Tonight (Lundi) the BBC News (Science) website was reporting the imminent escape of a Mesonychoteuthis Hamiltoni from its (for us) previously-safe confinement in a New Zealand Freezer
* will Archius Dudius be safe from its arms, now that he has abandoned inland Perth for Coral Beach, within tentacle-reach of the Sea
* he will not get any protection from his heroic Promotion of Human=Menacing Pseudo-Animals – Drop-Bears, Desert-Sharks, Tree OktoPodia & the Wild Antipodean Rudd-Creature
2. From her secret residence outside the London Congestion Zone but within a Racing Pigeon’s Flight of Shepherd’s Bush, the Lady ApilihP’s plans are coming to fruition on Thursday – her Ladyship’s Friend (herein called “der BozMeister”) is about to triumphantly become Mayor of London, replacing the People’s Champion, Puir Kennetho Rosso (a Politician to be trusted with the People’s Money)
AND
3. What happens if in November that nice Mr Obama is unable to prevent oor Hilaareh getting a 4-year Lease of 1600 Pennsylvania Avenue – what then will save America from her ordering the US Navy to pass the Port to the Right
Very vorrying
Yr Grace’s obedient servant etc
G E
… nor can it be spilling White Port over the Cigars after the retirement of the Ladies – ALL the White Port in his Desert has apparently been consumed in a (SCHOCKINGLY) anit-Clockwise direction
WHENCE, as a more felicitous alternative to Mummification, so many UK Fairies have selected Metro-Land as a Target to emigrate to, instead of Van Diemen’s Land
Yr Grace’s obedt servant etc
G E
Apr 29, 2008 @ 00:47:22
G: How do you come up with those long messages? And how do you come up with some of those long words. I usually have to keep a dictionary handy when reading them.
I don’t know how he’s an owl expert he just is.
I asked him if he had proof and he said no its just not possible then he stormed off because I made him mad. Wonder why?
ttyl and ttfn
Apr 29, 2008 @ 11:19:41
1029
Guten Tag, Puppy-Luv
It is a Truth universally acknowledged that your Dad is a most veracious fellow, on the possession of whom you are most to be congratulated
En Arche in ‘o Logos, kai ‘o Logos in pro ton Theon …
Why, Ah doo declayah, as my friend Mr Bingley also so incisively observed, it really is hard on a Man [or an Eagle] to be reminded in the Evening of the Silly things he said in the Morning
… errr … Mesonychoteuthis Hamiltoni = Giant Squid
I remain your (& her Grace’s) obedient servant etc
G Eagle
May 02, 2008 @ 21:43:03
What does En Arche in ‘o Logos, kai ‘o Logos in pro ton Theon and incisively mean?
And why should I be congratulated?
Thanks
Pup
May 02, 2008 @ 21:44:42
Also G I noticed I think that was the shortest comment you have made on this list.
Pup
May 03, 2008 @ 08:00:56
Puppyluvz
Salve
DER BOZ=MEISTER REGIERT, DOCH
[Red Ken told to Get Lost by Grandson of last Turkish Sultan's Foreign Minister]
In the beginning was the Word (“Logos”) and the Word was with God ….
Your greatly esteemed Forebear is not only an Owl Expert, but he seems to possess a most insightful Mind, as well as having Offspring of great Intellectual Courage & Sagacity
BUT now aux affaires importantes, one of her Grace’s most distinguished Kommenters now moves in the most elevated circles of this Kingdom – she is a Friend of Effendi BozMeister, who was last night elected to High Office in Inglaterra’s largest conurbation
The Lady Philipa must NOW be treated with due & suitable respect by ALL (and that includes YOU, Aerchie Dudie)
Tot siens e buona fortuna
atque Vale
L’Aigle Gris
May 03, 2008 @ 08:41:17
Archie is of course well-known to Fairyland and is immune from ill-effects, at least as long as he refrains from really pointed criticism of the works of Liberace.
Philipa’s friend has manifested his destiny upon London; opponents may take solace in the fact that his influence is now local, rather than national.
If Hillary wins, she will let Bill do whatever he wants, same as always. Like, HELLOOOOOOOOOOO! TRACK RECORD!!!!!
Puppyluvs, none of us completely understand G. Eagle. It is an undertaking best ah, undertaken, with an Africaans dictionary in one hand and a Latin dictionary in the other. And a drink in the other.
May 03, 2008 @ 16:06:17
i beleve this how do u make all those efects what id like to see is dna resalts and test.my hobbie is studying faries.im only 11 and ive observed how to find faries ive lighsend 2 movies read books gone in certian stores 2 observe there atmosphere.if u asked me any ? i can anser
May 03, 2008 @ 16:09:37
I didn’t know I had three hands.
1)drink
2)Latin dictionary
3)Africaan’s dictionary
I’ll have to find that third hand soon or i swear my brain will melt with all the words G puts in his/her messages.
G: Thanks for ruining my hope for you finally making short comments.
May 06, 2008 @ 23:53:14
Amazing! but kinda sad, haha. Poor dead fairy :’(
May 06, 2008 @ 23:55:10
11:53 pm?? where the heck are you people, anyway??
May 07, 2008 @ 01:08:44
Well, they’re not so much “hands” as “tentacles” but you get the idea. Three full still leaves the rest for typing.
Where are we? I’m right here, fending off squirrels and distributing free albums for my boyfriend Trent Reznor. See the rest of the site!
May 08, 2008 @ 11:26:16
Sami
Je ne comprends pas
Are you sad pour la Faerie
or are you suggesting etwas about the Kommenters
May 09, 2008 @ 00:48:34
G: I’m sorry to announce that I will be no longer reading your comment because they make my brain hurt.
Sami: I think they’re European but don’t quote me on that.
Raincoaster: I would like to sadly announce I cannot find that third hand or any of the other tentacles I’m supposed to have. Please tell me where I can buy some(you can find almost anything nowadays that’s why I ask).
Pup
May 10, 2008 @ 12:08:01
La Vestre Grace
E troppo rico pour la manually-limited Puppyluvz a criticiser les Mots longs de l’Aigle Gris, quand la Puppyluvz a utile mots avec 3 syllables
eg Puppyluvz
eg mybrainhurt
eg dickshoneairie
eg tentacles
C’est plus tragique que apparentement cet Aigle en ne fait pas plus de sense in Norman=Francais que in Anglais
Au revoir et bonnes Vacances
G E
May 10, 2008 @ 12:39:57
est wai beyawnd mee.
May 10, 2008 @ 19:19:34
Those “wings” are leves people! Leaves! You have been tricked! Fake!!!!
May 10, 2008 @ 23:17:09
Of course they look like leaves – it’s a natural form of camouflage to protect themselves from nasty young boys like you who would rather pull the wings off flys than believe in something beautiful.
May 11, 2008 @ 00:25:29
Of course they are leves; that is how they leve-itate! Like, DUH!
May 13, 2008 @ 22:10:27
Leaves my ***. Your a fake and when the fairy army takes over the world and welcomes us I hope they do something horrible to you and you apologize for being mean.
:P
May 15, 2008 @ 17:04:35
Sometimes faith in hard to believe things, like fairys, brings hope that the unbelievable can and does exist. Absolutley Wonderful. I am a believer.
May 16, 2008 @ 01:22:59
That is terrific Gypsybarbi!!!
You know how scientists are supposed to make these important discoveries, I’ve noticed most of their discoveries are very unimportant. For example: if barbie were life size she would be 7’6″ tall;it is impossible to lick your elbow; there is a phobia for everything including fear of the peanut butter sticking to the top of your mouth.
Yes these answer questions people ask but they are not “important” to the way we live our lives.
That is another reason not to believe a scientist if they tell you there is no such thing as a fairy!!!!!!!!!
May 16, 2008 @ 16:51:32
i dont no but i think its a fake. r u sure its not april 1 it looks real but the world would go 2 extraordinary lenghts for it 2 b true
May 17, 2008 @ 03:30:03
I bet Gene Simmons can lick his own elbow. But no way would I let him lick mine.
May 18, 2008 @ 03:10:18
HA HA HA
I wouldn’t want him to lick mine either(EEEWWW!!!)
HA HA HA
pup
May 18, 2008 @ 21:02:05
This is all very vorrying
Wer ist Chaim Witz
und
Why would anyone vant to kNow
und
Wot hass he to do mit Fairies, ALIVE OR MUMMIFIED (ERRR I mean alive or mummified)
Und
Vot or Who is it that the sagacious GypsieBarb believe in
May 19, 2008 @ 01:43:22
You cheated G and put spaces inbetween your lines. Other than that that is officially your shortest message ever.
pup
May 19, 2008 @ 18:36:43
DaMMmmm…..w3l ! l0v3 f@!r!3s….. bUt !s d@t 3v3n p0ss!bl3?…. d3y f!nd w0rthl3ss dinas0ur f0sS!Ls wh!ch R sUpOsSed 2 b sTr0nGeR d@N d0s3 0f @ “fairie’s”…. n d3y f!nd d!s “fairie still intact….right…. fairies can decompose like dat n big ass dinasours cant?…
May 19, 2008 @ 22:20:09
1 don’t do that again to much work to read
2 fairies are way kooler than dinosaurs
3 fairies are magic and they can decompose slower and are way stronger because of the advanced burial techniques they are stronger
DUUHHHH!!!!!!!
Pup
May 20, 2008 @ 00:39:20
I think that’s right. After all, this fairy was supposed to be in a magical barrow, but construction turned it up if I’m not mistaken. NATURALLY you’d decompose slower than a dinosaur in a magic barrow.
May 20, 2008 @ 18:08:42
cool thats funnny+fake
May 20, 2008 @ 19:40:11
i believe in fairies, personally, and im really sad if it is fake, and really happy if it isnt, no matter what anyone says, but its also kinda scary knowing that them and sprites have a little temper on them.
May 20, 2008 @ 21:02:58
ITS NOT FAKE!!!!!!!
If you don’t believe in fairies why were you researching them in the first place? My answer: Your a self-centered jerk who believes in fairies and if anyone found out it would be the end of you.
Pup
May 20, 2008 @ 22:09:54
Pup, just ignore the h8erz. They make completely unsubstantiated claims. Anyone could have purchased the body on eBay and performed a scientific investigation. These people did not. Why? Because they’re afraid of what they might have found!
May 21, 2008 @ 07:31:10
It is a Truth Universally acknowledged that the intellectually perceptive Pup shews a wisdom in advance of her youthful years in favOUring FaEries over Dinosaurs
Faeries (especially the Mummified Dead) pose no health risk to People
Dinosaurs (especially the Meat-Munchers, when rampaging over the Planet in the Good Old Days when this Eagle was young) would have relished varying their diet with the occasional Homo pseudo Sapiens, if only they had then been around before the Myth of Evolution had been invented
…. but the Spelling :
….. cenTREd … perlease
G E
May 21, 2008 @ 08:00:20
ay de verdad qe no lo puedo creer.. no se cuando fue este suceso.. no es que no crea en hadas y esas cosas, solo que me parece increible, me gustaria que me informaran mas sobre este suceso…!
Dios que caso tan extranho..!
May 21, 2008 @ 08:39:14
I don’t know what that means, but it sure sounds dirty.
May 21, 2008 @ 12:30:27
awsome..!!!
May 21, 2008 @ 21:32:30
Are you serious? You guys actually believe this without an autopsy report from LEGITIMATE sources?!!!! A forensic FBI evidence bag and latex gloves hunh, is that all it takes to convince the likes of you people?!!! Aw man, its time to make some money on the internet!!! Hey Bobby, get the Santa, Easter Bunny, and sasquatch suits out! We are gonna makes some believers today! All we need is latex gloves and zip lock bags and we “are in like Flint”! And people actually went to school for forensics, “Ha” I say! Yeah, more like ha ha ha ha ha ha ha ha ha ha ha ha…..
May 21, 2008 @ 22:57:47
Oh please, Pretentious-1, go back to where you came from. Obviously you’re not actually scientific, because science involves reading for comprehension; that is NOT an FBI evidence bag, it is a Derbyshire police evidence bag. Derbyshire is not even in FBI jurisdiction. Honestly, you people are so transparent!
May 21, 2008 @ 23:20:28
bonie, what is awesome, the fairy or that we believe?
May 21, 2008 @ 23:45:43
wow is that real…its kinda hhard to belive i mean where did u even “find” it
May 22, 2008 @ 00:08:52
On Fark, of course!
May 22, 2008 @ 09:25:01
Your Grace
Nothing Spanish escapes the understanding of the RegenCoaster Abwehr – Spanisch Section
Alejandra May 21
“ay de verdad qe no lo puedo creer.. no se cuando fue este suceso.. no es que no crea en hadas y esas cosas, solo que me parece increible, me gustaria que me informaran mas sobre este suceso…!
Dios que caso tan extranho..!”
Wow, I really can’t believe it… I don’t know when
this happened… it’s not that one doesn’t believe in fairies and that type of thing… it’s just .. that it seems incredible, I’d like to know more about this. God, what a strange case.
We remain Your Grace’s Spanisch-Translating Servants
etc
May 22, 2008 @ 09:42:04
I did not know that Eagles were quadrilingual (English, Afrikiinda, Latin and Spanish).
May 22, 2008 @ 21:00:30
I’m learning french and I know a little german so I have 2 more.
:)
May 23, 2008 @ 00:49:08
And I’m fluent in Profanity. Excellent!
May 24, 2008 @ 14:52:32
I am very reluctant to believe any story of this nature, and as per usual with these stories, I have found several holes in this case:
It says at the very top of the page that the “fairy” was 2 inches long, however, in the picture of the hands holding the “fairy” it is clear to see that the “fairy” is indeed alot larger than this.
Also, as someone earler pointed out, the investigative evidence bag is from Derbyshire, not the FBI and Derbyshire is not a part of the FBI in any way.
There have been lots of claims like this saying that “fairies” have been found.
What makes your claim any different from any of them??
Please reply as I am dying to know what argument you are prepared to put up
alice
May 24, 2008 @ 17:44:25
Excusez-Moi, Mlle xx-Alice-xx
Are you suggesting that the Bright Intellects of the Derbyshire Constabulary are in any way inferior too the plodding FBI
May 25, 2008 @ 00:22:28
What Ever
May 27, 2008 @ 16:54:32
hey i bk agen, omg raincoaster i cnt believe this still goin on!! it fab, how many blogs u up to now?? hae to admit i a bit confused by the last few bloggs what goin on?
i went to derbyshire over easter jst gone and the atmosphere is so magical there it is quite possible for fairies to exist and be happy there also there is plenty of animals and plant life to keep them thriving. gotta love it. x x x
May 27, 2008 @ 17:12:49
Ahhh
Whatever
Derbyshire – per Jane Austen : the Best of Counties
May 27, 2008 @ 22:26:54
i cant believe there real it looks awsome
May 27, 2008 @ 22:28:36
i do believe in fairys i do i do
May 27, 2008 @ 22:47:08
the wings look like really really really old leaves when you really look at it. by the way…how DO they reproduce? and if they lack repruductive organs, why might they have belly buttons?
May 28, 2008 @ 14:10:53
I believe in faires … it puts magic into your life … maybe these bodies arn’t really but there must be something … don’t you think … ? S’laters :) x x
May 30, 2008 @ 00:16:31
ITS A SIGN OF THE APOCOLYPSE!!
EAGLE MADE A 2 LINE COMMENT AND THATS IT!!!
I’M SHOCKED!
GASP!
Pup
May 30, 2008 @ 00:47:44
Moi aussi!
Who said anything about the FBI? I believe that’s a Derbyshire police evidence bag, and approved Derbyshire police latex fairy-autopsy gloves.
Yet again the enemies of The Little People make spurious and irrelevant remarks, claiming them conclusive proof. Nothing could show the weakness of the naysayers’ case more clearly.
May 30, 2008 @ 03:16:46
I agree, though I’m still in some shock from G Eagles short comment(which is still unbelievable).
Jun 01, 2008 @ 19:17:00
Spelling !!!
Ladies Children & other Animals visit this Blogge Excellentissimum
APOCaLYPSE !!!
What do they teach in these Colonial Schools these days
Vote Quimby
Jun 02, 2008 @ 22:00:38
Sorry my fault. I don’t go to a colonial school so how was I supposed to know. Geez.
Jun 03, 2008 @ 03:23:14
this thing loks real. but its fake as and april fools prank. idk y som1 would do somthing like that. that joke wasnt even funnyy. i think fairys should stay in ourminds
Jun 03, 2008 @ 03:29:16
If it looks real how do you know it’s not real?
Huh?
HUH?
Jun 03, 2008 @ 14:58:35
@G Eagle:
I believe the word mis-spelt as “apocolypse” should actually be “a pocolypso”
A pocolypso is a festive Caribbean dance done by natives of Port Coquitlam, near Vancouver. Once tree octopus and transplanted-French-Canadian habitat, it is now the pre-eminent home of Swedish furniture in the region.
“Coquitlam”, by the by, is the usual mistransliterated Native word meaning, in this case, “reeking of fish guts.” Never ask the upstream tribe about the neighbours.
Jun 03, 2008 @ 23:33:46
I wasn’t talking about some Carribean dance. I was stating a word we use in America that means the end of the world.
:P
Jun 04, 2008 @ 04:41:16
Ah, I see. Out here we use three words: “Spice Girls Reunion.”
Jun 04, 2008 @ 13:47:08
‘Ah, I see. Out here we use three words: “Spice Girls Reunion.”’
Har har
‘I was stating a word we use in America that means the end of the world.’
Two words. George Bush (three if you could the W)
Jun 04, 2008 @ 17:43:09
you probably never had a cryptozooligist come to this sit yet well here you go.and i am talking about me.it looks ligit but people have faked things like that before.people sometimes make fake mermaids but thats not the case.i say its real i have been studying nessie,fairies,and etc. and this looks exactly like one.
Jun 04, 2008 @ 17:55:18
wow – a professor who can’t spell! :)
Jun 04, 2008 @ 20:18:36
Mr Obama wins the D. Nomination
Doomed
We’re all doomed
All we can now do is :
Vote Quimby
Jun 05, 2008 @ 04:08:42
1) Hey, we’re almost at 1100 comments!
2) We’ve certainly never had comments from a cryptozoologist who cannot spell “cryptozoologist” before.
Jun 05, 2008 @ 05:32:35
Brilliant!
Jun 05, 2008 @ 17:43:19
I’m gonna make the 1100th comment!
Ready?
READY?
Jun 05, 2008 @ 17:45:02
Wow the 1100th comment, don’t I feel special.
What to say?
What to say?
I KNOW!!!
YAY FOR FAIRIES!!!!!!!!!!!!!!
:)
pup
Jun 05, 2008 @ 19:26:45
The highly-esteemed Puppyluvz rules, OK
Vote Quimby
Jun 05, 2008 @ 23:11:01
WhooHoo! Thread party!
Jun 06, 2008 @ 19:00:42
Thank you G, I know I rule.
:)
Pup
Jun 11, 2008 @ 18:08:07
I don’t care what you people say, but the fairy looks pretty real to me. I beleived in them ever since I was a little girl living in the country, and when there were fireflies outside at night, I believed that the fairies would go dance with them in the moonlit night.
Jun 11, 2008 @ 18:10:55
Except that I never really imagined them to look like that. It’s kind of creepy, like maybe nightmare creepy.
Jun 11, 2008 @ 18:18:25
you know i think the fairy debate has gone on for to long i mean its obivously fake >.>
Jun 11, 2008 @ 18:22:02
honestly i believe that the fairy has gone on long enough i mean its obviously fake
Jun 11, 2008 @ 18:24:32
i rather believe in something like the poopy monster or the boogy man or maybe even chuck noris
Jun 11, 2008 @ 18:26:38
Shut your stupid pie hole artemist! of cousre fairies are real! I spit when i say your name! P-toui!!!
Jun 11, 2008 @ 18:28:17
i dont have a pie sooooooo what exactly do you want me to do??
Jun 11, 2008 @ 20:16:06
Her Grace La Marchionesse de W etc
Your Grace
Salve & Merhaba
Doomed
We’re all doomed
Sauron the Brown has just won the 42-days’ detention vote in the House of Commons … with the Help of the Irish
Das geDammen und das geBlasten … the Republicans are taking over the Mother-Country
Next he’ll be ordering a 3rd & a 4th Miniature Aircraft Carrier to share avec les Frogges
AND all to win the votes of single-parent mothers and to impress die Amerikaner that the Britisch are still a reliable World Power
Before he can be arrested for yet more anti-Soviet Agitation and held by der Polizei for 42-days, this Eagle is off to the Prancing Pony for one last Drink
- but (with his usual luck) the Barmaid will ignore him in favour of dashing Heroes, even with the £20 (Canuckistani $100) Note held thirstily und anxiously in his talon
Your Grace’s Freond, that irritating Aragorn son of Arathorn – he continueth to queer mine Eagle’s Pitch, along with those diminutive Hobbits and that Obama-Supporting Legolas (an elf of otherwise impeccable taste und discrimination)
People with Pointed Ears should NOT be allowed to vote in Florida
BUT at least this Eagle can SPELL
“cryptozooligist” …. @£$%^ …. “to long i mean its obivously”
Wot do they teach in these Colonial & ex-Colonial Schools ???
ScHocking
No wonder the Faeies (those that still live) are emigrating in pods to the witty Monsieur Metro’s Vancouver – that Vancouver near St Louis on the Caribbean – in happier times, the former home of Tree OktoPodia und French-Canadians and later Empire Loyalists, fleeing from the Tyranny of that Tree-Murderer & his rebels
Harrumphus, Harrumpha, Harrumphissimum
Vale atque selamin aleykum
L’Aigle Gris
Jun 11, 2008 @ 20:25:13
Eleven hundred comments? You realise this thread is now out of warranty, right? So’s that fairy, if I’m any judge.
However, the flatness of this specimen can be easily explained:
Just like many other people, when I was a child I believed that every time a child clapped its hands, a fairy fell to earth. I also believed that you had to be careful to wipe the guts off on your jeans.
Jun 13, 2008 @ 17:37:30
That’s pretty sick, guts on your hands, then wiping them on your jeans. And how cruel are you to think that a child so innocent could kill a fairy just like that. Your twisted.
Jun 13, 2008 @ 17:39:56
Hey Raincoaster where are you? I want to talk to you.
Jun 13, 2008 @ 17:47:47
Oh sure, when “I” want to talk to you, Raincoaster, your not there to listen. You stupid Punk boy!! You are a boy, right?
Jun 13, 2008 @ 18:19:24
HELLO!!!! IM GETTING REALLY BORED!!!!!!!!! YOU KNOW WHAT, RAINCOASTER? YOUR A JERK!!!!!!!!! EVEN IF YOU ARE NOT A BOY, YOU SISSIE!!!!!!!!!!!!!!!!
Jun 13, 2008 @ 20:23:39
i acually do believe it is real but the leaves for the wings look a bit fake ! but if this website gets more info then maby ill rethink my comment! but i dont think its a prank!whoever said that is just plain rude!!!!! bye!
Jun 13, 2008 @ 21:41:26
@aero & jessica
“Your twisted.”
“Whoever said that is just plain rude!(x4)”
If I may venture into your lexicon:
“You’re words wound me. I didnt mean no harm”
It is not so: I got a hea-a-a-a-a-a-art full of soul, as the song says. Let me prove it by composing a spontaneous poem:
When I was a childe, I spake as a childe
I wrote as a childe, and I thunk as a childe.
I believéd in faerie(s) as a childe
I didst spell as a childe
Use multiple exclamation marks as a childe
And didst write indignantly in ALL CAPS as a childe.
And didst post multiple and unnecessary commentes as a childe.
But when I became a man (as Raincoaster never shall)
I learnt to put away childe-ish things.
And bought me a dictionary and yea, a thesaurus also.
And didst snark oft in the comments section
Ande this be also my wisshe for you.
Kisses, old darlings
Jun 14, 2008 @ 00:58:35
that fairy is cool i thought fairies dont exist!!!
Jun 15, 2008 @ 04:12:20
Ok,listen up stupid people who know nothing about fairies and are reading the wrong blogs!!Yes,there was an April fools day prank but this isn’t it Retards from planet STUPID!Yea,sure I might sound like a weirdo Fairy lover and guess what?I AM!!!So,stuff your STUPID ASSES up your mouth!Yea,I get affended by non-Fairy believers!And yea I’m pissed right now 4 you and your stupid comments!BTW-buy a book on Fairies maybe,just maybe,You’ll understand fairies!(maybe,if you’re not all F***** up S*** heads like I know you are!)
Jun 15, 2008 @ 08:35:47
there are many things in life that i am very unsure of but the thing i am very sure of is that fairys are real im a girl and 11 years yes i know to old to belive in fairys but this one is real how could some one pull of such a real thing of a fairy i mean it even has 8 rib cages xoxoxoxox corey.
Jun 16, 2008 @ 17:38:11
@Haille:
You sound like a weirdo fairy lover.
BTW, buy a book on spelling and grammar and maybe, just maybe, you’ll understand why no-one takes you seriously.
There’s probably a sale on dictionaries and grammar texts somewhere nearby. And they’ll be cheap, as it’s obvious supply is outstripping demand.
Don’t despair though, you clearly have a career ahead of you with the Discovery Institute.
@Corrie: You sound like a very nice person. Cling to that innocence until you’re at least 11-and-a-half.
@RC:
I know, I know … Can I excuse myself by saying “Look, it followed me home?”
Jun 16, 2008 @ 17:52:02
Hey Metro, sweet little poem you put up, where did you find it? J/K. Any ways, I i smell like pee
Jun 16, 2008 @ 17:56:21
Hey Metro, Nice poem, Where did you find it? J/K. Anyways, Methinks thou art not worthy enough to speak thy language of Mimbrate Knights. Take my advice and stop thy stupidity, doth understand me?
Jun 16, 2008 @ 17:59:56
Who ever posted me as a retard will pay!!! AND I DO NOT SMELL LIKE PEE! I KNOW IT WAS YOU ARTEMIST, DONT HIDE IT!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Jun 16, 2008 @ 18:06:29
Your right, i’m sorry. You dont smell like pee, you smell like petunias, and i smell like moose piss.
love me truly.
Jun 16, 2008 @ 18:08:46
NEVER!!!!
Jun 16, 2008 @ 18:11:40
Stupid Raincoaster deserted us!!!!!!!!!!!!
Jun 16, 2008 @ 19:22:53
This is charming. “Smeagol & Gollum: Together again for the very first time.” Now if only we could work out which is who.
@Aero (Can I call you Aero?) & Artie: (Can I call you Artie)
“I would the gods had made thee more poetical.”
~Touchstone to Audrey
“As You Like It” Act III, Scene 3
That poem? Well I ripped the bulk of it off from some old book all about a Great Sky Faerie. Good poetry, interesting stories, outmoded worldview.
Jun 16, 2008 @ 21:28:07
Sure ye can call me what ever pleases thee. Have you ever read the Belgarion series Metro? If not methinks you should. It tis a really good book. Thats where I get all this theeing and thouing stuff. If you read it, Mandorallen, 2 or 3 book, cant remember, will get you started.
Jun 17, 2008 @ 07:53:46
AeroG “Hey Metro, Nice poem … Mimbrate Knights …. doth understand me? ….. Raincoaster deserted us!!!!!!!!!!!! …. what ever pleases thee”
err … ummmm
Embarrrassed shuffling from left to right talon… and back ….
I hope the Witty Monsieur de Metro will forgive an Eagle’s attempts to render the interesting AeroG into the Englisch as she is spoke by God, before the Amerikans & those Rooineks “improved” her, without agreeing with AeroG’s sentiments :
Methinks the Welcome Aerogarthia meaneth :
“…. dost thou understand”
“… Her Grace hath deserted us”
“… whatever pleaseth thee”
AeroG might enjoy the unSpoiled Language of the 1662 Book of Common Prayer or the Authorized [King James'] Version of the Bible
… but Beware … such Words are dangerous … Readers have been kNown to become Christians and (in Inglaterra) LABOUR-Voters, horribile dictu ['orrible to say]
Jun 17, 2008 @ 16:22:50
I thank thee, G Eagle Esq, for thy reference. So Raincoaster is a girl? Fine. Her Majesty hath deserted me.
Jun 21, 2008 @ 07:56:16
errr
…. an understandable mis-direction in an (ex)Colony with its strange republican & democratic ideas
Oi tink the correct English usage for writing about a Marchionesse is :
Her Grace
Not many people know that
Jun 21, 2008 @ 14:28:34
True, and not many people have read all the comments. If they had, they’d know why I don’t comment here often anymore. Scroll up; they’re all still there.
Jun 23, 2008 @ 14:08:25
EWWW gross picture!! I AM SCARED!
Jun 23, 2008 @ 22:16:48
The guy who found it has already admitted that he is addicted to april fools… Besides, I’ve seen more like this kind of “proof”, often just some cutting-and-pasting with dead monkies, feathers and dead leaves. Sorry guys, but this and the fact that it was sold (instead of taken and investigated by the government) to some collector for a pretty low price (I believe it was about 250 pounds)… I would really like to see real proof of fairy’s… But this is just crappy fake stuff. Sorry.
Jun 23, 2008 @ 23:10:27
You people come, you naysay, you offer no proof of your claims (not so much as one link? Nothing? Pix or it didn’t happen) and then you HOTLINK MY IMAGES on your forum!
Well! I never! Or at least I wouldn’t with you! That just goes to show you what kind of people you unbelievers are.
Jun 23, 2008 @ 23:14:44
“Dead monkies”?
Well it’s not a Franciscan. I suppose it could be a Dominican …
Oh–wait! Silly me, I’ve completely misunderstood. Now I see–Jill’s right. It looks a great deal like Michael Naismith. And now that I think of it, has anyone seen him around lately?
Ah–ha!
Jun 23, 2008 @ 23:15:42
UnBeliever, the veracious Jill may be, but she must be rich, if she thinks £250 is a pretty low price
Jun 23, 2008 @ 23:27:38
Indeed, even though the fairies are quite cheap around certain sections of my neighborhood, at least near closing time.
Metro: I don’t know where Mike Naismith is. Who is he? Was he named after that guy in the Monkees, Mike Nesmith?
Jun 25, 2008 @ 17:10:26
Sorry, I’m confusing my boy bands with my Barrayar.
Jun 27, 2008 @ 03:35:27
Hey this is all so stupid. tha picture is of a reall fairy. the human world has destroyed the beliefe of them. they make our plants grow and they help us. we have just erased everything of them. but if we all can believe then there might be hope of them to come out of hiding and they can really help us. all of your guys’s talk is just stupid that is a reall fairy and you all know it. so stop denying it and start believing!
Jun 27, 2008 @ 09:40:09
Are you saying you use fairies as COMPOST? DEAR GOD THAT IS HORRIBLE!!!
Jun 27, 2008 @ 14:17:10
I’ll have to try that. Alternating brown and green layers, occasionally interspersed with spangly glittery layers …
Jun 27, 2008 @ 18:55:58
What a great idea. Compost! Yippee!
Jun 27, 2008 @ 18:59:40
How funny! I posted a link to a compost pumpkin and I got a message that read Discarded! Somebody’s got a sense of humor out there….
Jun 29, 2008 @ 16:33:12
i think fairys r relly cool i love fairys
Jun 30, 2008 @ 00:55:06
Wow!!!
I missed a lot while I was on vacation. Nearly 50 comments since my lovely 1100th comment. My only question is why do the naysayers look up fairies when they don’t even believe in them?? It makes no sense.
Jul 03, 2008 @ 05:18:54
I think faries are people with wings but smaller than us don’t you think
Jul 03, 2008 @ 05:37:47
i think it is real but how? if its real were do they get it from? were do they saw that fairy died were?
Jul 03, 2008 @ 05:41:08
i think its real yah but santa no thootfairy no becousi one thime i put my tooth but it was fake.so when people still think that santa is real they are kid so sorry to saying your kid but i whant you to know
Jul 03, 2008 @ 15:11:22
That was difficult to read but I think I got the just of it. What you were trying to say is that Santa and the toothfairy weren’t real. I have to majorly disagree with that though. I have seen Santa(and it wasn’t at the mall it was at our house on Christmas). So how can he be fake when we have seen him(and it wasn’t our dad in a costume or something stupid like that).
Pup
Jul 03, 2008 @ 18:27:46
Yeah…I belive in this image…I belive in fairies….!!!
I want to see their !!
Jul 03, 2008 @ 19:11:44
Matthew:
You know spreading disinformation and lies like that gets you a one-way ticket to the Hot Place (I think that’s a fairy bar downtown, can’t say as I’ve never been, myself).
Of course they want us to believe this is a fake. The Illuminati want us to underestimate the threat from their allies, the fairies. But be warned, the threat is very real.
Have you ever seen an empty eggshell on the ground? Those are the remains of fairie hatchlings–clear proof of their existence. However if you see something that appears to be a whole egg on the ground, leave it at once and don’t touch it–those are faerie technology land mines, and could take your arms clean off. Call your local bomb disposal experts or police, and the poison control people. Oh, and any local Exferinigators you can find (an exferenigator specializes in removing the chemical traces left by faeries in order to lead their brethren [faeries are exclusively male] to a food or nesting site).
The Illuminati, together with the Freemasons, Osama Bin Laden and Kelogg-Brown-Root (a faerie company masquerading as human, I mean, the name just screams faerie), are grooming an army of wee folk, including faeries, trolls, gnolls, orcs and mini-sasquatch, in order to force their Newer World Order upon us.
As I understand it’s for a large hawaiian with mayo. An abomination that must be fought to the death!
Jul 04, 2008 @ 15:56:19
OH NOOO
NOT A FAERIE ARMY WITH MINISASQUATCHES(why can’t they have big ones, too)!!!!!!!!!
I don’t want a new world order.
HOW DO WE STOP THEM?!?!?!?!?!?!?!
:o
Pup
Jul 04, 2008 @ 21:26:22
this is SOOO cool!! i told my mom fairy tales exist but she said no! but when she saw the picture she said sorry i didnt beleve you before.
Jul 05, 2008 @ 23:16:31
Yay!!!
More people need to be like her mom and stop disbelieving, they should just face the facts.
Pup
Jul 10, 2008 @ 16:18:37
Just remember, it’s not the facts you face, it’s the face you fax. And the butt you photocopy.
Jul 10, 2008 @ 17:30:42
Whatever Metro. Whatever.
:)
Pup
Jul 10, 2008 @ 17:55:31
that is so alsome i hope i v\find something like that one
DAY!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Jul 10, 2008 @ 20:01:41
Don’t we all!?!?!
Pup
Jul 10, 2008 @ 21:31:07
I never !?!?, though I sometimes !?, and occasionally ?!
Interrobang forever?!
I’d link to interrobang, but I’m not sure which of the thirty-nine blogs by that name is the original.
Jul 11, 2008 @ 17:54:21
????????????????
What????????????
Pup
Jul 16, 2008 @ 07:07:59
This could be made from polymer clay showing ribs, teeth etc. I think all x-rays sould be posted. Until then I will keep believeing in Angels only.
I would love to believe in fairies, mermaids, trolls etc. but I would like proof first. I would like to ehco Jill:
The guy who found it has already admitted that he is addicted to april fools… Besides, I’ve seen more like this kind of “proof”, often just some cutting-and-pasting with dead monkies, feathers and dead leaves. Sorry guys, but this and the fact that it was sold (instead of taken and investigated by the government) to some collector for a pretty low price (I believe it was about 250 pounds)… I would really like to see real proof of fairy’s… But this is just crappy fake stuff. Sorry.
Jul 17, 2008 @ 01:42:37
Where is raincoaster?
Pup
Jul 17, 2008 @ 06:28:44
I told you: I can hardly even open this thread anymore, it’s gotten so big. Carry on without me, you’re doing fine!
Jul 18, 2008 @ 03:34:37
Its not that big if my horrible internet can open it. Geez.
Oh well.
Pup
Jul 18, 2008 @ 19:22:06
posting comments at 3:30 in the morning, huh? interesting…so, i heard that there is over a 1000 comments on here….have we hit 2000 yet?
btw, that faerie looks so real, it kinda freaks me out because of the wrinkles….i soooooooo believe in faeries, but i dont believe that Mr. Ollie Winkle (an old faerie) killed a man because the man was handsomer than he was….(strange book i read :P)
Jul 18, 2008 @ 19:24:08
umm BTW, how do you people get the little pictures?
Jul 19, 2008 @ 01:44:05
I have no idea how they get the little pictures up there but they do(its probably the fairies or some really smart computer person).
Yea you believe in fairies and what was the title of the book you read, I would like to read it?!?!
Pup
Jul 22, 2008 @ 09:21:50
i believe in harvey dent…
ups sorry,.. i mean i do believe in fairy..
also alien,monster’s sea. they do exist! u better
believe it bro, the truth is out there..!
Jul 22, 2008 @ 09:27:56
The truth is not only OUT THERE, it’s creeping up your ass!
Jul 22, 2008 @ 16:18:14
Yes!!!
Jul 26, 2008 @ 12:53:28
I think that weather or not other people believe this I do. I don’t give a you-know-what about what other people think. Anyone who doesn’t believe this is just to narrow minded.
Jul 29, 2008 @ 13:09:49
Fairies are so real.I love fairies.And this is proof that fairies are real.C’mon, they got the cops on this thing.That should be enough 4 u.If fairies ar’nt real, then who came up with the idea.Just to make up something so awesome and tell people its not real?That person doesn’t exist because fairies are so real.
Jul 29, 2008 @ 22:23:18
i belive in faires i know they can exsist no they DO exsist their magical their beautiful their wild they have their own language the keep to themselves they know were destructive they know if scientist find any of them they will murder them kill their race off make them vanish off the face of the earth theyll mercicelly slaughter them . theyll throw them on the table and cut them open theyll rip out there guts and cut them open. theyll cut open there wombs and take out there unborn young and cut them up 2 the government will make them vanish to keep democracy in order theyll do anything to keep democracy together theyll say its 4 scientific descoveries well dont fall for it theyll kill any one who dare try stop them. fairies r in danger when they enter our world if u dont belive in fairies u dont belive in god. if god can create us why cant he create them? do u not belive in gods work?
that is all i have 2 say……..
the rest is up 2 u……..
Jul 30, 2008 @ 11:46:49
ok..this seems interesting..but i stop believing in this things long time ago, i know it’s sad and more because i’m just fifteen years old. i used to believed alot in these kind of stuff, really, but this cruel and soulless world made me lost all my fantasies and dreams. somewhere inside me i know i still believe in this.
well if you know someway i can, i don’t know get back all those beautiful beliefs tell me.
have a nice day
Aug 12, 2008 @ 20:05:42
Hello boys and girls, can you say “Fiji Mermaid”? I bet you can.
It’s a beautiful day in the neighborhood.
Aug 12, 2008 @ 22:05:50
Well, EVERYONE knows the Fiji Mermaid is real: It’s in the SMITHSONIAN for god’s sake!
Aug 13, 2008 @ 11:37:39
please….
je ne parle pas englais est il possible que quelqu un me traduise le texte s il vous plaits …
Merci d avance a ceux ou celles qui me traduiront ceci
Aug 14, 2008 @ 21:56:55
So sad Fairys are AWSOME and I totally believe in them!
Aug 15, 2008 @ 20:39:06
yay more believers!!!!!!!!!!!
Aug 16, 2008 @ 16:23:28
i totaly believe in fairies but i dunno about this…wouldnt they just like, evaporate or sumthin when they died? and the only reason officials are calling this a fake is because they dont want people knowing about the super-natural around us! 0_o
Aug 18, 2008 @ 13:43:43
All you people are focusing on the fairy instead of the real issue here.
The caption below the picture claims the remains are only 2 inches long, yet the remains are larger than the two hands holding it?
It is sad when someone tries to pull off a hoax and completely screws it up with such blatant ignorance. LMAO
Aug 19, 2008 @ 12:58:41
Kari darling. We must remember that fairies are magical and can seem larger than they really are. They are trying to prove this to you in the picture. Don’t you understand?
And if you don’t believe me you can read further up the page and see there was already and arguement on this topic.
Aug 24, 2008 @ 20:55:59
wow raincoaster i aint been on this site for like a year, glad to see it’s still going, how many comments have you got now? (i would count them but i kinda have better things to do with my time)i still believe in fairies =D
Aug 25, 2008 @ 06:07:50
dude any one know where i can find more info about this….well looks interesting and if this where real where are this animals
Aug 25, 2008 @ 22:14:32
Glad to see that hannah has come back. Rain doesn’t get on very often anymore but I do weekly.
Mario: I have know idea where to find more info on this topic but if you listen to the comments on this site you can probably find someone who can help you find some info.
Aug 26, 2008 @ 00:52:03
Absolutly dreadful. Hmmm… no I can deffinatly say that if I were to pass away (which concidering the cercumstances is a very very low possibility) I would not wish for my rotted body to be photographed and placed all over the web. Kindest regards to the family of this por Fae may it not hinder your lives to much.
Truly,
The Vampirate Mysterie
[any questions as to what a Vampirate is or to what I am may be answered Via E-mail at VampirateMysterie@gmail.com]
Aug 27, 2008 @ 21:59:28
I think the fairy was found for a reason and it was to prove to all the non-believers that they really do exist.
Yes it would kind of suck to have your photo all over the web if it was a bad thing they were saying about you but this is for the good of the world.
Aug 30, 2008 @ 00:03:25
FOR ALL YOU PEOPLE OUT THERE WHO DENY THAT THIS OBJECT ISNT REAL THEN YOU ARE SADLY MISTAKEN!! FAIRIES ARE INDEED REAL. JUST ASK AN EXPERT!!! JEEZE!
Aug 30, 2008 @ 18:41:42
Wow! Come on guys!
Aug 30, 2008 @ 23:43:20
Blimey, this is still going? Raincoaster is the blogmeister. We are not worthy and I expect the fairies are grateful too. Good thing to have; a grateful fairy, so I’m told.
Sep 02, 2008 @ 02:15:49
“Come on guys!” what???
Sep 06, 2008 @ 14:56:32
I think this is real. Its so different from other depictions of fairies, where they’re all perfect in flowing petal gowns and so on, so all you non-believers out there, I’d like to see you explain this one!
Much Love x
Sep 06, 2008 @ 22:24:05
Very good examples. The first we’ve ever heard of those as examples.
Sep 12, 2008 @ 11:31:47
um…i know u would like to think that this is real fairy but it is not look at the wings thay r soo fake they look exactly like leaves and you can even see the stem coming through the middle and out and he is holding it from the back so the leaves dont fall off hey guess what if u want to proove to us that this is a real fairy then why dont u take a side veiw of the photo without u touching the back or without gluing the leves on HUH SEE WHAT HAPPENS THEN and also give us a photo from its back
Sep 15, 2008 @ 00:34:54
um i used to belive in “fairys” but now i have grown up and i belive u should to but i think its pretty cool and there is no way it can be a barbie but u might be able to make it useing small animal bones and paper mashae, also for the hair, could be from a animal or human it looks far to real to be wig hair and i belive that the wings was made by leaves in a way to where they look like that please write back telling me where the origanl picture was takein and who took it please and if someone tells me “oh its real” or “why are you asking that”? ect. i will give a reasonable answer, Thank you that is all
Sep 15, 2008 @ 12:38:02
what the hell that looks like someone stuck leaves to some dead road kill and called it a fariy
Sep 16, 2008 @ 04:07:28
i found what i believe to be part of a fairy in my front yard it was very small and looked like it had been attacked. the parts that remaind were the legs torso and wings. the legs were still slightly moving and one of the arms was a little ways from it. when i went later that day to look at it it had disapierd
Sep 16, 2008 @ 07:46:00
1201 Well done Lulu
Sep 16, 2008 @ 08:14:51
YAY! Congratulations to scientific investigator Lulu, who has added the last piece of corroboration to the puzzle and, in the process, put us over the 1200 comment mark!
Sep 16, 2008 @ 22:58:05
Amazing Lulu!!
I only wish I had the honor of seeing a fairy.
Sep 19, 2008 @ 08:50:19
vorrei troare anzi avere 1 di quelle fate mi piacerebbe
Sep 20, 2008 @ 05:10:35
HUH?!?!
Sep 20, 2008 @ 13:34:19
SchPelling !!!
? troare = troVare
I would like to catch, indeed to have one of these made would please me
Sep 20, 2008 @ 15:07:30
me i use 2 bleve in puntuation n speling
Sep 20, 2008 @ 15:51:07
I’M SO CONFUSED!!!
:(
Oct 03, 2008 @ 19:08:58
Blimey isn’t that fairy dead yet? It’s had more come-backs than Micheal Jackson.
Oct 03, 2008 @ 21:00:00
FAIRIES SHOULD BE IMMORTAL DAMMIT!
Oct 04, 2008 @ 07:06:03
…. but Fairies are imMortal … apart from those that get mummified or emigrate to MetroLandia and drink the anti-freeze laced milk left out for the local Cats ……
Oct 04, 2008 @ 08:02:04
This is still going on? It’s like it’ll never die and there’ll still be comments in ten years time.
Oct 04, 2008 @ 08:40:10
This thread will NEVER die!
Oct 04, 2008 @ 10:15:46
whaow……… cool
what a great things……..
Oct 04, 2008 @ 10:24:36
Well if they make a film of it I’m happy for Arnold Vosloo to feature, and Oded Fehr, but spare me Brendan Fraser and Robin Williams. I think Raincoaster would look good in a tutu though and kick ass like Carrie-ann Moss just dreams about, with fairy dust. What value the blog after the award ceremony huh?
Oct 04, 2008 @ 16:40:28
Raincoaster in a tutu?
Now I have to bleach my mind’s eye …
Oct 04, 2008 @ 19:05:30
baby mothman? Great! Now I have gephyrophobia… The severe fear of crossing the Sturgeon Bay Bridge.
Oct 05, 2008 @ 15:08:11
Wow this is soo cool wow if thats a real fairy then is there more ?
Oct 05, 2008 @ 15:09:45
Wait so thisis a Dead fairy then shouldn’t we all try and find one that alive how awsome would that be!
Oct 05, 2008 @ 19:44:24
Hind “…. how awEsome would that be!”
However, not for the Fairy …. but at least it would stop him (or her, in these “enLightened” times) vting for that kindly lady, Mrs Palin
Oct 06, 2008 @ 16:00:54
@Hind:
Come up our way. We get them in swarms every spring and fall as they migrate to their breeding grounds on the coast … or tanning beds, perhaps. Fairies don’t breed, generally. Anyway, it’s good fun shooting the slow ones with slingshots.
Unfortunately it usually damages them beyond the abilities of modern taxidermy. Which is why I think this example’s fake. Besides, you can’t see any fangs in that picture, can you? Real fairies are vicious little buggers. Once they’re on the ground you really have to make sure they’re dead before you touch them, otherwise you’re risking rabies, fleas, and possibly worse.
Oct 06, 2008 @ 16:15:27
Metro – are you honestly telling us you’ve never seen a fairy that’s been stuffed?
Oct 06, 2008 @ 21:22:49
I’ve never cared to look closely enough to tell. Although my local MP might qualify–he gives the impression of having been embalmed.
No tell-tale signs of fairyhood, though … but on the other hand he’s a Conservative MP and a lay preacher in some born-again outfit, which are believed to be two of the three initial indicators.
Oct 07, 2008 @ 17:27:43
Metro – does he drink Red Bull?
Oct 15, 2008 @ 10:21:06
In Indonesia it called jenglot. Do you know about it? It is a mystic creature. But I don’t believe it exist.
Oct 15, 2008 @ 16:57:55
i think it is real but what do i know. all i know is it looks pretty awsome
-bobbie
I think it is real also. I hope it is ‘cuz that’d be really cool!!!
-Stephanie
Oct 15, 2008 @ 21:36:29
@Philipa:
No, but he spouts bull. Is that close enough?
Oct 19, 2008 @ 08:00:14
im in my teens but im not thick!!
those wings for one thing look alot like leaves to me!!!
seee girls arnt as easely fooled as boys so there!!!!
Oct 21, 2008 @ 09:22:21
Metro – close enough ;-)
Steph – well of course it’s real!
Pusscat – sadly I’ve found that’s not the case :-/
Oct 22, 2008 @ 02:36:06
and just when you think fairies aren’ real,,,,one just pops up outta nowhere.at the same time, we have to be thinking that corps could be faked,or it might not be,unless i can exsamen the corps for myself;i will allways ask myself this question:how will we ever know what is to believe or what is to be ignored as stupidity?
we may never know.
Oct 23, 2008 @ 17:20:15
And I want to know what they’re teaching children in school nowadays, and why? To quote Micheal: “how will we ever know what is to believe or what is to be ignored as stupidity?” Quite. Good point.
Oct 23, 2008 @ 21:41:43
PussCat “.. im not thick …”
Michael “.. how will we ever know what is to believe or what is to be ignored as stupidity ? ..”
Your Grace
I flatter myself that I agree with the encouragingly-perceptive young PussCat & the sagaciously-bemused young Michael on so many things
…. apart perhaps on whether the White House would be elegantly adorned by a Young Lady so expensively attired as Mrs Palin (under the Shrub Doctrine the terror to local Moose & Monsieur Metro’s Tree Oktopodia)
BUT
It is NOT a Question of Stupidity or Thickness but a Question of Truth
Galileo Galilei’s ABSURD suggestion that the Earth goes round the Sun may seem pretty stupid & tick (Oirish for “Thick”) to Flat-Earthers & Geo-Centrists
BUT it is a Matter of Fact whether Signor G was (or was not) Korrekt
und FACTS have to be ascertained on the basis of Evidence …. and Evidence has to be carefully scrutinized
MAIS
Living in Derbyshire (per Miss Jane Austen : “the best of Counties”), how can one openly express doubt over what could become a much-needed Tourist-Attraction in these times of Oeconomic Stress
J’ai l’Honneur de rester le Servant obedient de la vestre Grace
G Eagle
Oct 24, 2008 @ 17:52:25
Mr Eagle, Sir, I concur.
And it is the best of counties, for what can compete with the feel of gritstone under the fingers or the soft heartening viw of the Peaks?
Sir, perhpas you missed my message on Aerchies blog, so I hope Raincoaster will permit me to invite you to email me? I would like to invite you to my blog – it is now permission only. (again)
Oct 25, 2008 @ 01:20:20
that totally looks like a wax figure with add on and leaf wings would never believe it for a sec
Niki<3
Oct 26, 2008 @ 03:32:05
ok all you punks that say you dont believe in fairies. remember when you were growing up and your mom or dad or some one in your family told you all those nice little FAIRIE TALES. did you ever stop to think that they HAD to be based on SOMETHING. and you had to have looked on google or ask jeeves or something about fairies to find this page in the first place….SOOOOOOOOOOOOOO if you didnt (dont) believe,
Oct 26, 2008 @ 03:36:21
ok all you nonbelievers. if you do in fact DO NOT believe in fairies than why were you searching for FAIRIE things and happened upon this page. “oh look its a fairie. ill go check it out” you had to have thought something like that you idiots. ever wonder where the basis and title A FAIRIE TALE came from???? FAIRIES x_X
Oct 27, 2008 @ 09:30:34
cool.
I can do those fairy wings too (they’re made of bleached leaves)
but still I do believe in fairies ^^
Oct 28, 2008 @ 15:40:10
when i first seen this pic i though it was real, but no i know other wise lol very gd tho. its a shame its not real but there is still hope :)
Oct 30, 2008 @ 14:18:55
tutte cazzate nn è vero niente!!!!!!!!1
Nov 02, 2008 @ 00:36:03
hi! I thinck thath fairy’s existe because they are special
tings but i thinck it’s true bot be carfullthey mith be dangeuros
Nov 02, 2008 @ 00:51:47
Come-on !!! Stop poluting every on !!! They nid to survive!
Im sur that there is maini mor to se!
Nov 02, 2008 @ 04:24:15
Maini? Or do you mean Miami? Which sounds nice and warm and sunny.
Although I could do with a Martini roundabout now as well..
Nov 02, 2008 @ 13:51:45
Ooh yes, shaken, not shtirred for me, please.
Nov 03, 2008 @ 05:22:39
“Shtirred”? Seems to me you’ve already had one or two, eh?
Nov 07, 2008 @ 21:41:16
wow that fairy looks dead if i was that thing i whould kill myself one minute im the im dead already hahahahahah
Nov 08, 2008 @ 19:44:46
well people please just stop huffin and puffin about it stop talkin trash if you dont believe and go on with your life and leave us who do alone and one day when we get full proof to rub in your face then lets see you all big shot then talking trash a am 17 years old and i do believe its hard to but like a few comments up about god well i never seen him either but how did i get to step on earth if it was not for him in my case i say keep up with your work RC 8) your amazing off and out peace
Nov 10, 2008 @ 22:47:04
oh my god!!!!!!!! what is in your head people!!! even the owner has already published the fakeness of this thing!!! is NOT real at all!!! c’mon!!! he even apologized!!! what is next? the lake ness monster remains??????? i think barney is a real dyno too!!!!and i have an unicorn in my backyard!!!
tha bag’s evidence? how dificult is to print POLICE EVIDENCE… i have some million dollar bills i bought at 99 cents! i think they are real too!!!
my god!! grow up people!!! the creator has apologized for the shock his creation made!!! IS NOT REAL
Nov 13, 2008 @ 02:51:55
C’mon, folks, have you never seen a cicada before? They are absolutely real.
Nov 13, 2008 @ 15:26:43
Oh come on, folks–Err on the side of the evidence.
The person who found this has obviously presented it in good faith to the world, and for that reason alone it deserves at least a little credit.
Nov 13, 2008 @ 17:23:25
Just because you haven’t seen something doesn’t mean it doesn’t exist.
Nov 13, 2008 @ 20:45:09
I wasn’t saying that–I meant that no matter how crazy the poor guy who found this thing is, you have to factor in that he really believes this thing is a real “fairy.”
I mean, anyone with half a brain knows fairies don’t exist, but common sense never was all that common.
Nov 13, 2008 @ 20:56:00
But anyone with both brain halves know that fairies DO exist, and no, I’m not gonna make a joke about Proposition 8.
If they didn’t exist, why would we have a name for ‘em?
Nov 13, 2008 @ 21:18:54
We-ell we have a name for penis envy, Jordan and Micheal Jackson but none of those exist – the’re just human constructs.
However, Metro – it is against all the laws of physics, is it not, that bees can fly? Yet they do.
Everyone, QUICK! Clap your hands and say:
I do believe in fairies,
I do believe in fairies..
Nov 13, 2008 @ 21:50:47
OMG!!!!!
It has been a while!!!
So much I’ve had to read since September 20.
Hmm…. Still looks like we have a bunch of naysayers and the same people educating them just like always. Mothing really new except for the fact that I found out Philipia doesn’t believe in Micheal Jackson who I know is a very real and VERY VERY VERY SCARY person. But other than that nothing new. Oh well I’ll get over the fact that I didn’t learn anything new today.(3:50 my time)
Nov 14, 2008 @ 03:00:21
Michael Jackson is a cicada, too.
Nov 14, 2008 @ 05:42:21
No, he’s a chimera.
And for pete’s sake use the other half of your brain. This is a cute model, passed off by someone as the real thing. But it isn’t real and won’t be, no matter how much wishful thinking you apply.
We have names for phoenix, don’t we? Also cyclops. But how many have you ever seen, eh?
Nov 14, 2008 @ 08:33:59
Her Grace the Marchionesse de WitchHampton under Buzzard etc
Your Grace
1257 ScHocking – what do they teach in Canadian Schools these days
A Young Man (however able and entertaining) who asserts the existence and indeed give the Korrekt SchPelling of a Chimera is hardly in a position to denounce l’existence d’un Cyclops
….. and we have all seen ein Phoenix …. or at least those of us who have had le taste et discrimination pur voir that ‘Arry Potter film
… and if one is to err, one should never so to do in favour of the Facts
Yr Grace’s servant obedient
L’Aigle Gris
Nov 14, 2008 @ 08:45:07
Metro–
Using only the third half of my brain(the half that I leave behind the couch, and the one that you apparently don’t have) “Chimera” is a synonym for “cicada” if you’d take the time to peruse teh latin. Please define your version/re-definition of “real.” I stand by my statement, and it stands by me.
Phoenix is a city. Cyclops is/was a one-eyed cat borne last year whose image was spread all over the internest. Both exist, or existed. Do you still sleep on a futon?
Nov 14, 2008 @ 08:53:59
Whoa. Eagle’s here, too. The man who can look at a grape and not comprehend the raisin owns the name of Metro.
Nov 14, 2008 @ 09:14:33
Her Grace Scarlette, La Marchionesse de W under B etc
Your Grace
It is a Truth universally acknowledged that more is there to Life than le Raison
Le Raison is merely the deSiccated remainders left after the removal of the life-inspiring Grape-Juice that is presequent to that Fermentation, to which Port is the consequence
Yr Grace’s obedient servant etc
L’Aigle Gris
… errr … embarrrasssed shufffling from left talon … and back to right talon … shouldn’t it be CHIMaERA (Greek)
Nov 14, 2008 @ 09:19:45
Yep. Aye, mate, any port in a storm.
Nov 14, 2008 @ 16:56:22
Surely you’ll never need any port while there’s still Sterno available?
You assert the existence of fairies because we have names for them … Are you now saying that the flaming bird of legend exists because there’s a city named after it? Or that a birth-deformed kitten gives credence to a one-eyed giant?
Your statements don’t so much stand by you as prop you up, and they’re not doing a very good job.
I suggest you go sift through your couch cushions and find that missing chunk of brain, because operating without it has clearly impaired your ability to distinguish fact from fiction, tell $#17 from shinola, and do fractions.
I haven’t slept on a futon in years. I dumped it in an alley. Check the tag on yours and see if it says “Metro”.
@G Eagle:
Metaphorically, the raisin is what is left when Bunk has finished dessicating the grape of knowledge. It’s shrivelled and twisted and vaguely resembles the original, but it’s nothing like.
Nov 14, 2008 @ 23:35:34
I didn’t want you to get mad I’m just saying he does exist, and he is very scary and very gay. we have a saying over here that goes:
“I plegde alligence to the flag.
Micheal Jackson is a fag.
He used to play with little toys,
Now he plays with little boys.”
Pup
Nov 15, 2008 @ 02:43:50
Metro–
It’s getting hard to hear you through the pingback list static of SheWhoShiftsToNeutralDuringPrecipitation, and I’m sorry to hear about your extra chromosome. It kinda explains why your logic skips occasionally. My DVD player does the same thing, so you’re not alone.
Let’s take a different tack. Assuming that Faeries do NOT exist, then how do you explain the transformation of your own baby teeth (individually left under your futon within a couple of years after you were whelped) into coins? Physics, whether General, Nuclear or Meta, cannot explain it, but the existence of Faeries does.
Following the same argument, if faeries don’t exist, then trolls don’t either. You cannot deny that you exist.
Now go pull out that last tooth that you’ve been twiddling with your tongue and put it under your pillow tonight. In the morning: Instant Faerie PWND.
Nov 15, 2008 @ 04:36:08
Holy faerie crap! Do you know how freakin’ long this page takes to load?!?!
Nov 15, 2008 @ 07:01:12
Lori– Click [Control][End] and you jump to the good stuff.
Nov 15, 2008 @ 11:04:14
Well it’s making me laugh and that’s a good thing. Crying with laughter.
‘cept the Micheal Jackson bits, obviously. That IS scary.
Nov 16, 2008 @ 16:41:39
Hitting control-end only took me to a page containing two Bunk comments. Hardly “the good stuff.”
Bunk, if anything around here shifts to neutral during precipitation, it’s your mind. Shame you live in an area that gets 200 days of it per year.
Your DVD player skips because you keep shoving coasters in it. If you’d lay off the sauce a little you might be able to tell the difference.
It’s not actually my extra chromosome. We keep one of your warts in the secure lab up here. Your profile is in the “what not to do” section of the Mad Scientist’s Handbook.
Which of course would explain why you’d think a healthy specimen such as myself might be running out of teeth. But us normal human types normally keep them for most of our lives. Did you have an accident? Is it due to the nourishing diet of Twinkies and Cheetos on which you subside? Or did you lose all your teeth chasing fairies?
None of my teeth has ever transformed by any sort of magic. Presumably, this being the time of year it is, you’ll shortly be referring to a certain “right jolly old elf” and claiming that if HE doesn’t exist, who brings the pressies, right?
Nov 16, 2008 @ 19:53:48
Dear Bunk
Salve
This is very vorrying
The normally sensible Monsieur Ortem seems to be asserting the desideratum of being a “normal human type”
… surely he cannot have been sampling that Stuff that he has been putting out at night for the puir Faeries migrating in quest for a safer habitat, little realizing the perils in his Neighbourhood from (eg) Tree Oktopodia
It is a Truth Universally acknowledged that no-one would want to be Human if he/she had the better offer of being a Racoon or (better) an Aquilan
Your obedient servant etc
and
Vale
L’Aigle Gris
Nov 16, 2008 @ 23:37:06
That’s certainly not like Metro. Recommending normalcy? What would HE know about it? He hangs out with me!
Nov 17, 2008 @ 04:30:56
Senor Eagle Gris–
The Metro-gnome is out on a limb here (no offense GE) and he’s been backed into a corner. It’s very typical for someone in that situation, when one’s fallacious arguments have run their course, that one resorts to personal attacks having nothing to do with the discussion.
I would never stoop to such blatant character assassination, although I wonder why he seems to be an authority about drinking Sterno.
That in itself might explain why he missed my pun about the omnipresent and Honorable Ms. R’s blogging name, and jumped instead to the bizarre conclusion that I live somewhere that gets rain 200 days a year.
RC– We get rain 365 days a year, thanks to you! =)
Metro–
I shove Coasters into my CD player, not my DVD, but only rarely. Honestly, how many times in one’s lifetime can you listen to “Charley Brown,” “Smokey Joe’s Cafe,” “Along Came Jones,” and “Young Blood?” (Okay I’ll give “Poison Ivy” a pass, just for the one-note guitar solo.)
How’s your “Cowsills Revisited” retro band going? Keep us posted.
Nov 18, 2008 @ 02:29:49
Metro–
BTW, I gotta thank you for that virus-laden email you sent me yesterday. V-COM vaporized it on arrival. I also note that since you haven’t posted your usual smarmy response to my comments as quickly as usual that you must have received my “package” as well.
Go to Trend Micro’s website and get a free online scan and pray… assuming you can access the internet at all.
You’ve gone skooters, bro. Do it again and I’ll turn you in to the Feds. Serious.
Nov 18, 2008 @ 19:14:26
@G Eagle:
I drink antifreeze only when I am attempting to attain the worldview of M. Strutts, or when I’m hanging out with Raincoaster.
@Raincoaster:
You might, in a bad light and by a good-natured, drug-addled, pathalogical liar, be called “normal”. Want proof? Send Bunk a picture. Of course he probably thinks Micheal Jackson’s normal, so maybe we need a better guinea pig.
@Bunk:
Your remarks about failing to stoop to character assassination confirm my view that your mind is going.
My apologies for mistaking your geographical origins–I thought you were a Seattlelite. However, California is also a reasonable explanation: You’ve clearly been smoking something, in any case.
Now as to the question of virus-laden emails: It sure as hell didn’t come from me. However, it can’t be conincidence that my hard drive crashed mere moments after I opened what I assumed to be simply another deranged screed from you.
No need to get the feds involved–they already know. I understand sending viruses with intent to cripple a computer may be a federal offence. The Federal Trade Commission and the ISCC may want a word, as well. Assuming the RCMP can’t find a reason to charge you with terrorism.
Oh, and by the way, I got your “pun,” but ignored the sense of it out of pity. One has to consider the source, and if that’s the best you can do then we should all applaud your little effort. Not everyone is cut out for the literary life.
Nov 18, 2008 @ 19:27:04
Oh, and your humourous remark was closer than you realize. I have actually fronted two bands. How are you getting on marketing your CD–What’s it called again? Ah, right: “Bunk Sings Stockhausen’s Greatest”.
I understand that you’re having some trouble finding a new reviewer since the last one’s suicide attempt.
I’d volunteer, but I suffer from some primary defects that keep me from enjoying it as intended. One, I’m not a masochist; Two, my hearing is quite good; Three, I have taste.
Never mind, though. Perservere. It will at least keep you from violating the panhandling laws, technically.
Nov 19, 2008 @ 06:02:27
Metro–
My comments have been very civil, but your anonymous phone call to the police wasn’t. Way to go, scaring my wife and kids like that. Your false 911 calls have been logged in as blatant harassment since you’ve done it twice before. That you live in Kanuckistan doesn’t let you off the hook for internet malfeasance under U.S. law. You are dangerous and deranged, my friend, aka Klaus.
Nov 19, 2008 @ 22:37:30
Hey–I never made any anonymous phone calls. All my reports to the police have been signed. I had no idea they were already watching you, and they wouldn’t say why. But if I gave them the excuse they needed to execute the search warrant, then I am happy to have performed a public service.
I’m really sorry if your wife and kids were frightened, but at least you’re not having to explain to your boss why the company intranet shut down, and why the RCMP have forensic IT inspectors looking at the servers.
One of us needs therapy alright, and it would be you. That video link was clear proof. You remind me of someone … Ah yes: this fellow.
You’re getting on my nerves, amigo. I’m a nice enough guy to let this drop here, but I wouldn’t push it if I were you. Just friendly advice.
Nov 20, 2008 @ 07:35:10
Metrogue–
Keep ranting away, boy-chile. Everyone sees through your unfounded accusations. Comparing me to Oingo Boingo’s Danny Elfman is an insult? He’s one of the most successful composers in the business, you dork.
Suggest you hunker down a bit, bro, so the RCMP doesn’t find the teen skirt porn on your company server that you described to me in detail last June.
You know what I’m talking about: mirrors on your shoes, up the dress… You’re a sick person, sMutro. Why don’t you off yourself and give us all a break.
Nov 20, 2008 @ 07:54:08
WooHoo! Just got a call from Dudley DoRight. I allowed the RCMP to access my computer remotely and scan for nastiness. Ain’t nothin’ here, Metro. Loser.
Nov 20, 2008 @ 08:19:05
00:19AM ALL CLEAN. Heh.
Nov 20, 2008 @ 15:14:21
That’s because I took the most incriminating stuff off. Mwahahahaha. So now you initiate flamewars whenever my hits drop too low OR I tell Dick Cheney what you said about him!
Nov 20, 2008 @ 15:14:45
So yeah… Pretty fearies..
And this page now takes forever to load. I can see why ICHC restrict their comments now!
Nov 20, 2008 @ 15:16:37
Oh come on! This is just a Winnipeg mosquito!
Nov 20, 2008 @ 15:51:12
Those wings are amazingly intact for having come out of a police evidence bag.
Nov 20, 2008 @ 20:38:11
Metro– She’s onto us. And we didn’t even get to the all-caps screaming phase.
Nov 20, 2008 @ 22:20:32
I think that faeries exist in remote locations, but are only present in our own minds. I’m not agreeing with Bunk nor Metro.
Nov 21, 2008 @ 07:54:48
Indigo sums it up very nicely and I completely agree although he is absolutely incorrect.
Nov 21, 2008 @ 17:35:37
While Indigo’s statement is incorrect, I agree with it.
That was fun. We should do it again sometime, in the spirit of bipartisan co-operation and all that.
Nov 27, 2008 @ 21:11:03
WOW YOU GUY TALK A LOT!!!!!!! =P
Nov 27, 2008 @ 21:14:10
WOW YOU GUYS TALK A LOT AND JUST OVER A fairy. that may be
the last fairy on Earth. if someone killed it i will find
them and make them eat poop! =p
Nov 27, 2008 @ 21:17:31
ok i think now from all of that talking you 102!!!!!! but i
have one that to say or maybe two. i like pie and la la la!
Nov 28, 2008 @ 08:31:11
destiny– Love your comments. You’ve summed it up very succinctly, with emphasis on the first syllable. But there is still some confusion. Care to elaborate?
Dec 06, 2008 @ 03:37:06
HI
Dec 06, 2008 @ 08:46:42
1293 Hi
Her Grace la Marchionesse for G-G
now she has a Lap=Top
Dec 06, 2008 @ 14:05:56
Yay! I humbly accept the nomination, now that I have a computer capable of actually reading my own blog!
Dec 06, 2008 @ 16:39:47
Bites fingers in order to avoid typing something about finding a lap … and amazingly succeeds.
Dec 07, 2008 @ 12:05:09
Your own fingers, Metro?
Come on, people! 1300 for Christmas???? Please??????
Dec 07, 2008 @ 20:45:10
I don’t think I’ve ever seen someone whore a post out this much. I am impressed!
Dec 07, 2008 @ 22:25:19
rain– How ’bout an update on the stats for this whored out post? Maybe a screenshot of the graph? I’m willing to interpret it for Metro.
Dec 07, 2008 @ 23:52:29
I was going to put that as a comment here, but A) can’t put images in comments and B) if I make a new post I can whore it out even more!
Dec 08, 2008 @ 02:56:07
You’re just whoring this post out to try and get more comments. I refuse to be drawn.
Oh, wait…
Dec 08, 2008 @ 04:45:01
GOTTTA DO IT!
Dec 08, 2008 @ 04:45:36
1300!!
Dec 08, 2008 @ 05:00:17
They exist. Like whatever.
Dec 08, 2008 @ 08:30:18
Heh. What say we go for two k by the end of 2009?
Dec 10, 2008 @ 07:54:24
Shouldn’t be too tough, especially when I get to call Metro a penisoid without serious repercussions.
Dec 10, 2008 @ 07:56:35
=)
Dec 10, 2008 @ 11:17:46
So far, so good eh?
Dec 10, 2008 @ 23:32:37
Her Grace La Marchionesse Scarlett de WitchHampton etc
Your Grace
Je ne desire pas sounder troppo specie-ist
BUT
After 1301 Comments, how can even a Racoon add ONE Comment and then total the Comments up as 1,300
It’s si triste that these Racoons seem not to have had the benefit of the UK’s National Curriculum at School, where arithmetics are encouraged
OR perhaps what they lack in Mathemagical calculation,they more than make up in artistic & entertaining talent
AND as your Grace commands :
The Ha! you say. Well, this is certainly unusual to say the least. I think you might be on to something here. So, I say Ha!
Dec 11, 2008 @ 00:17:56
It’s the New Math!
Dec 11, 2008 @ 03:57:46
I help to you! Comment No. 1310 for the dead fairy!
Dec 11, 2008 @ 06:44:22
The real amazing thing about this post is the number of comments.
Dec 11, 2008 @ 06:51:01
Ahh…Raincoaster…you make me chuckle.
I am going to blogwhore this post tomorrow…hahaha…
Hope you get your comments…
Dec 11, 2008 @ 06:51:04
Is that paper mache?
Dec 11, 2008 @ 07:15:25
Marina
Shocking
What kind of suggestion is that, to make about something brought to the attention of the Public by a Derbyshire man
What would Mr Darcy say !!
Dec 11, 2008 @ 07:24:22
Is that the Real Estate Fairy? That would explain what has happened to housing prices in Vancouver! Those bastards need to put her back to rest in peace!
Dec 11, 2008 @ 07:41:48
There may not be a tooth mouse, but there IS totally rad and aweseom Mouse Woman! Book by Christie Harris. http://tinyurl.com/6l2e4w
Awesome and fun book! And didn’t first nations have some sort of little people lore? I can’t remember their name though! Starts with an “m” or “w” I think and is long and complicated. Raincoaster, you should know the answer with that logo, and since you are an expert on paleofaerie species and all… (this may have been discussed but I must confess I skipped some posts!)
Ok, that’s my 2 bits!
Dec 11, 2008 @ 08:37:11
GE esq– I was only congratulating the ONE on achieving her goal of 1,300, not claiming a point for myself as I had no way of keeping count. Tambien, es muy triste que la palabra “raccoons” tiene dos letras “c”… Ahora tengo talons que vayan izquierda y derecho, como sus.
Dec 11, 2008 @ 09:49:33
86 to go!
And there are lots of little people myths among First Nations people; as many as there are different nations! But since this was found in Derbyshire, I’m assuming it’s ye olde Englyshhe kind of fairy, with which we are all familiar through our colonial educations.
Kye, they obviously took her out of her barrow. She’s homeless! That’s what’s causing all of this…mortgage market collapse, bank bailouts, the whole thing…it’s so obvious, in retrospect!
Dec 12, 2008 @ 07:50:28
Maxwell Smart. To go.
Dec 12, 2008 @ 10:32:53
Or is that for here? If we put him in a porcelain mug he has a smaller carbon footprint.
But you know what they say…small carbon footprint…
Dec 16, 2008 @ 04:13:37
Speaking of Faeries, aren’t they related to the Menehunes of Hawai’i? They’re a pain over there. What about the ones who are attacking El Coyote in West Hollywood because the lady who owns the place is a Mormon and donated $100 to preserve the definition of marriage as that between a man and a woman?
Dec 19, 2008 @ 05:08:51
wow !a real fairy!
Dec 19, 2008 @ 06:45:46
Quick Henry! The Flit!
Dec 19, 2008 @ 22:17:22
i believe in fairies and I have sen one.
Dec 21, 2008 @ 08:34:48
One time I yawned and one flew into my mouth. Tasted like dust and MilkBones.
Dec 21, 2008 @ 19:02:20
Oh, bunk, Bunk! lol
Dec 21, 2008 @ 21:10:38
Bunk…can you fly now?
Dec 21, 2008 @ 21:56:23
No, but my farts smelled like pixie dust for a few days.
Dec 23, 2008 @ 06:51:14
i believe in fairy but I have never seen a fairy before but they might be living in some where else..;)
Dec 23, 2008 @ 07:57:39
When fairies stop believing in people, people will cease to exist. Or not.
Dec 25, 2008 @ 23:31:18
Fake…
Dec 26, 2008 @ 19:32:16
Doubter! Proof?
Dec 26, 2008 @ 22:29:27
I don’t think Stella exists.
Dec 28, 2008 @ 16:33:41
Stanley disagrees.
Dec 28, 2008 @ 17:37:04
Stella exists, but tastes far inferior to other Belgian beers. What say you all?
Dec 28, 2008 @ 21:18:09
I’ve had my share of Belchin beers and taste had nothing to do with it.
Dec 28, 2008 @ 21:48:35
Belgian beers pale in comparison to Dutch brews. Grölsch pulls an Australian Toaster Biscut (makes my mouth waaw-tah!). Heinie can just go ahead and cover its face in shame as it gets beat out by Olympia Gold.
Dec 28, 2008 @ 22:01:14
Stella is and always has been no good, but the other Belgian beers are pretty damn good. I think the quality of the beer varies inversely with the amount spent on marketing it.
Dec 29, 2008 @ 21:35:15
In Stella’s case the quality varies proportionately to the amount consumed.
Dec 30, 2008 @ 09:46:54
Yes, at least until the next morning.
Dec 31, 2008 @ 07:01:29
When Artois comes knocking…
Dec 31, 2008 @ 10:04:38
I always forget him. There’s Artois, Portos, Sleepy, Doc, Marcia, Jan, Peter, John Boy…who else?
Dec 31, 2008 @ 21:35:17
Metro.
Jan 11, 2009 @ 00:06:19
Geez, you disappear for a month and people are all over the place taking your name in vain.
I can’t load this page at work anymore. My computer is too slow. I almost named it “Bunk,” but I have way too much class.
Jan 11, 2009 @ 10:16:43
Metro, we didn’t disappear for a month, we are not all over the place, and nobody took your name in vain. Seems to me your load is your problem. Welcome back.
Aside from grade school, where did you get the bizarre idea that you had class?
Jan 16, 2009 @ 18:59:36
http://www.hoax-slayer.com/derbyshire-fairy-hoax.shtml
Jan 17, 2009 @ 04:00:51
Ah, you’re going to take the word of some uncorroborated site whose business model it is to prove things don’t exist? That’s a vested interest if ever I saw one. And they freely admit that they didn’t examine the object in question themselves, although they had the chance to purchase it for a very reasonable price. That? That is the sound of fear. The fear that their cosy little “debunking” world would come crashing down around them if they dared to actually investigate.
I could probably find some nutter to claim he invented zebras, and there were really no such things. Would that prove zebras to be a myth? I don’t think so.
DEMAND PROOF!!! MAINTAIN THE SCIENTIFIC METHOD!!!
Jan 17, 2009 @ 08:38:42
Ja, ja, bestimmt
Concisely put
Jan 17, 2009 @ 18:09:52
WOW YOU GUYS TALK A LOT AND JUST FOR A FAIRY! I DON’T THINK IT’S REAL. AND IF YOU GUYS DO I THINK YOUR STUPID TO BELIVE THAT. IF YOU SEEN IT IN REAL LIFE AND YOU KNOW WHERE TO SEE IT THEN TELL ME PLEASE, BY THE WAY… YOUR YOU GUYS GROWN UPS, TEENS OR KIDZ?
Jan 17, 2009 @ 18:15:14
hey every one hi! your nice and some are poop poop heads ha!i was just kidding!
thanks!oh and if you say the fairy is fake your stupid or your mom droped you on your head a lot!i think its both!
Jan 17, 2009 @ 18:17:03
ok i’m going to say one more thing
Jan 17, 2009 @ 19:55:08
But sadly ‘destiny’ did not. Probably went to bed early. Dear child. Listen closely in english lessons, dear. Especially the difference between your and you’re.
Jan 18, 2009 @ 08:22:51
I want to know what Droped is! It sounds exotic. Is it a Druidic ritual or something?
Jan 18, 2009 @ 08:26:35
Destiny gave rebirth to an old thread. Do not mock him/her. Leave that up to the professionals.
Jan 19, 2009 @ 03:05:48
Interesting thread, to say the least ;)
Jan 19, 2009 @ 12:10:22
Glad you enjoyed it. Did you see the part where we were tossing dirty puns around in Latin? That was a high point. I need either more caffeine or better gin to reach those heights again.
Jan 20, 2009 @ 14:45:14
You were tossing dirty puns around in Latin? Drat, I missed that.
I didn’t know you studied Latin. Do you have the skirt and everything? Is there a vid?
Jan 21, 2009 @ 02:51:40
ha ha ha hue hue hue is that true?
Jan 22, 2009 @ 14:28:02
The fairies exist. They are responsible for the Miracle on the Hudson, which shows how nice they really are, since several hundred were found mangled in the engines.
Jan 22, 2009 @ 14:36:45
My god! I didn’t hear a thing about that; there must be a coverup!
Jan 23, 2009 @ 07:06:21
Trojan geese.
Jan 23, 2009 @ 14:34:11
This!
Is!
Canada!
Jan 30, 2009 @ 19:07:33
Faeries totally do exist!
Jan 31, 2009 @ 04:54:29
Does Sami have totally additional Proof? Gotta trash the naysayers.
Jan 31, 2009 @ 05:20:45
Hmmm, although I feel this is not a real fairy, I believe. And although this is a blog about who believes, and who does not, is the name calling found in the early section of this blog really necessary? If you don’t believe in Faefolk, just say so and move on with your life. There’s no need in bringing male and female genitalia into this, because this is not a blog for that. Oh, and btw, anyone who misspells ‘vagina,’ and then goes back to try to correct themselves, only to misspell the word again: you’ve lost your typing privileges until you can find a dictionary or receive a passing grade in Spelling & Grammar. Got back to the 3rd grade, sweetie. [PS: Today is my birthday, the Faefolk and I are going to celebrate in a Fairy circle dancing the night away.]
Jan 31, 2009 @ 09:32:54
Oh, there’s obviously been a terrible misunderstanding. We are ALL ABOUT the namecalling around these parts, particularly where Albanians are involved, or at certain times of the month. This is a blog for the most remarkable trash-talking, I can assure you. I know the owner.
Jan 31, 2009 @ 15:29:07
Is that so? Well, my apologizes for my ignorance. I guess I missed where the discussion went from ‘Is this real?’ to ‘You cocksucking sonofabitch!’ I’ll be sure to keep that in mind for the length of my visit here on this blog. C=
Jan 31, 2009 @ 15:59:39
it is realy? no i’m sure…
Jan 31, 2009 @ 19:19:15
Julia, darling, if you wander around the internet telling people what their blogs are about you must expect to get smacked upside the head now and again. Consider it a learning experience.
And yes, you’ve obviously managed to skip the great Metro/Bunk debates.
Jan 31, 2009 @ 23:09:26
Rain– Last night I realized that I’d never read all the way through this thread. (Mr. Smuggles obviously was off his meds.) Hope that Julia understands that he was a bizarre aberration to an otherwise thoughtful debate.
Metro & I were having fun, but then you called us on it. How big a traffic spike did you get during “The Faerie Wars of 2008?”
Jan 31, 2009 @ 23:24:56
Unfortunately, not enough. Not nearly enough. My friend Arieanna has over 1500 comments on her post about the Victoria’s Secret fashion show. It’s just not fair! They have wings, fairies have wings, I thought Victoria’s Secret was really popular with Fairies and vice versa!
Feb 01, 2009 @ 01:49:39
So, like, um, you’re giving up? Screw Arieanna. He’s going down like Dracula’s boyfriend. Down for the Count.
Feb 01, 2009 @ 01:51:47
Okay. “She’s.” Same difference.
Feb 01, 2009 @ 02:21:05
Giving up? Oh, hardly! I’m resolved to pimp this thing out on Twitter at least once a day until we pass her. She hasn’t had any comments in months, and obviously we’ve got momentum on our side.
Feb 01, 2009 @ 02:37:28
Lemme know if I can help with your pimpage. No charge. Think of me as your benevolent slut.
Feb 01, 2009 @ 08:57:59
1376
Your Grace
I flatter myself that I agree with that Young Lady on so many things (eg the more amiable spelling Julia, in preference to another aberrant, anti-soviet spelling)
BUT
I don’t think that Mlle Julia has quite got it
Yea Verily, Name-calling … but only in a pleasant & erudite way …. saving and excepting ONLY denounciations of Evolutionistas & Tree-Oktopodia unBelievers and Harrumphers (especially in Latin)
and one can end this phase of the Long-March to 3000 Komments only with the Langweilig Senator Cato’s memorable Saying :
Carthago est Delenda
Your Grace’s obedient servant etc
G Eagle
Feb 01, 2009 @ 10:48:28
i think fairies really do exist wether seen or not. and that mummified pic does look real but who knows wether or not it is. things we can do with technology these days.
Feb 01, 2009 @ 11:57:09
I would like to believe in the fairies. But nowadays already everything solvable with the technology… you do not know it we you are the true one false.
Feb 01, 2009 @ 22:54:20
I think we should look around and see if we can’t get a fairy to make a comment. That’d settle the doubters!
Carthago est Delenda FTW!
Feb 01, 2009 @ 23:54:03
Hey stop fighting! Don’t you know that the fairy was my cousin! Yes we are true stop non-believing or you shall kill me next!
Feb 02, 2009 @ 00:05:38
OMG TINK!!! I thought you were dead!!!
Feb 02, 2009 @ 01:45:30
Well I’m not dead. But my cousin is!
R.I.P Lucindia
Feb 02, 2009 @ 06:06:16
Tink you little slut. There you go spreading rumors again. You’ve been a pain to me for 112 years now, just because I’m big boned. Get off my ass.
Feb 02, 2009 @ 06:35:40
Fairies are always so bloody dramatic!
Feb 02, 2009 @ 19:05:32
i believe in fairies thier fab so there stiletto !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! eat that !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! poopoo
Feb 02, 2009 @ 21:46:37
I wouldn’t dare Stiletto. You just don’t know WHAT that girl might do!
1385! Only 115 more to hit 1500, only about 150 to pass Arieanna. ONWARD, my friends! For Friendship! For Glory! For Spartaaaaaaaaaaaaaaaaaaaaaaaaaaa!
Feb 03, 2009 @ 00:02:15
I totalyyyyyyyyyyyyyyyy belive in fairies!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Feb 03, 2009 @ 07:56:01
Seems to me that Alexia is suffering from a bout of plagiarism. Look at the similarities between her comment and that of Roxie’s, i.e., “!!!!!!!!!!!!!!!!!!!!” and “!!!!!!!!!!!!!!!!!!!!!!!! poopoo.”
Am I missing something?
Feb 04, 2009 @ 19:52:18
Well on BBC it says that it was just a prank but it looks like it could be real.
Feb 05, 2009 @ 00:45:54
Bunk, good catch! Someone should report that!
Ariel, it ill behooves one of your illustrious name to sow seeds of doubt, however tentative. After all, who are you going to believe: The BBC, or some blogger you found on Google?
Feb 05, 2009 @ 04:58:40
Reported as requested. As for the BeeB, I’m guessing they’re covering up for their own 25% by denying it.
Feb 05, 2009 @ 18:32:58
I dunno–I’d believe it more if it wasn’t the Beeb. I mean, who trusts fact-based reporting?
Now if it was on FOX, or maybe the Sports Network … I’d totally believe fairies were sponsored by Coors Light.
Feb 05, 2009 @ 20:25:52
No, I’m with Bunk…there are too many of them actually working at the Beeb. It’s a coverup job.
Now, who committed the murder? Is this a case of fairy-bashing?
Feb 06, 2009 @ 03:57:38
I must do my part to bring the comment number up. I apologize for coming so late to the discussion. I have just read this entire thread and now my tea is cold. That is how fascinating a read it was, it made me completely forget that I had tea steeping, it also saved me from brooding about the fact that my poor darling husband announced today that he is depressed about his life and doesn’t want to talk about it and when I came back from walking the dog at 8:30 he was in bed. So the Metro/Bunk flamewars were definitely good for something! Thank you all.
I believe in fairies, also dragons. I have many dragons in my home and they are touchy things go live with. I suspect fairies might be as well. It was gratifying to finally see proof that fairies exist, even though the discoverer has reneged on his discovery, I’m sure that it was under duress.
I believe! Long live Raincoaster! Long may this thread become, and in record time.
Feb 06, 2009 @ 07:28:27
HMH– Dragons are easy, like dogs. Dogs demand food and attention, but that’s all. Fairies are petulant, like, um, well, fairies. They abhor attention, complain about not getting any, and then get all humpy when you get the badminton set out. You can’t reason with ‘em.
Feb 06, 2009 @ 07:44:50
Not only that, but they are prone to swap babies out for their own and only tell you years later. Also, they drink like fish. Very few people know that.
Feb 06, 2009 @ 07:53:04
Bastards.
Feb 06, 2009 @ 08:01:16
Cutsey little baby swappin’ moth lookin’ bastards.
Feb 06, 2009 @ 08:20:31
Exactly! That’s the spirit! Buggers have a noted tendency to make off with decorative youths as well, return them eight hundred years later for that Rip Van Winkle cultural dislocation, just for shits and giggles.
Feb 06, 2009 @ 08:48:17
Your Grace
This is a serious Educational Blogge, much appreciated by Ladies, Children and erudite Animals
It would be matter of Profound Obligation & Gratulation if your Grace could prevail upon the perceptive Monsieur Metro to refrain from using the “Light C….” Expression
ScHocking – inexcusable when he could have given Guinness a favourable mention
No wonder there are not more Live Faeries in the Tree-Octopus Forests of Canuckistan, if this is the kind of Beer that they’re expected to imbibe as a Palliative to the Recession
Yr Grace’s obedient servant etc
G E
Feb 06, 2009 @ 11:12:04
He has been known to consume Pilsner. No word of a lie: Pilsner. And he doesn’t even pretend it’s not voluntary.
1401! Yay!
Feb 06, 2009 @ 12:44:57
Isn’t that a first: you read the label of something before drinking it! Good for you.
Though I wish you’d started doing it earlier–Windshield washer fluid is expensive.
Feb 06, 2009 @ 14:29:59
I submit that light C, nay any “light beer” is not actually beer but diluted piss, most possibly piss from draft horses, and should not be mentioned in the same breath (or blog?) as the hallowed brews such as Guinness.
Perhaps I am living with a petulant fairy child sneakily snuck into the large brood of children produced by the parents of the person I am presently co-occupying with. That would explain a lot.
Dragons, being magical on their own account are not averse to peeves and petulance themselves, and considering their fire breathing properties and general largeness can be quite appalling when petlized.
Not that I would ever doubt a tiny fairy’s ability to make life miserable and create destruction in their wake.
Feb 06, 2009 @ 22:07:27
HMH– Are you talking about Darryl (The Captain and Toenail) Dragon? I didn’t think he was magical. I thought he was a schwantz.
Feb 07, 2009 @ 02:48:22
Maybe HMH was referring to Ricky “The Dragon” Steamboat?
He was WWF, and displayed a certain amount of peeve and petulance during that time. But I think that was in his contract, so I’m not sure it counts.
Feb 07, 2009 @ 05:04:53
WWF? Wide Wharf Fairy? Maybe http://www.carmendragon.com/ instead. I dunno, Babs. I’m just shooting in the dark at a moving targoid.
Feb 07, 2009 @ 05:06:37
What if HMH is really talking about Dragoons?
Feb 07, 2009 @ 06:01:33
ewwwwwww. that is sooooooo gross but kind of cool and the close up! yoi can see its bones oh and i have a question IS IT REAL???????? it looks awesome
Feb 07, 2009 @ 06:04:57
i love faries but not dead ones!!!!!!!!!!!!!!!!
Feb 07, 2009 @ 07:11:59
That’s good. It would make you a gay necrophiliac, and that could seriously damage your chances of getting into a good school
Feb 07, 2009 @ 23:05:48
Okay, no doubt I love fairies, but this is overboard. I don’t know if it’s real or not but like somone else said, let it stay in the imagination.
Feb 07, 2009 @ 23:33:03
Ah, another who claims ambiguity. Can you people not SEE the Police Evidence Bag? And latex gloves? What kind of two bit hoaxer would wear genuine latex gloves? I ask yez.
Feb 08, 2009 @ 00:05:30
poxa eu não sabia que fadas existiam, achei muito interesante, é incrivel estou sem palavras, é inacreditavel, achei muito legal.
Feb 08, 2009 @ 01:59:20
Se ou acredita, ou um não faz. A opinião não muda a verdade.
Feb 08, 2009 @ 02:05:28
Babelfish sucks.
Feb 08, 2009 @ 21:16:05
What’s Portugese for “Babelfish sucks?”
Feb 09, 2009 @ 03:05:23
hey this is so cool!!!!!!!!!!!!!!!!!!!!!!i am the bestest fairy fan in the world!!!i practiclly screamed when i saw this!!!!!!!!!!i hope that u like this as much as i did!
Feb 09, 2009 @ 05:03:44
Babelfish suga, according to Babelfish.
Feb 09, 2009 @ 17:15:56
i do think fairys exist but how do you know that it could be something else and with four leaves stuck on to it .
but i could be wrong you will never know in a million years
Feb 11, 2009 @ 21:30:09
I think fairies are real but that one is fake they don’t really look like that they are smaller and live all around us they also make things go missing sometimes. And they love shinny things ,thier favorite to do is take your keys and hide them cuz they jingle and they;re shinny
Bye Bye now
Feb 12, 2009 @ 02:40:16
Did the gnomes put you up to this?
DID THEY?!?
Feb 12, 2009 @ 10:57:20
wat ever
Feb 12, 2009 @ 17:48:00
A GNOMISH SPY!
Feb 13, 2009 @ 00:19:44
What kind of shinny things do fairies like? Would those be tibial shinny things or fibular ones? I was unaware that fairies had an obsession with hockey goalie and baseball catcher protective gear. . .
Feb 14, 2009 @ 12:12:25
you guys im a girl and bunk strutts i like the way you think! oh ya rhilipa i don’t care how you spell it it sounds right to me!and i go to bed at nine i am told i have to and i do!you guys don’t talk about the fairy a lot.and im only on on the week ends and raincoaster you act a little like your very smart. how old are you guys?but i have one more thing to say you guys rock! how you guys act like if some one do not think the fairy thing is not real you say some thing to make them think its real!
I LIKE THAT! IF YOU KNOW WHAT I MEAN!? AND ITS WAS DESTINY
destiny was here
Feb 14, 2009 @ 12:15:02
i mean if the faiy thing is real! NEVER MIND!!!!!!!!!!!=P
=] ;] -.- ^.^
Feb 14, 2009 @ 12:18:53
OMG I SAID AND ITS WAS DESTINY I MEAN THIS WAS DESTINY! GIVE ME A BREAK YOU GUYS! please?! AND I SAI IF THEY DO
NOT THINK THE FAIRY IS NOT REAL!!! OMG I MEAN IF THEY THINK THE FAIRY IS REAL! or i think that is what i mean to say i don’t know you tell me!!!!!!!!!!!!!!!!!!!!!!!
Feb 15, 2009 @ 08:17:28
TY DSTNY UR D 1LY 1.
BNK
Feb 15, 2009 @ 08:49:36
Zac Efron is SO banned! Stupid little gnome!
Feb 15, 2009 @ 17:56:05
plz wright back and plz wright a little more facts about the fairy i would love to hear more oh and just olny post it to me….:-)
Feb 16, 2009 @ 06:24:44
No.
Feb 22, 2009 @ 11:03:54
Next time, bother to use old goose feathers, or raven feathers, heck, any feathers, but not decomposed oak leaves. Hey, anyone ever actually seen a bird?
Feb 22, 2009 @ 11:21:40
Feathers? FEATHERS? What kind of demented pervert are you? Fairies don’t have feathers! You’re some kind of avian necrophiliac, aren’t you?
Feb 22, 2009 @ 12:14:38
I might have had my doubts if it hadn’t been for the presence of the Police Evidence baggie in the photography. Suddenly my skepticism vanished. Good work uncovering this, raincoaster.
Feb 22, 2009 @ 12:27:23
I live to serve.
Feb 22, 2009 @ 16:09:28
So all a scientist would have to do to test if your fairy is real or fake would be to take a strand of hair from the head and test it for DNA. If it comes back human than its probably a prank. If it comes back something else, well then I would image that you might have yourselves a real fairy.
Feb 22, 2009 @ 23:01:25
Faeries don’t have DNA. They have WTF instead.
Feb 23, 2009 @ 01:03:36
Alas, we’ll never know. The corpse was purchased by an unnamed cartel and hidden away, never to be examined by Science.
Feb 23, 2009 @ 02:02:21
GNOMES!
Feb 23, 2009 @ 07:42:37
OH MY GOD YES! OF COURSE! how could I have been so blind?
Feb 23, 2009 @ 07:57:04
The BASTARDS.
Feb 23, 2009 @ 07:57:37
Cutsey little lawn sittin’ Santa lookin’ bastards.
Feb 23, 2009 @ 09:20:06
Fuckers! Why, there’s one out on my patio right this minute! The raccoons turned his head to the wall, but that means nothing to the metaphysical beings.
I see I need an exorcist!
Feb 26, 2009 @ 23:01:54
ii wanna say iis thiis real because i dont no if there real but i do belive in them
Feb 27, 2009 @ 01:45:12
Well, we have more photographic evidence coming soon, don’t you worry.
Feb 27, 2009 @ 03:19:57
You guy’s need a life i beleave in aliens sum what but FAIRY’S please only on my wall they are real.hahahahahaha…..GET A LIFE……..
Feb 27, 2009 @ 03:46:38
You have a wall of fairies? What is that, taxidermy? OH MY GOD YOU ARE THE KILLER!!!
Mar 01, 2009 @ 02:34:22
I think he’s referring to decoupage.
Mar 02, 2009 @ 08:26:09
thats made of clay
Mar 02, 2009 @ 11:06:50
And THAT is what you call a completely unsubstantiated claim.
Mar 03, 2009 @ 08:41:22
Jack meant clam, and vice versa. It’s made of clam. Completely unsubstantiated clam.
Mar 03, 2009 @ 08:46:23
1452 – wasn’t that the year before Constantinople was liberated and 40 years before the Mexicans discovered Columbus
If the perceptive Senor Strutts is right, how can we be sure that no clam was hurt in the making of this Post
Mar 03, 2009 @ 13:41:10
But DO clams transubstantiate? I thought that was just bread.
Mar 03, 2009 @ 15:21:21
And wine, don’t neglect the vino.
Mar 04, 2009 @ 11:23:19
I NEVER neglect the vino.
Mar 05, 2009 @ 01:59:53
wow I THOUGHT THIS WAS 4 REAL!! no way its fake i say they did a good job!! but its kinda creepy!!! :, really sigh!:(
Mar 05, 2009 @ 04:27:47
god you guys are idiots aye fairies are NOT true ok. believe in something else like ghosts and all that. i’ve been in a fairy ring at night time and i DIDN’T SEE ANY FAIRIES
Mar 05, 2009 @ 04:35:13
You guys have to grow up and get a life aye. i’ve seen ghosts and other freaky things ok. fairy’s were probably alive many many years ago when the gods were first introduced you know hercules yeah but it is best that you only imagine them and don’t say nefin 2 anyone because people might think you are loopy and shit so yeah just listen to my advice and believe in something else. N hey you know that there are more than one god kos the black hole leads into many other galaxies so why just beieve in one god when there are many more.
Mar 05, 2009 @ 06:59:36
You don’t believe in fairies because you were in a fairy circle once and you didn’t see them? But you didn’t see me either, did you? And I’m right here. Explain that one.
Mar 05, 2009 @ 07:41:29
Beer goggles.
Mar 05, 2009 @ 08:31:38
Obviously. How people can be so incredibly dense…on the other hand, there’s no proof I’m NOT a god, right?
Mar 05, 2009 @ 08:43:52
More beer goggles.
Mar 05, 2009 @ 15:27:32
ooohhhhhhhhhhhhhhh my gold…ùù
ma è fintooooooooooooooo
Mar 06, 2009 @ 22:59:48
moi je m appelle thirtsa pis chut certaine que les fée existe
Mar 07, 2009 @ 12:33:00
Fairies are real damn it!! Look at the damn proof right here !!! wtf!!!
Mar 07, 2009 @ 12:35:36
made ya look didn’t it!!!
Mar 07, 2009 @ 16:32:52
Now we’ve got an international coalition of Fairy Rights Activists! There will be no stopping us now!
Mar 08, 2009 @ 16:55:02
Funny, she’s in the same position as Ötzi was found. :)
Congrats to the creators! Good job! I wish I was such a good miniature maker…
L.
Mar 16, 2009 @ 15:38:07
Ötzi? Wasn’t he found in a foetus position?
Mar 16, 2009 @ 15:55:39
Well obviously; fairies were never fetal in the first place, therefore they do not assume the fetal position, while humans do. Duh.
Mar 19, 2009 @ 01:05:45
So if fairies are not ever fetal, do they spring fully formed from the brow of their parent, like Athena being born from Zeus?
Mar 19, 2009 @ 06:54:03
Blaspheming magic hand healing skeptic.
Mar 19, 2009 @ 07:08:30
I think they come from mushrooms. They crawl out from between the folds on the underside like baby kangaroos.
Mar 19, 2009 @ 07:16:56
Now I gotta clean the snot off the monitor again.
Mar 19, 2009 @ 09:14:15
Only bogeys come from snot! You could have a bogey outbreak in your computer now!
Mar 31, 2009 @ 23:04:47
this is amazing are these actuly real?! do you have any other photos of these amazing creaturs?
Apr 09, 2009 @ 19:58:07
While the pictures are fascinating and the story an honest wish come true (apart from the fairy being dead of course) the best part of this blog has got to be the comments.
Such witty debate/combacks.
And I do believe in fairies. I do, I do~
Apr 09, 2009 @ 22:06:40
We are glad to welcome another True Believer into our happy coterie.
Apr 10, 2009 @ 05:42:02
(Psst. Sarah. Rain ignored you. Don’t get sucked in… Stand up to the Vortex.)
Apr 10, 2009 @ 09:27:11
Not at all. We must all sooner or later face the truth. Allow me to present THE TRUTH:
http://raincoaster.com/category/fairies/
Apr 12, 2009 @ 17:43:06
Wow, this is a REALLY long debate! Ha ha ha! It’s a really authentic looking picture! I hope it isn’t a fake: It would be SO cool if fairies exist! i believe in fairies. When i was a little girl, me and my freinds used to play games and pretend we were faries! I still believe in them. Well, i was actually looking for pictures of Nessie and for some random reason i found this! Ha ha ha! Well, i hope faries are discovered and protected some day! XXX
Apr 13, 2009 @ 02:06:16
Protected??? WHAT A FABULOUS IDEA! Yes, we should contact teh World Wildlife Federation and get Sting to do a telethon or Saint Bob Geldof to do a concert. Yeah, that’s a brilliant idea!
Apr 13, 2009 @ 06:39:25
Dear Mr. Raincoaster,
We understand you have questions for the World Wildlife Federation (WWF) regarding our work with species preservation. Please be assured that a donation is not required at this time.
Cordially,
Dr. Robert “Bobbie” Bieber, FFS
Gladstone, MD
[Automated response generated by TorpalSearch, Inc.]
Apr 13, 2009 @ 06:57:54
Super! When can we expect fairies to become a protected species? They’ve been in danger of dying out for over a century, as the great playwright Barry made clear in his magnum opus, “Peter Pan.”
Apr 14, 2009 @ 07:11:11
Dear Mr. Raincoaster,
Thank you for contacting the World Wildlife Federation (WWF) regarding our work with species preservation. We appreciate your kind offer to volunteer, and hope that you continue to support our efforts to assist endangered species and to preserve the environment for future generations.
Please fill out the attached form so that we may better assess your strengths and desires for species preservation worldwide.
Cordially,
Dr. Robert “Bobbie” Bieber, FFS
Gladstone, MD
[Automated response generated by TorpalSearch, Inc.]
Apr 14, 2009 @ 08:24:35
We’re making progress, people!
Apr 14, 2009 @ 08:35:40
Mr. Raincoaster???
Apr 14, 2009 @ 08:46:02
I definitely believe in fairies and I strongly support your endeavours to have the Little People protected. I look forward to reading a policy statement intended to provide a guide for stakeholders in determining whether any proposed action is likely to have a significant impact on the FF in temperate and semi-arid areas across the current and historic range.
Apr 14, 2009 @ 09:06:14
Hmm, the impact of global warming on fairy populations. It’s been mentioned in this thread before. A conspiracy, perhaps? There is so much to think about.
Az: what can you expect from a bureaucrat?
Apr 23, 2009 @ 23:08:28
HAHAHA!!! This is so fake, it’s not even funny!
Why do people waste their time tyring to trick people into this crap??! It’s utterly absurd.
Apr 23, 2009 @ 23:19:19
Again, an usubstantiated, poorly-spelled attempt to put down the truth. You make me laugh.
Apr 24, 2009 @ 19:14:05
Personally, I spell it “færie”, but then I’m ancient. HUZZAH for the news, howsoever.
Apr 25, 2009 @ 01:16:47
Re: FairiesRFake’s comment: Could it be? After reading his/her/its clear logic, I’m beginning to have doubts. What if this really IS a hoax/hosejob and we’ve been defending it all this time? Oh man…
Apr 25, 2009 @ 04:35:38
I became uncontrollably excited when I saw my comment count on this post was at 1505, but sadly that was a fakeout; no doubt the faeries/fairies up to their old tricks! Leprechaun gold…faierie comments…same old same old!
Apr 25, 2009 @ 05:23:19
A married couple in their sixties are visited by a fairy, who grants them both a wish.
“I want to travel around the world with my husband”, said the wife, and two plane tickets magically appear in her hand.
The husband says: “sorry love, but my wish is to have a wife thirty years younger than me”, so the fairy waves her wand and the husband turns ninety.
The moral of the story: men who are ungrateful bastards should remember fairies are female, as this one clearly is.
Apr 25, 2009 @ 06:41:52
A married couple are visited by a fairy, who grants them each a wish. The husband wishes his wife had bigger boobs, and the wife wishes her husband had a bigger swantz.
The fairy grants them their wishes.
That night, at the stroke of twelve, Nancy Pelosi, Harry Reid and Barney Frank all materialize in the couple’s bedroom and discuss prosecuting them for imaginary transgressions against THE PARTY.
Apr 25, 2009 @ 07:51:21
Her Grace Scarlett RegenCoaster La Marchionesse de WitchHampton under Buzzard de La Zouche
Your Grace
Buona Giornata
In these ever=gloomier ErgoNomic Times, this Serious Erudite Educational Blogge still attracts such Earnest Debate, Humour (err …. humOr, for visitors from the Middle Colonies) und 1497 Komments
Even the entertaining Guido Fawkes scored only 1294 Komments on 19 April, despite its Tragique Human-Interest Tale of the ScHocking Spillage of Holy Liquid (err … for non-Oirish visitors – Guinness), in what was surely not a malicious politically-motivated incident
Truly did Cato say :
Carthago est Delenda
[Lower Beer Taxes]
AND indeed
Scipio Africanus has been vindicated, when observing with such economy of language & directness of perception :
Nil ReiPublicae Romanae Desperandum est
[God Save America from the Republicans]
J’ai l’Honneur de rester le Vestre Grace’s servant obedient and
Ciao
Der Graue Adler
Apr 25, 2009 @ 18:45:53
G. Eagle, as always a pleasure to welcome you back to the blog and this thread. Even if I must do so with a dictionary in one hand.
Bunk: I don’t know, that sounds like QUITE a party to me!
Karl, thank you. Yes, something to keep in mind, definitely.
May 06, 2009 @ 15:25:30
Ha! they finally killed off Tink XD hehe
May 06, 2009 @ 22:12:02
Is that fairy rill or what cuz i want to now!!!
May 07, 2009 @ 07:02:34
Wow…briliant!:)
May 07, 2009 @ 20:22:17
Yay, 1502!
May 09, 2009 @ 05:36:23
Miriam: perhaps you are on to something. This could be the remains of a Rill Fairy. One of the most elusive variants. It isn’t very common that a rill is large enough for a ring of mushrooms to grow in (that would usually require a gully or an even a streambed), but it IS possible that is where this fairy came from. I would like to look into your hypothesis further, but I would need to know what from the picture first brought you to this notion? It’d really help as a starting point for the research.
May 09, 2009 @ 06:20:53
I am so, so very proud to be presenting the foremost resource for the proper classification of the wild Devonshire fairy. Truly, the scholarship in these comments is remarkable and inspiring. Surely the same collegial, intellectual atmosphere pervaded Los Alamos in the early days.
May 09, 2009 @ 09:46:43
Actually I understand that Los Alamos is the very place that a lampshade was first worn on a head during the weekly “brainstorming” sessions. I won’t go into the nitty-gritty, but it is no coincidence that removing one’s trousers while wearing a lampshade is known as “Oppenheimer’s Folly.”
May 09, 2009 @ 11:30:43
In retrospect, that explains a great deal of the history of the mid-Twentieth Century.
May 09, 2009 @ 11:56:51
…or at least everything after the Trinity tests.
May 09, 2009 @ 13:21:16
Zing!
May 09, 2009 @ 13:56:41
1509 comments. That’s rather impressive! Most one of my posts has is something in the 60s.
May 09, 2009 @ 14:14:57
This post on my friends’ blog has 1524. Will I beat their record???? ONLY TIME WILL TELL!!!
http://www.blogaholics.ca/archives/2005/11/victorias_secre.html
May 09, 2009 @ 14:31:43
Good to know you’re not competitive!
May 09, 2009 @ 14:46:09
I’m the LEAST competitive person you’ll ever find. Nobody is less competitive than me, NO ONE!!!
May 09, 2009 @ 18:55:11
You’re totally Capt. Apathy of the RCN Indifference when it comes to being competative.
May 09, 2009 @ 20:20:41
Good God. Tink’s remains were scraped off teh undercarriage of a Toro Mower and the discussion has devolved into a discussion of competivityness. I’m gonna get a haircut tomorrow.
May 09, 2009 @ 21:58:06
Was it a Toro Push-Pull?
May 09, 2009 @ 23:30:04
What kind of haircut? A Pixie?
May 10, 2009 @ 01:05:47
rain…
May 10, 2009 @ 02:16:45
You know, I just realized there is no scale on the picture, nor anything to judge by in it. This could be a female gelfling!
May 11, 2009 @ 19:38:55
A reverse mullet.
May 11, 2009 @ 23:30:58
Well, you can see the size of the body bag, although you can’t really judge what kind of hands those are; it could be a giant!
Bunk, you’re getting a Dorothy Hamill? Awesome. Pix or it didn’t happen (you KNOW we’re all about the evidence here).
May 13, 2009 @ 00:58:29
I guess I’m out of the loop… didn’t realize that there was such a thing as a reverse mullet. Let’s go back to Dorothy. Is that the witch’s Dorothy? I don’t think she had a mullet, regular, reverse or inverse. What’s the one that Grampa Munster had? I want that.
May 13, 2009 @ 02:10:37
I think that was a tonsure. Not sure.
May 13, 2009 @ 20:17:55
You could always get a Prince Valiant (aka the “Anton Chigurh”).
May 13, 2009 @ 22:09:13
Did the Sluggo thing in elementary school, Prince Valiant in HaSkoo. It morphed into a Joey Ramone/Frank Zappa in college; later it receded into a mashup of Moe Howard/Flock of Seagulls/Mark Trail. Ever since then I’ve left it up to the local Viet Namese barbers.
May 14, 2009 @ 01:58:19
That’s what I did…ten months ago. Perhaps it is time again.
May 14, 2009 @ 12:52:06
It’s been nearly a year since I had a haircut (the last was rather traumatic, and the post about that horror show is still doing well on Google) except one done by me at three in the morning over the bathroom sink. Those don’t count unless they’re so drastic people assume you were drunk, right?
May 14, 2009 @ 14:37:52
I’ve always thought those were the ones that didn’t count. The “so-bad-it’s-good haircuts” are kinda like shooting the moon.
May 14, 2009 @ 15:26:35
As it happens, I have a post on one of those as well:
http://raincoaster.com/2008/02/02/black-and-white-and-banned-all-over/
May 14, 2009 @ 19:52:26
That was more of a blog about tattoos that had a hair filling.
May 14, 2009 @ 22:27:01
Dear Mr. Raincoaster,
Thank you for contacting the Federal Faerie Preservation Society (FFPS)regarding our work with species preservation. We appreciate your kind offer to volunteer, and hope that you continue to support our efforts to assist endangered species and to preserve the environment for future generations.
However, we must inform you that your contribution was not received in a timely manner. This has resulted in the well-publicized demise of a significant number of chimaera, including wood faeries. Faeries do not have a voice: please give them one by contributing today.
Cordially,
Dr. Robert “Bobbie” Bieber, FFPS
Gladstone, MD
[Automated response generated by TorpalSearch, Inc.]
May 15, 2009 @ 00:27:28
I hate it when government agencies change their names.
May 15, 2009 @ 21:15:57
That’s obviously why they didn’t get my application in time!
May 15, 2009 @ 21:44:01
Well you would have known had you gone down to their office and seen the notice posted on the break-room cork-board that the agency name was changing. I mean it’s been posted there for six months, just under the ad for the Gibson guitar somebody has been trying to sell for the last four months.
May 15, 2009 @ 23:44:02
Dear Mr. Raincoaster,
Thank you for your generous donation of $10.00 per month.
Please forward your contribution promptly such that we may continue to preserve the Faerie Species for all the worlds’ children’s children to enjoy for generations to come.
It would be a shame to see such magnificent creatures wither away, to suffer for days, months, only to die out, when we have the solution for their preservation so cose at hand.
Please consider increasing the amount of your monthly contribution. We may be able to avert this modern ecological holocaust, but only with your kind and generous help.
Cordially,
Dr. Robert “Bobbie” Bieber, FFPS
Gladstone, MD
[Automated response generated by TorpalSearch, Inc.]
May 16, 2009 @ 02:13:59
The cheque is in the mail. Posties are even less dependable than fairies, however. Not to mention the Posties who ARE fairies.
May 16, 2009 @ 03:28:02
Small humanoids with wings that deliver messages?
Mini-Mercuries?
May 21, 2009 @ 19:11:54
Those wings look so fake but the body does look somewhat real, I give 8.4/10 for trying.
Fairies eat cotton candy these days because it’s so sweet and full of sugar!
May 21, 2009 @ 22:08:00
But if that’s true, how do they maintain their trim figures?
May 22, 2009 @ 01:37:09
it says its a two inch body…. so the mans hands are two inches long?
May 22, 2009 @ 18:55:07
Holy Crap, proof of dwarves too! Good catch!
May 22, 2009 @ 20:12:41
“Body” refers to the torso only. Two inches looks about right.
Jun 05, 2009 @ 14:52:47
these pic is cool i think that they r real!!!!!
haha
Jun 05, 2009 @ 16:36:33
We Believers must stick together; look how far all those vampire fetishists have come since Interview with a Vampire!
Jun 05, 2009 @ 16:45:36
Well, that’s it. I’m convinced.
Jun 05, 2009 @ 23:56:10
@Wandering Coyote– Sometimes one must doubt before one believes. Help yourself to the beer in the fridge.
Jun 06, 2009 @ 04:24:14
No shit, those damn Nosferatu-Nuts have had several TV shows too!
wait…we have beer?
Jun 06, 2009 @ 08:14:38
They do exist!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!1111
Jun 06, 2009 @ 19:18:24
@valarmo– Yeah, it’s in the natural ice pit in the back, but now you gotta hack a path since varvara planted the exclamapointweeds. Warning, though: don’t take the Molson’s and replace it with Bud Lite. People will get all humpy and stuff.
rain– The ice pit’s still open, right?
Jun 08, 2009 @ 13:37:07
Well, the Mammoth is taking up most of the space in there. But i think there’s room for one or two more.
Jun 11, 2009 @ 09:31:31
I want to believe in this but its hard to but this evidence is strong
Jun 11, 2009 @ 19:13:53
Honestly, WHAT MORE DO YOU PEOPLE WANT??? DNA SAMPLES????
Jun 22, 2009 @ 11:20:01
this is not legit at all. the creator even said it was a work he had created to see if people still believed in faeries. It was sold on Ebay for 280 pounds and is now in the art collection of a man in the United States.
Jun 22, 2009 @ 23:15:40
No way do fairies weight 280 pounds. The magical kind, I mean.
Jun 22, 2009 @ 23:19:51
*weigh*
Jun 24, 2009 @ 21:48:58
LMAO!!! Stiletto you crazy SOB. Great comment on your hair being done by a fairy!
Jun 25, 2009 @ 01:22:13
Bunk – They do when they wear their battle armor constructed entirely of unobtainium. Those wings are stronger than they look!
I’ll make my way to the icepit, my bush-whacking skills could use some boning up on. …and replace the Molson’s with WHAT?!?! I take offense at such accusations.
I’d replace it with Oly Gold.
Rain – “AAATTGCCCTTGGACTTGAT” First twenty base pairs of fairy genome discovered by me, cheif researcher into Fairy And unKnown’s Eugenics. It’d help if I could get an actual tissue sample though as that run closely resembles the BPs I came up with for aboreal octopii genome.
Jun 25, 2009 @ 04:00:24
If you could obtain a fairy DNA sample from Perez Hilton’s vital organs, I think the gay community of LA would make you a very, very wealthy man. Provided the wound was large enough to be fatal.
Jun 25, 2009 @ 04:01:12
And come to think of it, doesn’t he weigh about 280 pounds? Ah, it’s all coming together.
Jun 28, 2009 @ 20:45:44
little thing sure is cute!
Jun 28, 2009 @ 20:55:02
No doubt about it, those are fairies, not unlike the souther coastal fairies that continue to plague us here.. I have a spray for them
Jun 28, 2009 @ 21:44:32
I personally know many fairies. They are a gentle and loving species with excellent taste.
Jun 29, 2009 @ 00:45:54
AND it’s such shame that apparently they are so highly valued by Tree Octopodia as a culinary delicacy which is free of Coors Lite Beer, as an alternative to over-blubbered American Tourists
Jun 29, 2009 @ 07:35:47
FAKE – everyone knows fairies are only the size of dragon flies – what is this? a mutant giant fairy?
Jun 29, 2009 @ 10:17:15
Wow, I didn’t think about that. A giant mutant fairy? That would explain why it doesn’t quite match up with any existing fairy morphology.
Jun 29, 2009 @ 13:23:51
@michelle– Your assertion that “everyone knows fairies are only the size of dragon flies” is false, therefore the rest of your comment cannot be trusted for accuracy.
Jun 29, 2009 @ 14:28:15
that thing doesn’t even look real! the wings look like leaves, and the body’s proportions do not look real at all. just look at those legs! looks like something i made out of playdoh last week…
Jun 29, 2009 @ 14:32:03
I just noticed something else. the 2nd picture features the “fairy” in an alleged forensic scientist’s hands. but the truth is, forensic scientists doing an autopsy in a lab would never pick up and hold the body/evidence like that. I’m sure everyone knows that, so I don’t have to explain anything more.
Jun 29, 2009 @ 18:59:50
Ha, the ridiculous claim of someone who’s bluffing. How many forensic scientists have you actually seen at work on a dead fairy? EH? Answer me that! And no, CSI:Palm Springs doesn’t count!
Jun 29, 2009 @ 19:39:12
@Principessa– Your assertion that “forensic scientists doing an autopsy in a lab would never pick up and hold the body/evidence like that” is false, as they might pick it up if they absolutely had to. Therefore the rest of your opinion is specious as well.
Jun 30, 2009 @ 12:41:59
Not only that, but I’d like to know her qualifications for critical analysis of forensic scientists. I am of the opinion she’s pulling it out her ass and, as you know, we are far too skeptical to fall for that around these parts.
Jun 30, 2009 @ 14:06:37
this shit is soo retareded get a fucking real job u pricks!!!
Jun 30, 2009 @ 14:17:25
Your comments will be given all the careful consideration which is their due.
Jun 30, 2009 @ 20:19:44
Rain– I noticed that the androgynous Ashley Beagle’s insightful comment anagrams to:
“So, A Short Shittier Deed: Is Genuflect a Jug Cab? I Risk Pork.”
Extrapolation requested.
Jul 01, 2009 @ 01:01:37
“So, A Short Shittier Deed: Is Genuflect a Jug Cab? I Risk Pork.”
Good catch, Bunk. Here’s the scoop (although various international security agencies will not be happy I’ve revealed this):
After an extensive analysis of this thread sometime last Fall, I and my advisors came to the conclusion that it was being used to transmit coded messages among the Transnational Repressionary Occidental Littlepeoples Legion Society, or TROLLS. It took weeks to break their code, but we isolated ourselves under a mountain in Connemara and, after a long struggle, succeeded in cracking it.
We have been watching these comments closely ever since.
The selection you so cleverly isolated, “So, A Short Shittier Deed: Is Genuflect a Jug Cab? I Risk Pork” means nothing more nor less than “Stir the pot in Iran and make sure to stamp out everyone on Twitter with green avatars; they are in solidarity with the Iranian Fairies.”
Note: Ahmadinejad has repeatedly said there are no fairies in Iran. You and I? We know better.
Jul 03, 2009 @ 08:10:05
I believe in Fairy’s..
alsow this is fake..
Jul 03, 2009 @ 15:40:03
Fairy? Hmmm … :)
Jul 03, 2009 @ 15:58:41
I’m beginning to wonder: the celebrities are dropping like flies. Could they be innocent victims caught in the crossfire of the fairy/meerkat conflict?
Jul 03, 2009 @ 16:50:16
What are the meercats doing now? Is Zsa Zsa next?
Jul 03, 2009 @ 19:06:23
In point of fact, Zsa Zsa Gabor just got released from the hospital, where she’d been confined for some time, fighting off a mysterious illness.
http://news.yahoo.com/s/ap/20090630/ap_en_ce/us_people_zsa_zsa_gabor
What do you think? Were the meerkats just practicing on her, or do Eastern Europeans have built-in resistance to their engineered death squads?
Jul 03, 2009 @ 20:45:01
If you think I’m gonna disparage the MoMos, you’re wrong. We’re disparaging meerkats.
Jul 03, 2009 @ 20:47:15
Cutsey little standy-uppy weasle-lookin’ meercats.
Jul 04, 2009 @ 01:06:53
Cutsey little standy-uppy weasel-lookin’ Michael Jackson and Zsa Zsa Gabor-poisoning meercats, that’s who.
BUT WHY DID THEY HAVE TO KILL KARL MALDEN TOO???
Jul 04, 2009 @ 04:07:08
He knew too much.
Jul 04, 2009 @ 12:24:23
valar– *Snort* So what about Ed McMahon?
Jul 04, 2009 @ 14:12:38
Ed McMahon was involved in the Jerry Lewis telethons for decades…and have you ever looked at the young Jerry Lewis very closely? Doesn’t he resemble a certain cutesy, weaselly creature with which we’re all familiar. Sometimes their alien leaders don’t give them very good disguises.
I’m not saying Ed McMahon was a meerkat. I’m saying Ed McMahon was a Fifth Columnist, working on their side. They took him back just as their Operation Celebrity Rapture began.
Jul 04, 2009 @ 18:05:43
“Meeeeeers Johnny!” It all fits now.
Jul 05, 2009 @ 17:06:23
Bruce – how dare you question my assumption that ” everyone knows that fairies are the size of dragon flies”. It is indeed factually my assumption – I am assuming it and as a matter of fact it is my assumption
Jul 05, 2009 @ 17:12:42
I finally had time to look up morphology om wikipedia – and can now comment –
raincoater you make a good point if the pictute does not match current fairy MORPHOLOGY than the theory of it being a mutant giant fairy is valid
Jul 05, 2009 @ 18:43:31
@Michelle– [to Bruce?]“How dare you question my assumption that everyone knows that fairies are the size of dragon flies.”
My point was that you can’t possibly know everyone, let alone know what every single person in the GlowBall Com-Unity knows about fairies; therefore your argument (and your innocent assumption) is null and void from the start.
There is potential for your theory, though, but you need to provide proof of fairy mutation/acromegaly. That’s gonna be a tough nut to crap.
Jul 05, 2009 @ 18:44:06
*crack*
Jul 05, 2009 @ 22:18:42
You’re all on crack if you think the world is being invaded by Giant Mutant Fairies. There is no need to just make shit up, please. We are having a rational discussion here, an evidence-based examination of the possibility of the existence of fairies and the rising global meerkat conspiracy. Let’s just stick to the FACTS.
Jul 05, 2009 @ 23:20:42
Facts, facts, facts, it is always about the facts
Jul 05, 2009 @ 23:22:34
Now I have to look up acromegaly
Jul 05, 2009 @ 23:49:21
it’s not real ..
Jul 06, 2009 @ 00:10:25
Do you think it’s imaginary??? Look, there are pictures of it; are you saying that’s a Photoshop? Of course it’s real. It was even offered for sale on eBay.
Jul 06, 2009 @ 00:53:01
How much$$
Jul 06, 2009 @ 03:10:26
For the remains of perhaps the last fairy in Derbyshire? How much would be too much? How much could POSSIBLY be enough?
Jul 06, 2009 @ 07:36:06
It is from Derbyshire?
Why didn’t you tell me that changes everything….
Jul 06, 2009 @ 07:43:18
Your Grace
When told “This is totally legit”, why do I find myself anxiously checking my Wallet
Your Grace’s obedient Servant etc
G E
Jul 09, 2009 @ 21:57:02
Nando says he’s seen them on the outskirts of Jakarta.
Jul 14, 2009 @ 00:42:30
G E- because it’s already in your hands as you have no pockets within which to keep it?
rere4444 – Claiming that people suffering from acromegaly actuall have a psychosomatic issue is insensative. A lot of the time it is brought about by a tumor of some sort.
Jul 14, 2009 @ 02:16:31
Um, I’m not sure what to say to that, but thank you guys for my 1600th and 1601st comments!!!
Jul 14, 2009 @ 12:36:42
wow people u need to get a grip cant u just think that maybe fairy’s roamed the earth a one point in time and there most likely still out there alive and u might think i need to get a grip on life but people don’t believe in spirits but we no there out there our kids could be talking to there imaginary friends and u might think aw that’s cute but they could be talking to a ghost because children have more of a mind that believes in any thing some one tells them
Jul 14, 2009 @ 13:03:20
Im n ur post eatin ur punctuation
Jul 15, 2009 @ 00:42:40
Buon Giorno, Signor Ashley
As Trinity should have said to Neo :
It’ not the Punctuation nor the Grammar that drives us
It’s the need for all of us to get a Grippe on Life …. and on our Wallets
Wah, Aah doo declay-are, Miss Scarlett
Even her Britannic Majesty’s Government has begun to realize that it’s running out of our Money to spend on Worthwhile Projects like Moats, Duck-Houses, taxi-fares for the (now former) Speaker’s Wife and her Cleaner when they go shopping
Jul 15, 2009 @ 01:55:13
Fairies used to thrive in those duck houses. Dozens of fairies will now be homeless (how many fairies can dance on the head of a duck? More than you’d think, without him noticing in the slightest). What is Gordo’s plan to house these wandering Little People (and presumable constituents).
Jul 16, 2009 @ 01:53:08
OMG….I can belive.but,it`s 2 fricky to.
Jul 16, 2009 @ 02:46:02
Your Grace
Heil Blair
Euro-Präsident-Elect
Bringer of Peace to the Middle-East
etc, etc
Your Grace & those Fellow Colonials & ex-Colonials should appreciate the benefits of Britisch Rule in the 21st Century
For the last 12 years, Herr Gordo le Grand & Mellifluent has managed the British Economy with SAGE wResponsibility & Great pSuccess
… and he is now pressing that kindly Mr Obama und the frightening Frau Merkel to be sensible about flooding the World with bogus Dollar & Euro Banknotes
Just think how high UK unEmployment statistics would be if Gordo (Saviour of the Universe) had not been so brilliant at multiplying ways of concealing JOBlessNess
Why, his unGrateful Ministers have so massively improved British Education with enHanced SchPelling Tests to efficaciously increase SchPelling Scores which would reassure Ashley & Angel about their challenging letters
We can be confident how deeply Gordo the Sensitive Communicator feels for the fates of British Fairies who, if driven from the shores of what was in Shakespeare’s time, “the envy of many less happier lands” would be exposed to Monsieur Metro’s “milk” saucers & the predations of Tree Oktopodia in British Columbia’s Rain Forests
BUT he is generously willing to give credit to his kindly policy of caring for Fairies & the Aged & the Poor & Infirm and improving their Life-Chances to another dashing American (or was he a Canadian) who so sagaciously opined :
“Frankly, my Dear
I don’t give a Damn”
I remain your Grace’s obedient servant etc
Heil Braun
G E
Jul 16, 2009 @ 03:10:24
I thought he was Australian? I get all those famous anthropologists and comparative pholklorists mixed up.
Jul 17, 2009 @ 09:41:57
This going to be The Ever Ending Stories of Denying Fairy…
Jul 17, 2009 @ 14:22:17
it is if I have anything to say about it!
Jul 18, 2009 @ 04:51:08
They have teeth mice here in Spain. It sorta freaks me out, to be honest. I have no idea why a tooth-hoarding faerie is OK with me but a mouse doing the same thing is somehow perverse. I think it’s because he doesn’t leave money.
Jul 18, 2009 @ 05:01:57
You know, looking at the way that fairy has her hair seemingly tied around her neck, she may have been “hangin” (pardon the pun) with David Carradine just before she expired.
Jul 18, 2009 @ 11:29:26
wow questa è una prova in più per credere alle fate !! io ci credevo anche non vedendo questa fata ritrovata !! ma ora ci credo il doppio !! viva le fate !!
Jul 18, 2009 @ 22:04:54
Yea! Un altro credente da Italia! Yea!
Jul 19, 2009 @ 08:32:37
wow questa è una prova in più per credere alle fate !! io ci credevo anche non vedendo questa fata ritrovata !! ma ora ci credo il doppio !! viva le fate !!
Fata, fate = fairy, fairies
Wow this is a test in more than believing in fairies!! I believed even without also having seen this re=found fairy !! But now I believe doubly !! Long live, the fairies!!
Jul 19, 2009 @ 16:21:09
Sylvia, are you sure he’s not SCOTTISH then?
Jul 19, 2009 @ 17:43:46
Look at the lies spreaded on mashable! http://mashable.com/2009/07/15/internet-hoaxes/
Jul 19, 2009 @ 18:02:48
Well, what can you expect: not ONE direct link to this post. I hardly think the story can be covered adequately without a link to this post, do you?
Jul 19, 2009 @ 18:39:38
Totally not. You’ve got to complain to mashable. Right now.
Jul 19, 2009 @ 19:40:33
You’re covered. Posted twice with linkoids in case the first one was diseased.
Jul 19, 2009 @ 19:49:30
Brilliant, thank you. It’s hardly fair to let them wallow in unsubstantiated repudiations; how do we know that recantation was not obtained under torture? And how can you take the word of an admitted fraudster? Honestly, does no-one CARE about the SCIENTIFIC METHOD anymore?
Jul 19, 2009 @ 20:08:25
rain– Your first two questions appear to be rhetorical, and I although I can’t answer the S/M question, I’ll betcha Nurse M. can.
Jul 19, 2009 @ 20:28:38
She knows scientific methods that would curl the pubes of a dead fairy!
Jul 19, 2009 @ 20:45:11
Dead fairy pubes are straight? Dang. Learn something new every coupla months or so.
Jul 20, 2009 @ 06:57:33
omg, these can’t be real, gosh, quit tryin to trick everyone, and I’m NOT a Godless heathen! I’d like to see the person that calls me that! God is my Lord! hmph
Jul 20, 2009 @ 06:59:37
I do believe in fairies, but don’t you think it is rather odd that the press and he pres. hasn’t gotten to this yet? Very strange, hmm, that’s the only reason why I think this is just a trick
Jul 20, 2009 @ 08:01:35
If the tooth mouse were Scottish, he wouldn’t wait for the tooth to come out on its own before taking it, would he?
Jul 20, 2009 @ 11:29:28
There IS that, I suppose.
Jul 21, 2009 @ 00:11:35
this “finding” would under no reasonable circumstances be considered police evidence…so maybe not so official huh? This is interestingly faked, but u guys are full of shit.
Jul 21, 2009 @ 00:14:57
Ur full of shit, interesting, but still full of shit.
Jul 21, 2009 @ 00:19:26
Two words, big talker: Prove it!
Jul 21, 2009 @ 21:43:25
Ur full of shit. Non sequitur.
Jul 22, 2009 @ 03:15:25
Are you telling us this naysayer is actually giving us the secret location of the Meerkat Conspiracy HQ?
Jul 22, 2009 @ 10:01:16
Cutesy little standy-uppy weasel lookin’ bastards.
Jul 22, 2009 @ 11:14:08
Excusez Moi, Senor Bunk
This may be an entirely understandable opinion for a persecuted Scorpion or a tasty Kalahari Worm to express
BUT
With their voracious appetites, RacCcoons are scarcely in a position to utter pejorative observations about Meerkats, just because they favour (err …. favOr) the Republican Approach to Life
Jul 22, 2009 @ 16:43:20
Ah, but who ever heard of a raccoon conspiring against a fairy? Nobody. Any such allegations are, at this point, completely unsubstantiated, whereas we’ve seen in this very thread the subtle workings of the Great Meerkat Conspiracy.
Jul 22, 2009 @ 20:12:00
“I am not a Raccoon! I am not an animal! I am a human being! I am a man!” –paraphrasing John Merrick
“You are Number 6.” –quoting Number 2.
Which brings us back to the unfounded accusations tossed out by Mr. Noway U. Getname, aka, the New Number 2.
Jul 22, 2009 @ 20:15:34
Take it.
Jul 24, 2009 @ 10:07:46
I’ve seen one before.. and he doesn’t look like the mummified one shown here aside from the size though…
It happened around 7 – 8 in the morning of December, I can still remember how he looks like… orange hair, he’s wearing a striped shirt (alternate blue and black), he’s holding a sword like thing and its black and its shape is like a closed umbrella… And its easy to tell that he’s a guy… They look very much the same like us humans except from the size of course…
the reason why I saw him is because I felt something weird on my hand… I thought it was a mosquito but when I try to move my hand away from my face I saw him, he’s pinching me using his small black sword. Then he stepped back cuz he notice that I caught him in the act and after an instance he’s gone… and even until now I always ask my self why is that thing pinching me… for what reason I still don’t know but I’ll try to find out… And the thing is it doesn’t end there… I can hear them all the time, they always comment on my thoughts and ideas… it seems like they are playing with my mind or maybe they are afraid that I will tell people about this and that is what I am doing now… they’re trying to make me go insane day by day but the God given free will that I have is so strong that’s why I’m still here and able to tell the tale…
I’m looking for someone who can help me surpass this situation that I have… I’m a very strong person but they are more powerful than I and I’m so helpless and vulnerable to them…
I’m looking for ways on how to defend myself at least and somehow…
Here’s my email([edited out by raincoaster because you shouldn't post your email on a blog unless you love getting spam])you can contact me if you experience the same thing or what not or if you have solutions… I’m willing to pay any amount…
Regards,
Jeembo
Jul 24, 2009 @ 18:37:41
@Jeembo:
Dude–that wasn’t a fairy. You were clearly attacked by a Nac Mac Feegle!
Understandably, you mistook the dirty blue hide for a black-and-blue jersey. But you vividly recall the red hair. Congratulations on surviving the encounter!
Jul 24, 2009 @ 19:57:32
Slightly OT, but we’re discussing a handmade aboriginal novelty fake turd over here. If anyone would like to use the phrase, click on the linky, scroll down a tad and join the comments.
[Now back to your previously scheduled program.]
Jul 24, 2009 @ 20:24:34
Oh, I think I’m going to save that for blogathon. See you all in ten hours. Send gin.
Jul 28, 2009 @ 07:06:54
is like in HELL BOY…:)) ;) :P
Aug 04, 2009 @ 22:06:06
How do fairies live, and ware can you find them specifically because that would seem like a good hobby to do for fun, and if I am lucky 1 day actually see one. A take its picture.
I was reading on one of the comments you left I that the fairy died because it wasn’t loved?
-paige
Aug 04, 2009 @ 23:33:53
Well, that’s what nearly happened to Tinkerbell. I’m figuring if indifference is deadly to fairies, we’ve saved many, MANY lives with this comment thread.
Obviously, you can find them in Derbyshire, where they are not loved. Wonder how many are left?
Aug 04, 2009 @ 23:54:14
Rain– I found out what ticks off the Meerkats so much: it’s THIS FRAUDULENCE. Honestly, I can’t blame them.
Aug 04, 2009 @ 23:58:44
Flitty little moth-smellin’ Fairy-lookin’ bastards.
Aug 05, 2009 @ 00:46:34
“Made in China” Oh yeah, I bet she WAS, every Saturday night.
It’s appalling that in this day and age true fairies have to hide while these tinsel-bedecked golems are worshipped in lower middle class, tchochke-bedecked homes around the world.
Aug 09, 2009 @ 09:38:01
omg
Aug 09, 2009 @ 09:40:45
yo mr smuggles shut up
Aug 13, 2009 @ 11:46:01
lol you people are really funny but most fairys are in england but there is one or two in the states
Aug 13, 2009 @ 12:10:50
Yes, Perez Hilton is one of them.
Aug 13, 2009 @ 15:31:45
well i strongly beleive in faires just because there is proof i understand dosent mean its real but r u serious?
look at that.blah blah ” That bears no resemblance whatsoever to Quentin Crisp! Fraud” r u serious dont get all serious r u kidding its right in front of your face if your gonna leave a commet leave one that makes sense dude.
Aug 13, 2009 @ 16:37:53
“Just because there’s proof doesn’t mean it’s real”
Are YOU for real? Because we have no patience on this blog for nonsensical people who are just out to waste our time. None at all. Nosir.
Aug 13, 2009 @ 22:55:36
butfair ies r trust true y dont u thn k thm falz mean wot.Huh
I’m amazed.
Aug 14, 2009 @ 22:48:51
ALL Fairy Supporters know who Quentin Crisp is. You can’t fool me!
Aug 17, 2009 @ 08:53:28
i really believe in fairies
but i really want to believe it
but i just can’t!!!!!
SORRY!!!!
Aug 17, 2009 @ 09:03:32
i love fairies i can’t really tell that it’s fake
and how could you make something so small and delicate
and it looks fake cause it’s old
THAT’S MY OPINION!!!!!!
Aug 17, 2009 @ 21:17:42
WE CAN TELL IT’S YOUR OPINION!!!
To say something is fake because it is old is to betray a deplorable faith in our elders.
Aug 22, 2009 @ 17:25:07
The creator of this model admitted it, later on the day of original publishing, that it was an April Fool’s joke. He does say that he believes in fairies, and was pleasantly surprised at the response from believers, but this particular “fossil” is simply a trick of some fabric and doll parts.
You can find the article by searching “fairy” in Google images and the first hit that comes up tells the story.
Aug 23, 2009 @ 23:31:40
Oh no; once again we have someone who simply takes the word of an admitted liar. When will the world see the point of the Scientific Method? When will the world bow to logic, to proof? Must we wander in a morass of superstition and supposition forever more?
Aug 25, 2009 @ 19:14:31
I beleive in fairies and i always have. this may have said it was a hoax, but i believe in this. it’s hardcore proof.
Aug 26, 2009 @ 16:04:03
Oh Wow!
I Freaking Love Fairy’s!
I Wish I could buy one!
I DO BELIVE IN FAIRYS!
=P
Aug 31, 2009 @ 17:38:30
just throwing this out there…if it waz a “fairy” the wings would not be there, for the wings are not made of bone but a
fethery like material or like what a bugs wings are made of. But what im getting at is that the outline of the wings would not be there the bone; maybe, but not the wings outline.
~FAKE~
Aug 31, 2009 @ 18:36:24
I’m not entirely convinced: do you have an existing post-mortem of a fairy with which to substantiate your claim that the wings are either feathery or bug-like? As always, we require proof of assertions.
Sep 03, 2009 @ 13:55:07
wowwww u r a complete idiot to think this was real hahahaha
Sep 03, 2009 @ 14:03:33
it is a fake! read and weep u dumb blondes: http://news.bbc.co.uk/2/hi/uk_news/england/derbyshire/6514283.stm
Sep 03, 2009 @ 15:33:34
Did you read the comments before you posted? Puh-leeze, we dealt with that YEARS ago. Wasn’t it the BBC who said there were WMD’s in Iraq? I rest my case.
Sep 04, 2009 @ 18:47:56
ALL OF YOU SHUT UP ITS REAL / FAKE OKAY THERE 1/2 is real the other is fake :)
Sep 05, 2009 @ 08:16:54
MEOWMEOwILUHDUHPUSSY what are you talking about? What 1/2 and what other? The bag and gloves are real for sure!
Sep 05, 2009 @ 08:24:33
John Russo, just how do you know what fairies wings are made of? Who says that they go by the natural law of decomposition anyway! They are mythical creatures. Unless you can prove what the wings are made of, then don’t comment just to make yourself sound smart.
Sep 05, 2009 @ 11:28:03
this is fake just so u know it waz proven fake
Sep 05, 2009 @ 11:30:28
u all are fucking fags if u think this is real and u all like to suck huge dicks
Sep 05, 2009 @ 17:01:14
grace, you have no PROOF of that. You never met my ex.
Sep 05, 2009 @ 21:51:22
Hey Grace, do you know of any inbreeding in your family? Your a bit on the slow side huh!!!
Sep 05, 2009 @ 21:53:58
Oh yeah Grace, why don’t you stay on AOL Chat or something where talking like that will make all the 10 year olds think your cool!!!
Sep 06, 2009 @ 00:14:24
That fairy’s family doesn’t believe in you either Grace. They demanded that you pass a Turning test.
Sep 06, 2009 @ 08:55:47
Awesome name valarmorghulis! But all men, nor fairy shall not die!
Sep 06, 2009 @ 09:08:41
For everyone saying it’s fake because the wings look like leaves, DUH it’s a Flower Fairy(spinosissima orioles). What should the wings be made of, rocks or something! Do some research!!!
Sep 06, 2009 @ 14:42:13
Aha, a scientific name. We welcome you to our fellowship of scholarly inquiry.
Sep 06, 2009 @ 22:21:36
you should never start ur article with “This is totally legit.”
Sep 06, 2009 @ 23:10:15
Wai nat?
Sep 08, 2009 @ 06:48:48
What should you start an article with, this is really, truly, and completely fake? Let’s take a vote. Which one would be more likely to be read: A fake moon rock was found in Washington D.C. or A totally legit live gummi bear was found on the outskirts of Poland? You probably weren’t too good at term papers huh datsun?
Sep 08, 2009 @ 08:24:21
do you believe in majic cause i do!!!!!!! this just proves that there is more out there than just us. god mad us all with his majic!! how can you question what we know in our hearts is real! with out majic life wouldnt exist so believe in majic cause god is majic and these are his children too!!!!!!!!!
Sep 10, 2009 @ 18:56:10
Yeah, Becuz Sumwhere iiN Dha Bible He Sayz How He Made All FaiiRies Equal..LMAO
KiiD ii Bet There iiZ Sum type Of supernatural Powerz Out there But Letz BE Real About ThiiZ…!
Sep 11, 2009 @ 02:56:10
Yes, G-Smartz could hardly SchPell more unmemorably
- the wholesome outcome of US Primary Schools, whose achievements include Mr Armstrong’s First Visit to the Moon (with its US Flag blowing in the Wind) and Master Shrub Jnr’s Democratic Triumph in 2000, where he had 55% of the Vote to Mr Gore’s miserable 44%
Indeed, in the earliest Old-World reference to Racoons, the Latin Poet Vergil rose thus to similar heights of eloquence in line 81, book 8, Aeneid :
Ecce autem monstrum subitum et oculis mirabile
[Lo however a racoon sudden and to the eyes marvellous]
Even at the Greatest Extent of their Puissance, the Romans worried about their Empire and the Menace threatened to themselves and endangered Species like Tree Oktopodia & Derbyshire Faeries, if the Racoons were recruited to the Great Meerkat Conspiracy
Sep 12, 2009 @ 10:35:26
Virgil hated raccoons. It’s a little-known fact.
Sep 12, 2009 @ 15:12:13
maybe its the fairy from zelda lmao jk
Sep 18, 2009 @ 01:53:39
Whear have you got the fairy?
Sep 19, 2009 @ 12:21:59
why does it say “2 inch remains” and then in the pic it shows someone holding it in both of their hands, clearly bigger than 2 inches…? dont contradict yourself. lol cool pics though :)
Sep 19, 2009 @ 23:26:35
Readin about this off another site those fairy remains are fake and not legit
Sep 20, 2009 @ 18:56:38
AAAAAAAAAAAAAAAAAAAAAAAAAAHHHH…. FAIRIES….. aye dey found tink….. maybe theyll find peter pan…. and never land…. and oooh….. ooooooooooh…… i wonder if they will ever find unicorn remains…. or better yet…. a live unicorn….
Sep 22, 2009 @ 18:38:19
Re: Ludeawakening89
“A totally legit live gummi bear was found on the outskirts of Poland?”
Dang! I missed that story. Gummi bears, hmm. I shoulda known they were tied up in all this. Cutesy little sticky/squeezy-lookin’ bastards.
And regarding Virgil, he hated raccoons because they kicked his ass up and down the parish, not once but numerous times. Virgil backed off after that, became a hermit and started inventing poetry. The raccoons let him off easy IMO.
Sep 22, 2009 @ 20:10:54
Since you did beg for comments….. ;)
Sep 22, 2009 @ 20:12:02
The history of literature owes those overgrown bandito-rodents more than I could have imagined. Wow.
Sep 22, 2009 @ 20:22:59
Riiiiiiiiight…..
Sep 22, 2009 @ 20:34:12
Ah, another skeptic. Without proof, your disbelief is nothing more than superstitious negation of something obviously proven beyond the shadow of a doubt. You could have purchased the body yourself and done an autopsy. Nothing could be more open, or more obvious, than the reality of this poor, shriveled corpse.
trent, thanks! I’ll get there! I’ll get there!
Sep 22, 2009 @ 20:40:52
Someone needs to meet The Pieman.
Sep 22, 2009 @ 22:02:44
Pieman? Do explain; is he another conspirator with the meerkats, attempting to keep the truth about fairies and unicorns away from the public?
Sep 23, 2009 @ 10:15:50
It was a simple reference to Simon. He might meet the pieman at the fair.
Noticed that this thread is not appearing in my comments feed anymore, so I figgered it was a dead thread. But NoOOoo…
Sep 26, 2009 @ 15:30:24
Alrite..Ive read a lot of dumb things on the internet, but this takes the cake! You guys honestly beleive that faries are real?!? Wow. I have a Suggestion. GET A LIFE! And stop trying to convince other people that faries are real! If you think its soooooooooo important, you must think it will change the world! What’s it gonna do? end world hunger? stop the war? find a cure for cancer? NO!! So get a job, Get some friends, and remember! FARIES.ARENT.REAL.(:
Sep 26, 2009 @ 18:29:57
See:
“FARIES.ARENT.REAL.(:”
That’s the giveaway. Meerkats cannot spell, use punctuation, or do smilies correctly to save their lives. If you can draw them out long enough, they ALWAYS make that mistake.
Sep 27, 2009 @ 20:48:44
Could be that Josie is referring to FarIs in the Rasta vernacular, but it’s hard to tell since she(?) has obviously spent hours combing through this thread to come up with such an unfounded conclusion.
Reading through the proofs on this thread could compel any sentient being to resort to head banging on any convenient hard surface nearby, and I know this via first hand experience.
Sep 28, 2009 @ 00:57:41
Her Grace Mlle La Marchionesse la Regen=Küstner
Your Grace
Heil Braun
I flatter myself that I agree with le Sagacious Monsieur Bunk on so many things
…. apart of course on whether the Governator of California should be asked to swop jobs with the Kindly Gordon Brown, Saviour of the Universe’s Financial System
… or Gordon would be the Saviour if only those brainy anti-soviet German, French, American, Japanese, Chinese, Botswanans, Tongans etc had the wisdom to follow Mr Clunking-Fisted Brown’s advice on QE
BUT surely enLightenment can be soughtnover the mystery of the erudite, perceptive and most welcome Josie’s Suggestions by applying Occam’s Razor — seeking the simplest solution
Namely —- the Meerkat & Unicorn Alliance’s influence continues to spread even into this erudite Space
Es macht man denken, nee
Das ist es, doch
[It makes yer fink, ughh]
[this is it, i'n'it]
Your Grace’s obedient servant etc
G E
Explanatory gNote for Economic Illiterated Visitors, incapable of perceiving Mr Brown’s obvious Wisdoms
QE = Quantitive Easing – flooding the World with Government-Forged Electronic Cash
Sep 28, 2009 @ 15:51:31
Negitory, good buddy. Looks like you’ve been drinking meerkat-tainted kool-aid: the Unicorns and the Fairies are united against the Meerkats. Cthulhu’s position in this is, as always, uncertain. The Great Meerkat Conspiracy attempts to repress knowledge of Unicorns and Fairies and thus to deprive them of fundamental freedoms. A popular writer of the last century did an allegorical novel on the conflict, set in a farm in the English countryside. Wish I could remember what it was called…
Oct 01, 2009 @ 01:11:21
I think it was called “The Return of the Wilderbeest to Tunbridge Wells” by Sir Pithcairn Vapors-Smythe.
Oct 03, 2009 @ 21:21:41
OMG! This is thing has gone on for sometime. And I actually read it. Amazing… I know!
But for the whole fairies and what not.
I mean why not believe they are real?
Everyone needs a little bit of faith in your life.
It would be like slapping a small child and telling it not to have dreams. Come on people.
Believe.
And it shall become.
Oct 03, 2009 @ 21:28:37
And congrades on reaching over 500. x]
Oct 05, 2009 @ 16:17:30
it’s fake. the guy that snapped those photos admitted to it.
Oct 05, 2009 @ 19:46:58
Again, yet again, an unsubstantiated claim with nothing whatsoever to back it up. We didn’t just fall off the turnip truck, you know. You’ve got to have PROOF, scientific PROOF before we believe you around these parts.
Oct 06, 2009 @ 01:38:34
Whoa. But I fell off the turnip truck. Twice, and that negates the first time by a factor of two. Just because you didn’t doesn’t make you an authority by default.
But Joe obviously hasn’t experienced the zen of the turnip vehicle disembarkment yet, so cut the ignoramus some slack.
Oct 10, 2009 @ 07:51:13
perileri çok severim ama böyle peri görmedim ,ona zarar veren herhangibir kişi ise çok kötü olduğu belli.bence bu periyi biri korkutmuş onun için peri de bayılmış ve açlıktan da bu hale gelmiş olabilir.
Oct 10, 2009 @ 07:58:24
bu peri yüz yıl öncede ölmüş olabilir ve bilim adamları veya insanlar bulmuş ve bilim adamlarına göstermiş olabilir,bu nedenle bilim adamları iğice araştırıp resimlerini çekip yolamışlardır.bence bu periyi kim buldu?sorusuna cevap vermek çok kolay ama bu peri kaç yaşında olabilir?bu sorunun cevabını bilim adamlarından bekliyorum
Oct 12, 2009 @ 18:44:37
rain– Are they talking dirty, or just having some serious problems with spellcheck?
Oct 12, 2009 @ 19:01:09
AHA! The Turks are here!
Hoş geldiniz! Biz peri Kartoum eteklerinde bulundu inanıyoruz. Muhtemelen Meerkats tarafından öldürüldü. Soruşturma devam ediyor Nisan 2007 beri.
—————–
Elifsu said:
I love fairies, but we did not see the fairies, any person who hurt him so bad is that for him belli.bence this peri peri also love to have one scare, and starvation, this might have become.
Sila responds:
this fairy in a hundred years ago may have died, and scientists or people have found and scientists may be displayed, so scientists investigate the affairs of the device take pictures, and this fairy yolamışlardır.bence find who was that? answer to the question is very simple, but this fairy may be how old? the answer to the Waiting for scientists.
Oct 12, 2009 @ 22:15:52
Merhaba [G'day], your Grace
As usual, these Sagacious Raccoons are so multi=lingually well-informed
BUT how can one gently suggest to the honest & worthy Joe, that (like Jeeves) perhaps he could profitably engage in some study of Spinosa
This would afford an illustration that even Anglo-Saxon Empiricists and Evolutionists from the Middle-Colonies should not believe everything they read
Allahismarladik [Ciao]und tot siens
L’Aigle Gris
Oct 13, 2009 @ 21:06:28
Bunk, I don’t know what’s up with our two Turkish friends other than they’re obviously having problems formatting links to their porn sites properly.
And I’m not sure, but I THINK they recommended sawing the scientists in half and counting their rings. Can’t hurt is what I say!
Oct 16, 2009 @ 01:33:46
Oh how wonderful would it be… little fairies among us just like in those fairy tales that take us to far away lands!
I would grow a garden just for them to visit. But… reality bites, this world is one very much far from a place far far away… isn’t it
Oct 17, 2009 @ 08:43:07
i consider that “fake”mumifided fairy as some great Art work. i bet it took months for all the details.
Oct 17, 2009 @ 08:54:08
O: I belive in fairies and you better say you do or Tink will die D:< you evil people
Oct 17, 2009 @ 21:27:49
Ya, where do the peaople with the porly drawn monster charaters come from?
Oct 24, 2009 @ 23:36:20
yeah whatevs i would like to believe it… but i need some real facts first. cold hard evidence you know? something we could actually have public access to?
Oct 25, 2009 @ 00:44:41
by the way raincoaster… you sound like a pretty cool person… and i just want to say I do believe in fairies, I am just having a really hard time tellig whether or not that picture is real or not… you know?
Oct 25, 2009 @ 09:05:27
SPONGE BOB SQUARE PANTS! okay that was random lol anyway i think they do exist but there just hiding u really need to look
Oct 28, 2009 @ 01:23:26
My neighbor told me he’s a fairy, that’s how I know they’re real. ‘Cause I actually met one.
That fellow way…… up top there looks like something from the 80′s. Just sayin’.
Oct 28, 2009 @ 07:56:53
WOW.i want to see it.
Nov 04, 2009 @ 04:13:18
WELL i think its real i mean…ALL the stories and fairytails HAD to come from somewhere right????????
Nov 04, 2009 @ 21:05:34
Quite so. Oral history is one of the major tools recognized by historians, sociologists, and archaeologists.
Nov 08, 2009 @ 10:28:26
uhm bringing science into this if fairy was to have hallow bones where it’s marrow is making white blood cells it is this thing would not live past it’s first day out of the womb 0.o
Nov 08, 2009 @ 17:01:51
So, explain BIRDS, then, Oh Robbie Nye the Science Guy!
Nov 12, 2009 @ 01:22:39
So hows this fairy shit work on getting the girls i bet you got your degree online and have never had a girl friend because no one that matters in this world cares a god dam shit in fairies or any other thing that we have don’t have prof on. I mean common a kid could forge that fairy photo you get a police evidence bad somewhere on eabay or something and latex gloves are sold everywhere you dumb ass. I hope you shrivel up and die you fairy believing peace of shit. Oh oh no all the fairies are dead because i don’t believe that much, they should be because if god kills them off because we don’t believe in them there not that very fucking important in the first place. Jesus sorry for the language.
Nov 12, 2009 @ 12:40:02
Seriously guys? It’s a baby primate with plaster and leaves glued to it’s back. If it were real this would be all over the news. I have studied cryptozoology for years and this is amazingly fake.
E-mail me : moonshinefountain@yahoo.com
Nov 12, 2009 @ 13:10:43
that is fake like the other one
Nov 12, 2009 @ 15:34:37
“A baby primate” oh yes? And your proof for this assertion is what, exactly? That you’ve studied something for years obviously doesn’t mean you’ve picked up logical thinking or a demand that statements be backed up with proof!
Why, the assertion that there are primates in Devonshire is itself alarming and unproven!
Nov 15, 2009 @ 03:36:23
So hows this fairy shit work on getting the girls i bet you got your degree online and have never had a girl friend because no one that matters in this world cares a god dam shit in fairies or any other thing that we have don’t have prof on. I mean common a kid could forge that fairy photo you get a police evidence bad somewhere on eabay or something and latex gloves are sold everywhere you dumb ass. I hope you shrivel up and die you fairy believing peace of shit. Oh oh no all the fairies are dead because i don’t believe that much, they should be because if god kills them off because we don’t believe in them there not that very fucking important in the first place. Jesus sorry for the language.
Nov 16, 2009 @ 16:24:09
this is a proven hoax guys not a gov cover up and ya there are probably still some unidentfied species but this was a prank by a master artist :/ sorry guys dont believe everything you read on the internet the “remains” are in a master art museum the guy loves to do april fool jokes sorry guys ya some of you will still deny the truth but open your eyes the wings are off <3 sorry
Nov 16, 2009 @ 20:39:49
NonBeliever: your comment will be given all the consideration which is its due, of that you may be assured.
Bella, how’s Edward? And again, AGAIN with the unsubstantiated claims. You say you have proof it’s fake. Okay, fine; prove it. Where’s this proof of which you speak? Who is this shadowy “Master Forger?”
We have, as you can see, zero tolerance for unsubstantiated, random claims by internet personalities.
Nov 18, 2009 @ 18:44:43
this is bs not real one u can get gloves anywhere an a police evident bag you would be surprised how easy it is to get one of those this is photo shopped
Nov 18, 2009 @ 19:11:47
Well, make up your mind: is it faked, or photoshopped. Also, just exactly where do YOU get your Police “evidents” bags?
Nov 21, 2009 @ 00:02:20
thats amazing
Nov 22, 2009 @ 07:55:43
What ‘ s amazing, Ashley
Nov 28, 2009 @ 09:52:36
Gosh…Why do so many of you doubt that fairies are real?I, for one,believe.After seeing two pictures of faries my best friend took,seeing almost ten real pictures from books, three on the internet[including these]I TOTALLY BELIEVE!Who wouldn’t want to believe in these amazing creatures?They help the envirment,and bring joy to us.My best friend,Evie[the one who took the pictures]has seen them and has had actual REAL conversations with them!She once wrote a letter to her tooth fairy and she got a letter back!It was written in the tinyest cursive!And for those of you who don’t know,everybody’s got their own tooth fairy.Evie’s is Marigold.
Nov 29, 2009 @ 23:05:38
Do you suppose you can get us a scan of that letter, Giana?
Nov 30, 2009 @ 18:23:09
Uhm…ok whole the HELL-o is Quentin Crisp??? CRUNCHATIZE ME CAPPN
Nov 30, 2009 @ 21:22:25
Come on, you KNOW how this works. Look it up!
Dec 03, 2009 @ 19:13:28
Sorry,I think Evie lost it.But I do know that if you buy the book Farypolis,Return to Fairypolis,or The Secret World of Faries,you can see all kinds of stuff.They have pictures
diary entries,letters,pages from stories,it’s like their big scraptbook just waiting to be opened to reveal the truth to our curiousity.Sometimes I think Evie might be lying,but I believe in faries,and I know Evie would never lie to me.
Dec 03, 2009 @ 19:18:04
Raincoaster,I’ve got a question that I just can’t answer myself,even with the research I’ve done:Are faries related to angels?
Dec 05, 2009 @ 13:30:04
Fairies and angels are both supernatural beings, which means they were both created before the world existed and are independent, not related to one another.
Dec 07, 2009 @ 09:37:23
I started with the news from Yahoo! about some rich guys including Steve Jobs with big paychecks and ended up with this magical post. Laughing aggressively out loud.
Well, anyways, about my opinion about the magical world… Haven’t you ride a donkey before? It holds the key to all your questions.
Extra: I think Cthulhu is related with Steve Jobs and Steve Jobs is related with fairies.
Dec 07, 2009 @ 11:53:20
um… looks bigger than “2 inch remains”
Dec 07, 2009 @ 16:10:14
Size isn’t everything!
Dec 12, 2009 @ 18:20:53
yeah. no. unless those hands are superass tiny, like 2 inches tiny, that fairy is fake. it was funny though.
Dec 14, 2009 @ 13:50:35
Proof, Johnelle? Where is your proof?
Dec 16, 2009 @ 00:13:34
“…unless those hands are superass tiny.”
There’s a bizarre description. Huge weakness. Jumbo shrimp. A small catastrophe. A little atrocity. A quiet cacophony. Artificial global warming. A huge dessicated fairy. And the beat goes on, according to the late Sonny Bono.
Dec 21, 2009 @ 19:38:19
I believe in fairies, in magic, and that there are things in this world that exist without our noticing. My name isn’t really Rima Mashiro, she’s a character from the anime Shugo Chara.
Truth to suffice, it could be a fake, or it could be real, but if you truly believed, that would be insignificant information. Little kids have the best faith, in my opinion, because they aren’t ruined with responsiblity, and what is ‘scientifically possible’. It’s like they believe in the tooth fairy/mouse, santa, the easter bunny and in anything else they choose to.
Dragons actually did exist, and if dragons exist, maybe a whole communtity of other creatures exist. Maybe you have to truly believe to see them, and be pure of heart.
I’ve seen a fairy portal before, they’re quite common to see at sunset, along with lights going in and out. I also have the ability to talk to guardian angels, and predict small things in the future (useful with coin flips).
Why can I see and communicate with fairies? Because I’m gifted and I believe. I can see auras, and see into the future. It is also common to find fairies trapped in sea shells, and if you release them, they will bestow good luck on you.
I don’t abuse the fairies, but I find it amusing how they can tell me things, that you otherwise wouldn’t know, if you weren’t a fairy.
Dec 30, 2009 @ 00:25:47
HOLY FREAKING CRAP PEOPLE!!! Did ALMOST everyone just TOTALLY ignore the whole “POSTED ON APRIL FUCKING FIRST”?? (April FOOLS day if it still hasn’t quite registered with ya) Plus the FIRST clue should have been “THIS IS TOTALLY LEGIT” NEVER trust ANYTHING that starts off that way.
BRAVO TO THE CREATOR! There was ALOT of effort put into this scheme! I admit I was being sucked in as read the article, started running theories as to why I hadn’t heard about it sooner. BUT I READ THE WHOLE ARTICLE!
They may not be real, but I still like to leave thimbles of honey and milk on my doorstep, just like I leave out a plate of milk and cookies at Christmas. What do you think superstitions are? EVERYBODY believes in at least one: salt over the shoulder, broken mirrors, umbrellas opened indoors, black cats, sidewalk cracks, walking under ladders, etc etc etc. Why the hell to we live life if we don’t believe in a little magick every once and a while! It will make you smile which will put ten years on your life!
Some need to smarten up, others need to pull that giant stick out of there asses!! CLAP YOUR HANDS!
Dec 30, 2009 @ 05:40:44
Indeed. I hope you saw the part of this thread where the commenters were trading dirty jokes in Latin. This comments thread has been called one of the most beautiful things on the entire internet, but you have to read it like a book, not just skip to the end.
Dec 30, 2009 @ 07:22:27
i wesh to see it wen its not did
Dec 30, 2009 @ 08:06:30
Yes I did! I must say that I found myself thinking the same thing! I sat here and nearly peed myself I was laughing so hard!! You got a good one going here raincoaster! Keep it up! This is the only thread I have ever even bothered to read fully or comment on! Thoroughly entertaining!!
Dec 30, 2009 @ 19:45:23
jojo, you shoulda been here two years ago, obviously. Poor thing.
DaNu, welcome to participatory performance art.
Jan 04, 2010 @ 15:36:59
If it is a hoax it looks really good, something to make you smile and bring back some faith in fantasy and dreams :)
But…
…. did they have to call scientists “Godless Heathens” as if they have no moral codes? A true scientist would never cover this up if it was real, true Scientists would embrace it and be very excited about this (again, if it is/was real).
Jan 05, 2010 @ 00:37:39
Well, that’s exactly what we’re doing!
Jan 05, 2010 @ 04:45:14
Ah yes, I remember back two years ago, when the fairy was still fresh and hadn’t yet shrivelled up and dried out.
Clearly Raincoaster wasn’t keeping it in her apartment.
Jan 05, 2010 @ 05:06:08
No, it’d need a zodiac to stay dry in there.
Jan 15, 2010 @ 00:36:27
as in???
Jan 15, 2010 @ 01:09:23
Well, have you SEEN my apartment?
Jan 16, 2010 @ 15:28:46
Nice to see the debate still raging. I overheard a woman on her bluetooth yesterday. She was arguing with someone, and I think she said that all fairies are named “Marsha.” I suspect that she fell for the old urban legend, but snopes has nothing on it yet.
Jan 19, 2010 @ 14:54:31
i do think it’s reall add me on myspace i have a reall fairy i found in the woods at fox island
Jan 20, 2010 @ 03:52:32
Ugh… that is the most horrible thing i have ever seen, i acctually believe in fairies and that supposed “fairy’s” wings are made of dead leaves…… Everyone knows fairies are 5 inches long. Its a mean thing to do. :(
Jan 20, 2010 @ 04:59:26
Most of the fairies I know are named “Fifi” or at least they are on Fridays and Saturdays after 6pm.
And who ever claimed that fairies are five inches long? For one thing, you’re a horrible sizeist. And for another, it’s NOT the size, it’s how you use it.
Jan 21, 2010 @ 20:21:16
Fifi would be the français version. Sascha is the Русский equivalent. I’m gonna sidestep the length x circumference argument; I’ll leave it to you experts.
Jan 23, 2010 @ 16:17:01
Yeah its been confirmed that it was an april fools joke. Someone made it and planted it to be found on april first. The guy came forward and admitted it was a hoax, even saying how he made it. Not saying there aren’t things out there that havent been discovered, but the particular “creature” in the picture is a fake.
Feb 01, 2010 @ 20:55:57
I love fairies i see them all the time!!!
and i love what they do to their hair.
lol :P
Feb 10, 2010 @ 01:44:48
is this Fairies is truelly reall ….
how did they found !! …
and why they Already … Dead !!
is there the rest of them are life already … and hidding …
Feb 10, 2010 @ 09:10:29
I’d be hiding too! Around these parts, we have our suspicions, though not enough proof to charge anyone. Let’s just say a certain Eastern European mammal knows more than he’s saying about this mysterious death.
http://www.facebook.com/Comparethemeerkat
Feb 10, 2010 @ 10:37:18
My name is Flower.
For years I was teased becuase of the fairy believing thing. I decided to stop blieving until one night I heard something in my bathroom. I’m not the brave type so i made my brother go in and look. When he came out he was really scared adn threatended to go get my Dad, but when I asked him what had happened te only words he said to me, were:
“It glows. It really, REALLY glows.” I put on my big girl pants ;) and went into the bathroom. Nothing happened but all I saw was a fat firefly in my Chia (cha cha cha chia)I thought is was just a joke so my bro took a jar and decided to keep the bug. But when he stuck his finger for the bug to crawl onto it, the bug began to uncurl from this ball shape, and than a small- Polly Pocket like figure jumped back and got up in the Chia.
By this time we were both screaming and my parents were coming into the bathroom.
Well, just like those cheesy Peter Pan movies, parents cant see fairies, and even though I practically touched the tiny person with wings, my parents didn’t see her.
The tiny person would keep coming to my room and she liked to eat the insides of jelly beans (from my candy stash) I didn’t touch, i would only watch her flutter and dance around my room. The closet i came to knowing some information was when she played with my tinkerbell pen and began writing something on a post it.
The tiny person was a girl an her her name was like Maidor or something. She knew how to talk becuase when she went inside my kitty’s play pen, she would sing tinkle little star to my cat. My cat is reeally mean and Maidor somehow controled him.
I still see Maidor sometimes. I see her mostly on Tuesday nights, sicne I am homeschooled. she enjoys candy and likes growing things. Somehow she became my best friend.. raincoaster is right. And i dont know if thats a real fairy, but Maidor does…
Feb 10, 2010 @ 10:59:50
Mit Apologien an Herr Hughes Mearns :
“Yesterday upon the stair
I met a man who wasn’t there
He wasn’t there again today
Oh, how I wish he’d go away”
Your Grace
The Regen-Küstner=Abwehr are troubled by so multitudinous & divers qvestions :
eg can a Sqvare ever be circular
eg are Gorillas really a more intelligent species evolved from Homo pSeudo Sapiens
eg Why did the British invade Iraq in 1915 (where Grandfather Eagle contrived to catch Malaria) and then again in 2003, with their US Friends
UND
eg Why is the wretched Government of her Britannic Majesty [God Bless her] claiming that the UK has ended its Recession
AND like the erudite RIAM, it is also wondered pourquoi et how do Fairies die, while struggling to escape to Vancouver away from the excessive UK Tax-Regime in Derbyshire, formerly recognized (by Miss Jane Austen in 1813) as “the Best of Countries”
Surely it cannot be from being gunned down by polite but heavily-armed Racccoons, while flying over Orange Groves in California
Surely not from drinking anti-freeze so thoughtfully put out be Monsieur Ortem for any thirsty & exhausted Fairies who make it over the Canadian Rockies
Alles Gute
G E
Feb 14, 2010 @ 19:06:00
0.0 what the hell? FREAKS >.< GET A LIFE!!
Feb 14, 2010 @ 21:21:05
@ANONYMOUS– Are you on a stair?
Feb 16, 2010 @ 17:37:34
a bit of paper mashay then ur sorted lol
Feb 23, 2010 @ 00:06:59
wow that is bull crap as much as i would like to believe that fairies and many other mythical creatures are real, because i think that would be absolutely awesome, this is in no way real. first of all there is no way that this so called fairies delicate wings could be preserved in such a climate. The body alone would be impressive there is no way they would last. then if by some miracle the wings were in some way preserved the way whoever it is that is handling the body would have broken the wings the way they are carrying it. Third how did the police get a hold of this, it should be in the hands of someone who knows how to preserve and care for such remains, instead of some idiot bobby who only knows how to eat donuts, drink coffee, and through his weight around. I would say this is the result of a photo shop expert.
Feb 23, 2010 @ 00:34:42
@Loki– You are mistaken. THIS is bullcrap. Note that bullcrap has no wings, and there’s a big difference between bullcrap and fairies.
Feb 23, 2010 @ 12:44:14
uumn you say how can i prove this wrong? well i cant prve it 100% wrong (other than the fact that i believe it has been discouverd to be a prank already) but i can find many holes and lacking evidence e.g how could the fairy have been found so easily in the first place specially if it had been mumified, if it was preservd in some way theres no way it was just laying on the sidewalk the whole time, the man found it walking his dog, i wonder how many other people walk their dog in the same place. second you say bones are similar to birds i wonder how many bones are the same shape and how much of it could have been made out of other material, what type of wings are those? how could they ahve been preserved so well? the mummy looks about as old as real mummies so it must have been spreserved very well, why in that position a difficult position to make air tight and perserve particulary when it cmes to those wings. yeah my heads over folowing with more things wrong withthis article i cant organaise it enough to write anymore down but yeeah yeeeeeeeah
Feb 23, 2010 @ 13:09:16
Well, if birds are shaped like that it’s big news anyway. As to how it got there, I offer no hypothesis except the (frankly speculative) possibility that it was disinterred by hostile Meerkat grave-robbers who were interrupted in their dastardly work by the dog-walker before they could make off with their grisly prize.
Feb 26, 2010 @ 14:01:42
I think that’s a fake pikture hahahaha!!! sorry but i just don’t believe that’s real… but when i personally think you’re all on shrooms to be seeing faries .. especially you Flower! you have one quit big imagination… but that’s ok kuz i saw faries when i was on shrooms too xD
Feb 26, 2010 @ 14:06:18
I personally think all you people are on shrooms if you say you’ve seen fairies hahaha!!!
I think they’re real though! i love mythical kreatures! i wish i was one too!!!
but i think Flower is on something wayyyy different to be seeing a fairy kome into her room every tuesday!! ha sorry Flower!!
But i’ve seen plenty of fairies when took shrooms the first time xD
Feb 26, 2010 @ 14:08:54
I wish i had a doll like that though ;D
I’d post that shit up on my wall an fool everyone i know hahahahahahahahahahahahahaha pinchi amber!!!
Mar 04, 2010 @ 22:29:55
Wow. This is really quit insane. Highly entertaining but truely insane. Fascinating. I cant believe i sat and read the entire thing! Well done!
Mar 06, 2010 @ 02:06:49
Her Grace “…. hostile Meerkat grave-robbers …. ”
The erudite Pixieheart may pretend to a Perseverance and Perspicaciousness beyond her Youthful Years
BUT Are Unicorns and their Tree Oktopodia friends innocent in all this !?!!
BUT what was the involvement of those sagacious RaCoons ???
Mar 07, 2010 @ 20:14:12
Im curious as to hold you think i am G Eagle Esq? im thinking maybe not quite as young as what you might beleive. :) dont let the silly name fool you.
I believe that unicorns are not quit as innocent as they would have you believe
Mar 07, 2010 @ 22:13:56
Herr Eagle persists in his belief that schools used to teach proper punctuation and grammar, hence his assumption that you must be of a more youthful cast.
As for the involvement of Tree Octopi, I cannot say except to remind everyone that a species pushed to the brink of extinction will do anything it can to survive!
Mar 08, 2010 @ 20:09:25
Ahh well in that case he needs to consider the growing laziness of anyone (no matter their age) when typing. I actually rarely ever type out all of my words because it is just easier and I do not like to send an overly long time typing whatever it is im trying to say. I am admittedly a lazy typist. i do see the pion, however, and understand.
Mar 10, 2010 @ 17:19:27
that is so photo doctored
Mar 20, 2010 @ 02:16:26
it so unusually!!! means on Earth fairies lived once!
miracle!
Mar 25, 2010 @ 18:20:12
those are actually pretty cool. i like them. I don’t know why, but they look cool.
Mar 30, 2010 @ 13:14:10
Raincoaster! why do you believe this?
is there any proof other than that pikture an that police evidence bag in the back?
kuz honestly in my opinion, I personally don’t think that is real.
I believe in things like this but i think people are tryin to mess with us an pretty much kallin fairy believers IDIOTS!!!!
don’t you think?
Apr 07, 2010 @ 14:21:33
yay i have my doubts buti hope its real!!!!
Apr 15, 2010 @ 17:48:30
not rather think it is REAL it is like a animal
Apr 15, 2010 @ 17:49:47
not rather lie it is FAKE
Apr 16, 2010 @ 14:53:46
Your Grace
Ich weiss nicnt was soll es bedeuten,
das ich so traurig bin
Ein Märchen aus urAlten Zeiten,
das gent mir nicht aus dem Sinn
Not only does the Learned Idaly seem to make no Sense
This is very trubblink
…. rather like our Glorious Leader, Monsignor von Braun, explaining to the Long-Suffering Bristisch Electorate -
HOW having got us into such a Mess, we should trust him to get us out of it
Apr 18, 2010 @ 08:54:12
all the people who dont believe are,to put it in juvenile terms,demented. The evedience is overwhelming. every civillisation has its own description of a fairy.
Apr 18, 2010 @ 22:53:09
Indeed; and you can even buy the body on eBay if you’re still skeptical, and do your own autopsy. What could be more eloquent of confidence than that?
Herr Eagle…does Brown have an alibi for this murder?
Apr 24, 2010 @ 09:02:39
I totally believe in fairies, although I know this one is fake. I’ve seen some incredible pictures, and read plenty of stories from my friends claiming they’ve seen one. Raincoaster, please send me all evidence/pictures you have of fairies. That would be greatly appreciated. Flower, Christian, it would be great if you could somehow email me some pictures of Maidor, or that fairy you found at Fox Island.
Anyone else, please send me some info! I love showing my friends this stuff!
Kbocker1@gmail.com
Apr 24, 2010 @ 10:58:50
You can no longer buy the body. It was bought for (250?) dollars.
Apr 25, 2010 @ 00:52:38
More evidence came to my attention recently. AxeCop knows about fairies and enlisted one for his team. She’s completely awesome.
axecop.com/index.php/acask/read/ask_axe_cop_14
Apr 25, 2010 @ 02:10:52
Oh, it’s about time they got their own comics (other than Elfquest). Ask any of my friends: you just do not mess with a fairy!
Apr 26, 2010 @ 13:08:22
Of kourse you kant mess with fairies! they might put some evil spell on you xD
Apr 27, 2010 @ 15:08:54
That’s right!
Apr 28, 2010 @ 11:41:35
Hello everybody,
I have been trying to read this entire posssssst for the passssssst week in-between essssssay writing etc. I almost died from laughter in the processsssss. In fact I am sure that one of my lungsssss sssssssprung a leak from it (you ssssssee I have been hearing a sssssstrange hisssssssing noissssssse whenever I move: the hole in my lung, I’m asssssuming) Well, this is the first comment that I have ever mede on anything… ever. Weird. Never the lesssssss though I must inquire assss to the whereabouts of archie, kssstaff, and philipa. Why have they dessssserted usssss?
Apr 28, 2010 @ 14:33:57
Now say that with a lisp.
Apr 28, 2010 @ 14:41:45
1812
Your Grace
Once again, I find myself driven by sheer power of rational argumentation to be speculating in similarity to that sagacious Racoom
BUT as the Erudite Turnip most Demented enquires :
Wo ist der AerChie und die kindliche Philippa ???
Apr 28, 2010 @ 15:00:00
Ah, my dearessssst Eaglelikeobject
In ansssssswer:
Ich glaube, dasssss ssssie auf dem Blog über Quentin Crisssssp ging!
perhapsssss we sssshould join them?
yourssss mossst ssssssincssssèrement la Turnip
Apr 28, 2010 @ 15:11:20
Dear st. turtsS knuB,
how do you know that that wasssn’t ssaid with a lissp and I jussst cannot sspell?
jussst a guessss perhapsss….
:)
ssmiley facsse ri i ight there^
frowzily face right here>:(
ssorry
Apr 28, 2010 @ 15:13:43
By the by it isss not my fault, the hissssing, you know, it’sss the hole in my lungsss….
Perhapsss I’m inadvertently dictating for my lungssss?
Apr 28, 2010 @ 18:54:26
I’m not sure you’re not transforming into a boa constrictor. You should get that looked at right away. Boa skins are worth a lot of money, you know.
Apr 28, 2010 @ 19:08:54
@pinrurT de’mrofeD–
“how do you know that that wasssn’t ssaid with a lissp and I jussst cannot sspell?”
I thuthpected thomething and thimpley guethed.
@Herr Eagle– An Overture is called for.
@rain– Ask any drummer.
Apr 28, 2010 @ 23:09:27
sorry raincoaster – just checking comment upload time. Please feel free to delete this.
Apr 28, 2010 @ 23:11:41
No worries; I was just thinking about you with this thread: have you noticed, it seems to load a LOT faster.
Apr 29, 2010 @ 09:51:34
Dear liquid-precipitationcoassster, Perhapssss you have a point but where would you sssssuggessst that I would go to, asssss you ssssay, get it looked at? Unlesssss of courssssse you are a ssssspecialissst on this sssort of anomaly, in that casssse we could do it right now…
st. turtsS knuB, yesssss just assss I thought. Do you own a cat? If not, would you like one?
Apr 29, 2010 @ 18:18:26
If I were you I’d avoid Milan, but otherwise you should be safe. Perhaps the Amazon?
Apr 30, 2010 @ 10:49:25
Ahhh, I ssssee, do they have ssswpecialissstsss on thisss sssort of thing there? Perhapsss it some sssort of microbe that doessss it… Oh, dang be back later!
Apr 30, 2010 @ 15:18:49
Anyway, before I wasss ssso rudely interupted!
Why ssshould I not go to Milan?
What horrid dissseaessse do you think that I might have!?
How did you get your little photo iconsss?
yourssss ˈtər-nəp’
May 01, 2010 @ 04:15:11
DT: Milan is the global headquarters for the manufacture of snakeskin pants. If you are morphing into a boa constrictor, it is the LAST place you should consider going.
One has to be practical about these things.
May 01, 2010 @ 14:05:34
Oh dear, I sssee. Why are you on the internet at four in the morning?
May 02, 2010 @ 18:21:38
Because that’s when I’m awake, sssssilly.
May 03, 2010 @ 05:32:05
good god, what are you doing awake at that time?
May 03, 2010 @ 06:43:57
Blogging, OBVIOUSLY!
May 03, 2010 @ 10:00:02
Hmm, yeah, fair enough.
May 03, 2010 @ 10:02:22
Where do you live that it’sss 10:00 right now?
May 06, 2010 @ 10:03:17
Ha! Lol, this made me crack up at the unreality of “red hair” found. Hair would fall out, you dummy
May 06, 2010 @ 10:27:24
Well, if it’s dead it ain’t moving around, so where do you think the hair would end up? Eh?
May 07, 2010 @ 09:32:31
Raincoasssster, why are you ignoring me? Alsso why are there ssssuch long periodssss of time where there issss no one to talk to on here?
Hannah dear, hair doesss not fall out when you die. Mange isss not a ssssymptom of death. Have you never ssseen a real mummy.
My mummy hasss lotsss of hair.
May 14, 2010 @ 11:54:49
your mummy?
wha kind of mummy? ^-^
May 14, 2010 @ 11:56:41
an hair does stay on you! they’re dead cells… they kant dissolve or anything like that silly goose xD
May 14, 2010 @ 16:25:52
“an hair does stay on you! they’re dead cells…”
Unless they’re wild hairs. They can actually get UP IN YOU and make you do all sorts of uncharacteristically impulsive things, and all it takes is one. Be careful with them.
May 20, 2010 @ 12:31:50
oh my jesus!! really?
wow! never knew that!
…wha kind of uncharacteristic impulsive things would it make you do?
please explain??..
and wha sor of wild hair?
May 20, 2010 @ 15:34:33
You really didn’t know that? Huh, interessssting, what do they teach in sssschools thessse dayss? Here isss an example of a wild hair and itsss effectssss http://www.proxima13.com/avakassss/pic5.jpg. Note how pssssychotic it looksss. (There isss only one “Sss” in the above web sssite by the way, sssorry!)
Wow, it ssseemsss like I haven’t been here in decadesss.
Where do you people live?
May 21, 2010 @ 01:12:10
1839
Impulsive behaviour (err .. behaviOr, in the Middle-Colonies Argôt)
…. aMbEr would sympathize with the Camelopards on Senor Bunk’s entertaining Space – they seem rather upset about something
Surely it cannot be the sight of Mr Cameron evicting that pleasant Mr Brown from his Home …..
May 21, 2010 @ 10:05:22
this is sooo cool where did you find it because in belfast ulster museme there is a mummified person real it is all wrinkly and black
May 21, 2010 @ 19:48:48
Miz AmBer– To clarify by example, I just got one that compelled me to post a comment here. I suggest googling “1839 camelopard” just to be safe. Herr Eagle is to be complimented for his rare knowledge of [fill in the blank.]
May 21, 2010 @ 22:33:36
I have no idea what you people are talking about. Everyone knows mummies are terribly hirsute.
May 22, 2010 @ 05:01:33
cool sooo superly cool
May 24, 2010 @ 12:02:30
i totally agree wih raincoaster!!!
i don’t know wha you people are talking bout now haha!!!
i’m from tx deform’ed turnip
wha bout you?
May 24, 2010 @ 12:11:20
thank you bunk strutts…i’ll be sure to check it out
May 26, 2010 @ 10:35:00
i am beliver real fairies but i am know why god have created with fairies and why i beliver god did created about fairies tales people real world like humanlity,.yeah but i have psyhics vision but i beliver fairies and eleves people have a hide the world but people cant saw at fairies people ,.please leave fairies people alone but do not get hurt body with fairies tales.if god will mad at people but thou shalt not killed fairies people but god have love fairies tales people in the world ..god say people need leave fairies tales people alone. please ….please i saw god finished
May 26, 2010 @ 14:10:20
co.
May 27, 2010 @ 18:12:07
So much photoshop, it’s not even funny… ok it’s so funny!!!
May 28, 2010 @ 03:51:14
Oh, AGAIN with the “Photoshop” cries. Easy to say, not so easy to prove, eh? Or you losers would stick around and offer some concrete proof, which I note you have not.
May 28, 2010 @ 11:58:02
ok i don’t know wha the hell rebecca just said xD
an that fairy is not photoshopped!
i think it’s fake …but don’t get me wrong i still think fairies are real ^-^
Jun 01, 2010 @ 10:26:31
it’s a fucking fetus!!
Jun 02, 2010 @ 12:40:11
??? fetus?
Jun 12, 2010 @ 20:08:59
Do you know, I think that J.R.R. Tolkien is under appreciated. Does anybody know someone who speaks fluent Elvish… I’d like to learn. I mean I of course can write it but I can speak it.
I think someone is a fetus and nobody has hijacked my lettuce.
Jun 12, 2010 @ 20:13:42
I meant “can’t” speak it, of course, my mistake.
Jun 12, 2010 @ 20:35:12
@Deform’ed Turnip
Who is J.R.R. Tolkien? Is he in Parliament? Did you vote for him?
Jun 15, 2010 @ 09:42:15
that’s definitely not photo-shopped… @}`~,~
Jun 20, 2010 @ 16:16:00
Bunk, no he isn’t and yes I did, you shame me.
Jun 21, 2010 @ 10:50:42
Well I AM a Dick Licker but also as a Botonist I also recognize those are just last year’s leaves on the back.
Good job on making her look like an alien.
Jun 21, 2010 @ 19:59:27
@Deform’ed Turnip– So this Tolkien guy was an important British Earl or Baron or something? Honest question.
@yah right– Hahaha! Another joker in our midst who declares fraud yet correctly identifies the sex of the fairy. Pure awesome, and more proof. Great sleuthing.
Jun 23, 2010 @ 14:05:08
Ah hem, not at all, he was creator of the great LotR.
Jun 23, 2010 @ 18:28:06
Bunk went to American schools, it’s not his fault he doesn’t know book writers.
Jun 23, 2010 @ 18:47:48
@ Deform’ed Turnip — OH! I got it. Is LotR like WoW? I don’t bother with online role-playing games, but knew a kid who played D&D a lot. He was fascinated with sorcerers, fairies, druids, trolls, etc. I guess that’s where the fairy connection comes in.
@raincoaster– Huh? You’re sniping at me? I thought that was Metro’s job. After all, he’s the one who caused the leak in your gin bottle, not me.
Jun 23, 2010 @ 19:27:39
I’m not sniping at you, I’m just taking a broad stab at Yankistan, because when have I ever resisted the urge to do that?
Besides, I don’t think Metro can handle his gin. He must have passed out.
Jun 23, 2010 @ 20:42:01
There’s a reason why 90% of the Canucks live within 100 miles of the U.S. border: pizza delivery and Molson’s Golden exports. Fact.
Jun 23, 2010 @ 23:42:49
Ha! Is that so? Great, I’ll have a large capicollo, feta, olive and mushroom pizza with double mozzarella. How fast can you get it here?
Jun 24, 2010 @ 11:17:54
Once I scan it in you’ll have it in seconds. Do you want Meerkat dipping sticks with that?
Jun 24, 2010 @ 15:16:19
Absolutely! I LIKE the idea that someone is killing those damn rats.
Jul 02, 2010 @ 08:19:39
I love fairies! btw…you guys talk alot. :P
Jul 03, 2010 @ 01:36:49
…. and some of us occasionally have a space between separate words
Jul 04, 2010 @ 08:31:28
Thanks for that Rain, however I’m not sure his country of schooling is the problem: I went to American schools too… Where do you live? Please tell me. Please. By the way, you don’t happen to speak Elvish do you?
What do you dip the Meerkats in?
Have a pleasant day
Jul 04, 2010 @ 17:19:59
No, I don’t speak Elvish. Well, only “menu Elvish” enough to get me through lunch at a pretentious restaurant.
My name is “raincoaster.” Where do you THINK I live?
I dip the meerkats in vats of Goo! Didn’t you see Roger Rabbit?
Jul 04, 2010 @ 19:13:27
Rain– Gotta check with Herr Eagle on this one, but Goo was someone very important in ancient hibernia, as the surnames McGoo and MacGoo are very common. That esteemed ancient was very possibly renowned for his excellent meerkat-dipping vats.
Jul 04, 2010 @ 19:23:25
Ah, I see. I always thought that Goo might be some Jewish approximation for “God” the way they use G-d. Which, when they do that, makes me think that all the old dead people who wrote those Victorian novels that say things like “G-d d–n his eyes!” were all Jewish. Gee, they really DID control the media back then, didn’t they?
Jul 04, 2010 @ 19:27:29
The ancient tribes of Britain were jewish? Oy.
Jul 04, 2010 @ 20:35:35
Funny. They don’t look it.
Jul 04, 2010 @ 20:53:18
Goo is also a Chinese surname, but they would have likely avoided the place back then, even if they had known about it.
Jul 04, 2010 @ 21:17:53
Maybe. But what if they didn’t KNOW they were Chinese?
Jul 04, 2010 @ 21:29:13
Did you happen to notice? My birthday’s coming up and this thread needs only 122 more comments to hit an even 2,000. I’m just sayin’!
Jul 04, 2010 @ 21:30:42
I can’t believe how many comments you have on this post. Who knew mummified fairy remains would generate this buzz.
Jul 04, 2010 @ 21:45:33
Oh, the meerkats knew. But they cannot stop us: free the fairies!
Jul 04, 2010 @ 21:56:09
Be careful with that thing! It’s a freeze dried fairy. Add EVO, a bit of rosemary, parsley, thyme, and sage (in that order, the song is wrong) a splash of Balsamic vinegar and a nice Viognier and you have reconstituted fairy. They are mean when brought back.
Jul 04, 2010 @ 22:10:16
Maybe the Chinese in question were from Norwegia? They’ve got a nice cruise line, but they’ve got funny names, too, like Úlfr, Auðr and Guðmundr.
Jul 04, 2010 @ 22:26:16
Those wings don’t look like leaves at all. No sir, not one bit!
Happy fourth! (It’s the July 5th now where I live, but still the 4th out west I believe …)
Jul 04, 2010 @ 22:28:15
Jenny, do you have to reconstitute it in a pentagram, or will a quadrigram do?
Happy 4th/5th/whatever, Mr Hippity.
Bunk, do you mean Icelanders? They have enough on their hands dealing with the resurgent Godzilla, I don’t think they’re behind this.
Jul 04, 2010 @ 22:31:49
Here’s a haiku I just wrote …
Two thousand comments:
Raincoaster’s birthday present.
We can do it, folks!
Jul 04, 2010 @ 22:34:16
There are Icelanders named Goo? Dang.
Jul 04, 2010 @ 22:34:58
You’ll notice that I used punctuation in my haiku. That’s because I strongly believe that haikus should be properly punctuated. In fact, I’ve written more than a few letters to the editor on the topic over the years …
Jul 04, 2010 @ 22:54:19
some punctuation
in haikus to editors
gets their attention
Jul 04, 2010 @ 23:50:48
Hey, Raincoaster, been a while, how ya doing?
Jul 05, 2010 @ 00:02:50
Doing better and better all the time. If I can’t get cash or presents for my birthday, famousnosity is the next best thing!
Goodang is a well-known Icelandic surname, Bunk. I’m surprised you did not know this.
Mr Hippity, I do not involve myself in haiku wars. They can turn ugly in an instant, and those people will never stop until they’ve parsed every syllable of your blog. Fisk has nothing on them, especially the Scandinavian haiku snobs. I am not joking, for once.
Jul 05, 2010 @ 04:44:53
It still doesn’t look like Quentin Crisp . . .
Jul 05, 2010 @ 11:44:44
This is the most bizarre thing I have ever witnessed on the internet.
Jul 05, 2010 @ 14:38:24
images of dead fairies, yeah know you have my attention
Jul 05, 2010 @ 15:14:52
Bizarre and gay: the only way it could be more “raincoaster” was if it also had tentacles.
Jul 05, 2010 @ 18:37:07
I thought all night Rain and I still don’t know… show me where because I want one, do they have them there? They don’t have them here. Please Rain. Please. Then, maybe I could send you a real Birthday present… Please.
Jul 05, 2010 @ 18:39:17
I’m sorry if I am being hysterical, but I spent all night in the rain.
Jul 06, 2010 @ 00:19:49
Haha I’m not sure if I should get a sense of sarcasm here or not, but definitely interesting nonetheless, good pictures too, gotta say
Jul 06, 2010 @ 00:58:05
1898
Yes, qvite so
Those living to the South of Nootka Sound in the World’s 4th-largest Economy have their own infelicitous animadversion in respect of those poor Millipede=munching Meerkats
BUT
In Polite Society, a GentleEagle does not openly admit to agreeing with your earliest Kommenter’s Observation :
“The Ha! you say. Well, this is certainly unusual to say the least. I think you might be on to something here. So, I say Ha!”
Rather one echoes Virgil’s observation most erudite :
Arma virumque cano
Je reste le vestre Grace’s obedient servant etc
L’Aigle Gris
Jul 06, 2010 @ 01:49:28
Turnip, what are you doing in the rain? Don’t you know you’ll turn into soup if you do that?
Loki, welcome. Sarcasm? HERE? NEVAH! And no hyperbole either, never, ever in a million years.
G Eagle you can quite CLEARLY see that the arms on that fairy are natural and dessicated in a quite authentic fashion, for a mummified fairy. Was that some sort of doubter’s crack?
Jul 06, 2010 @ 01:54:32
I agree!
Jul 06, 2010 @ 02:45:58
Absolutely! There is no room for doubt in the face of such a preponderance of scientific proof!
Jul 06, 2010 @ 05:30:47
It would appear that fairie passed away while doing the hokey-cokey or some Neverland-inspired version of the Lindy hop.
Jul 06, 2010 @ 06:15:19
It could well be so. They are known to be quite strenuous, and just look at her: she’s no spring chicken!
Jul 06, 2010 @ 07:47:12
I thought the post with 2000 comments might be some slander about Michael Jackson….is that fairy moonwalking BTW?
Jul 06, 2010 @ 07:54:11
One comment closer to 2000 and Happy Birthday Lorraine
Jul 06, 2010 @ 14:48:28
I am sorry Rain but I was looking for your house, no luck of course, however- wait… what! Why did you not tell before! I could’ve used some nice hot soup. Fluch meiner unvorbereitetness.
Please Rain.
Jul 06, 2010 @ 15:22:31
Maybe we are all the mutant offspring of an alien fairy race.
Jul 06, 2010 @ 17:26:30
1907! The comment counter has reached the early 20th century!
Jul 06, 2010 @ 17:28:41
1908! The first Model T has now rolled off the assembly line!
Jul 06, 2010 @ 17:31:09
1910!
The titanic disaster is just two years away. World War I will start in 4 years.
Raincoaster’s 2000th comment is 90 years away. That seems like a long time …
Jul 06, 2010 @ 17:33:32
Wordpress just told me: “You are posting comments too quickly! Slow down!”
Wordpress is such a nag.
Nag, nag, nag!
I’m headed back to Tumblr ….
Jul 06, 2010 @ 18:00:58
Noooooo, don’t goooooooooo!!!
Wordpress IS a nag, but at least you can comment on it, unlike Tumblr.
And yes, we are all descendants of a mutant fairy race. There are occasional throwbacks like Katy Perry and Liberace, but for the most part we’ve moved very far away from our roots.
Jul 06, 2010 @ 18:58:46
Given that on December 8, 2008 you said “What say we go for two k by the end of 2009?”… it appears we’re falling behind on our duties.
Consider this a birthday nudge towards your goal. We can make it!
Jul 06, 2010 @ 20:12:42
I can comment on Tumblr: It sucks. And I’m not even interested in a discussion of Fairy tubers.
Jul 06, 2010 @ 21:34:19
VANCOUVER
Rain when is your birthday exactly, I will make sure your get your 2000.
Jul 06, 2010 @ 21:35:47
looks like 1 2 many r’s…
Jul 06, 2010 @ 21:38:36
Well, bye, 111 minutes past the witching hour so I’m off. Bye.
Jul 06, 2010 @ 21:40:52
Finally got this page to load, but what an ordeal.
Tinkerbell is alive and well and living in a hollow Ohia tree here on the Big Island of Hawaii.
Jul 06, 2010 @ 22:19:01
But, is she/he an earth fairy — or a galactic fairy? Because, truly, you can’t make any assumptions about the true dimensional origins of anybody/one/thing. Trust me; I have relevant knowledge and experience in matters such as this. All the fairies love RAIN!
Jul 06, 2010 @ 22:23:33
Jon: yes, the world owes me. Haven’t I ever mentioned this before?
DT: Well, I do have blogging to do and alas cannot be here 24/7. My birthday is Saturday, so you’ve got till midnight then to push it past 2k.
Richard: your perseverance is appreciated. I believe there is a fairy in your tree. And a gremlin in my WordPress!
Jul 06, 2010 @ 22:26:44
Bunk: you must be magical yourself if you can comment on a Tumblr; you surely can’t comment on mine!
Rachel, we do not know, but suspect it is an Earth fairy as it was found near some old mounds in Devonshire, and that would seem to indicate some connection with the Land Underground. Any light you could throw on the matter would be appreciated.
Yes, fairies love rain. Lots of my best friends are fairies, actually.
Jul 06, 2010 @ 22:28:55
Totally didn’t read any of this but hope you hit 2,000 comments ;)
Jul 06, 2010 @ 22:48:13
The post date is a dead giveaway, but I am still drawn to that dried up little sprite, April Fool or not:-)
Jul 06, 2010 @ 23:16:09
Kerry, how could you? This thread has been studied as part of the curriculum at two universities and has been called one of the most beautiful things on the internet! Don’t miss the part where the commenters make dirty puns in Latin!
Cathy, thanks!
Jul 07, 2010 @ 06:02:40
Amaaaaazing! I always knew they were real! If you can find the movie “Photographing Fairies” I highly recommend it (Ben Kingsley stars).
Jul 07, 2010 @ 06:26:54
Oh, I adore Ben Kingsley. So much so that I sat through Prince of Persia twice. What abs…oh, that WASN’t Ben Kingsley’s character?
Jul 07, 2010 @ 06:40:51
Whew, almost there! (hope you get what you want for your birthday….;-)
Jul 07, 2010 @ 06:56:05
Thanks! We WILL get there, if I have to register an army of sock puppets!
Jul 07, 2010 @ 07:21:05
I’m telling you every time a bell rings a fairy gets its wings, but every time it hears an obnoxious ring-tone it gets a rare fairy tumor and dies mid-flutter.
Perhaps they can extract some of her genetic material and finally get to a cure or at the very least a vaccine for the pan-demic that is Avian Bone Syndrome; then her death won’t have been in vein.
Jul 07, 2010 @ 11:10:50
Fairies are absolutely real. I even caught a ride on a fairy last month.
Oh, wait. That was a ferry.
Does that count?
Jul 07, 2010 @ 11:47:25
This Saturday, the 10th?
Jul 07, 2010 @ 12:11:24
At the rate Harvey Fierstein is going, we may have an American variant of the fossil in a few years or so . . . .
Jul 07, 2010 @ 12:29:17
I, for one, eagerly await the rise of Raincoaster’s Army of Sockpuppets. (Which, by the way, would make a great movie title.)
Jul 07, 2010 @ 13:44:31
Quelle tragedie que this Extinct Faerie hath not lived long enough to witness that Life is not all tragedy
There are compensations
Middle Colonies 1 Ghana 2
and
Spain 1 Germania 0
Jul 07, 2010 @ 15:15:11
Indeed.
Jul 07, 2010 @ 15:17:46
Eagle Sir, would you join my quest to post obsessively till Rain’s Birthday?
Jul 07, 2010 @ 19:31:50
Won’t be making to your potluck dinner… so here’s your birthday gift! I hope it does make it to 2,000 comments.
Wishing you lots of success, health and love in this new year of life!
Jul 07, 2010 @ 20:19:47
1938. http://en.wikipedia.org/wiki/1938
Fairies found murdered in the red barn near meerkat infestation.
Jul 07, 2010 @ 20:24:46
BTW, anyone can comment on Tumblr, just not ON Tumblr. 1939.
Jul 07, 2010 @ 20:38:51
wow! Those are pretty cool! Reminds of me of the pressed fairy book.
Jul 07, 2010 @ 20:40:09
Well my four and six-year-old would believe it in a heartbeat. But then they believe in fairies already. In honour of your bday…
Jul 07, 2010 @ 20:43:51
I blame global warming.
Jul 07, 2010 @ 20:46:54
LW, so the meerkats engineered a virus that is killing the fairies? THOSE FIENDISH CREATURES! We must spread the word that fairies should practice safe sects!
Alejna, it all counts.
DT, this Saturday, the 10th.
G Eagle, but do fairies play football? Do they even watch? It seems way too macho for them. I would expect fairies to play leapfrog, or chess perhaps.
Bunk, your erudition is, as always, astonishing. Also, thanks for the link on your other site!
FFE, speaking of Broadway, have you met LW?
Guacira, thanks! Now, to create those sock puppets.
Jul 07, 2010 @ 22:37:38
Thanks Jessica, Annemarie, and Renee! Much appreciated.
Jul 08, 2010 @ 01:20:10
I frikkin’ knew it! Actually, I didn’t, but I’m supporting the 2000 drive anyway. Nice one…
Jul 08, 2010 @ 01:51:09
So many questions:
Did she leave a will?
Jul 08, 2010 @ 01:59:34
Where did she leave all the teeth?
Jul 08, 2010 @ 01:59:43
1942 Renee “I blame global warming”l
1947 Waily, waily
As Eeyore so sagely wailed, I don’t care whom you blame [for the ongoing success of the Great Meerkat Conspiracy], as long as you don’t blame me
Jul 08, 2010 @ 02:00:49
Who will take over her route?
Jul 08, 2010 @ 02:06:02
How did she get money out of the ATM with those tiny little hands?
And then how did she change the twenties for singles? Because all I ever got was a dollar? :p
Unless….unless she was moonlighting as a stripper?
Jul 08, 2010 @ 02:15:42
I must admit I haven’t read all 2000 comments yet, so if I’m asking questions that have already been posited, I’m a stooge.
But Hairy Mo and Surly wants to know.
Jul 08, 2010 @ 02:22:07
I blame the Meekrats!
Why must they scurry around timidly in the dark wreaking havoc on the Cheetos?
Jul 08, 2010 @ 10:26:11
ONLY 48 COMMENTS NEEDED NOW! 47 after this goes up!
Thanks, guys, I really appreciate it.
LW, I don’t think she could have been a stripper; take a gander at her. She just doesn’t have the body for it, besides being way too old. And no way would her tits have been big enough. I also don’t think fairies use ATMs; don’t they always pay with fairy gold, that vanishes the next morning? (I knew those Comparative Folklore Studies would come in handy)
G Eagle I consider the Meerkat guilt for global warming to be firmly established. We can only await their extortion demands and stock up on snorkels and wetsuits.
Jul 08, 2010 @ 10:31:28
Wouldn’t you like to know where her will is… well tough, I promised her not to tell you.
Jul 08, 2010 @ 11:23:40
Oh come ON! I know she left me the teapot with Peter Rabbit on it; she told me so!
Jul 08, 2010 @ 11:52:53
Just googled “fairy recipes.” Amazing how many people consider them food. I guess I shouldn’t be surprised, as some folks eat unicorn meat, too.
Jul 08, 2010 @ 12:47:31
Yeah, well, I got the Peter Rabbit teacup. So, ha. And the Peter Rabbit tea too. Ha, ha.
Jul 08, 2010 @ 13:49:36
I’m boycotting unicorn meat; it’s not dolphin safe!
Peter Rabbit tea…which reminds me of a joke. A very long, painful joke.
So this guy, he’s a gourmand. LOVES food. LIVES for food. Thinks Gordon Ramsay doesn’t take food seriously enough, okay? So, basically, guy is food crazy.
Dude comes into a pile of money; seems his whole family is food crazy, and they’re dropping left and right from celiac disease and cardiac infarctions, leaving him all their money. He decides to take a year off and go around the world, seeking out the rarest, most wonderful dining experiences there are.
It goes wonderfully. He’s just finishing up his tour in Malaysia when he bumps into an old friend, and he catches the friend up on what he’s doing.
“That’s awesome!” says the friend. “If you’re hitting all the greatest places in the foodie world, you must have been to Mercy!”
“Mercy?” says the guy, puzzled. “Never heard of it; what’s the story?”
“Oh my god, you’ve never heard of MERCY??? It’s only the greatest gourmet secret on the planet. I honestly shouldn’t have told you but I thought you’d already know. It’s this little town in the Outback in Australia. Look, as you’re such a gourmet, I’ll draw you a map, but if you are captured, you MUST eat it. Don’t worry, the paper is artisanal.”
“Okay, okay,” says Our Boy, intrigued beyond all describing. “I’ll do anything it takes! My trip will not be complete, no my LIFE will not be complete without a trip to Mercy.”
“The town is entirely populated with the greatest chefs in the world who have retired. It’s nothing but restaurants. Brutally expensive, but you look like you can afford it. Here,” says the friend, hastily stuffing a hand-drawn map into his pal’s pocket. “I can’t be seen talking to you after this.”
Well, long story short, our boy diverts to Australia immediately. After six long days at sea in one of those ferries that are always sinking on the news (you’d think they’d know better than to go on the news, it’ll never hold them!) he arrives on the coast, and immediately hires a jeep to take him into the Outback, following the directions on the map. After seven days of driving, they’ve run out of road, and he hires a camel. After three days of camel-jockeying, at dawn he spies a protrusion on the horizon: no, several. It’s Mercy!!!
He spurs the camel into a bone-jolting gallop, arriving just before the dinner hour. He chooses the most imposing-looking restaurant and saunters in, the dust of the trail clinging to his chaps. He’s greeted by the standard-issue stuffy maitre d, and escorted to his table.
Immediately, he is served a refreshing sorbet flavoured with sustainably-harvested dragonfly wings, followed by a flute of Veuve Cliquot 1820. The rest of the meal is to the same standard, course after course of the most impossibly exquisite delicacies the universe has ever seen. Finally, it’s time for the piece de resistance, the grand finale, the specialty of the house. As with each course, it’s a surprise to our protagonist, right up to the moment it arrives at the table.
Or, in this case, the moment after.
The maitre d wheels a trolley to the table. On its surface is an enormous bowl of boiling water, with a burner beneath to keep it burning. Below that are an assortment of strange, non-euclidean vegetables, and something large and lumpy underneath a napkin. The waiter tosses the veggies into the air and the maitre d expertly slices them as they come down, dropping them gently into the pot. Then he grasps the object under the napkin and flourishes it: A large, dead koala bear.
This he proceeds to chop up into bite-sized pieces, every last hair and claw, tossing it into the bowl and stirring it. After a few moments, he ladles out a large, steaming mug of the broth and hands it to Our Guy.
Who looks down into it and sees one of the koala eyes staring back at him, still in its bit of bone socket. He looks up at the maitre d and asks plaintively, “Can you please strain this or something?”
Oh. My. FUCKING. GOD!!! The maitre d draws himself up to his full height and puts a double load of contemptuous French accent on, before replying, “SIR! The koala tea of Mercy is not strained!”
I forget why I was telling you that.
Jul 08, 2010 @ 13:56:15
So that’s what happened to the tooth fairy. My parents weren’t cheap and weren’t lying to me after-all.
Jul 08, 2010 @ 14:04:20
I bet fairies taste like caramelized kittens.
Jul 08, 2010 @ 14:10:56
“2-inch remains”, huh? That’s one tiny scientist, then.
(I also like how they gave it an X-Files alien head)
Jul 08, 2010 @ 14:55:34
They are breeding the scientists very small these days, to save on housing and feeding them.
Jul 08, 2010 @ 15:18:47
…they don’t have to make the leashes as big either.
Finally, were out of streamlined suburbia.
Jul 09, 2010 @ 00:07:07
Your Grace
It is a Truth universally acknowledged that
Canuckistania in tres partes divisa est
1. where Faeries flourish
2. where Tree Oktopodia flourish – but Faeries seem absent
3. an intermediate zone where neither are observed – it’s called Alberta
Es macht man denken, nee
Das ist es, doch
[it maikes yer fink, ugh
This is it, i'n'it]
Jul 09, 2010 @ 00:15:49
*GROWN*
My reaction to the PUNch-line of your fantastically told folk tale, and in honor of our Homonymph. Perhaps we should call her Portia? Would it have helped the allusion if you said the chef cut up the Koala and tossed the “pound of flesh” into the pot? All in all, it was quite enjoyable even if I did noticeably age and audibly moan. It is definitely a joke that lends itself to the written word, though I would never be able to re-tell it as well as you did. Well done. Like our Portia.
Jul 09, 2010 @ 00:24:54
You may be on to something, could it be she is one of Shakespeare’s Fairies from “A Mid-Summer Night’s Dream?” Titania, perhaps? Could this be the queen? Or maybe it’s Peachblossom or Mustardseed? Who the Puck knows? Are we supposed to imagine old William just made these characters up out of thin air?
Jul 09, 2010 @ 00:26:07
And to say she couldn’t have been a stripper, Rain, is really looksist of you. You’ve obviously not spent much time in the fairy porn section of the Pleasure Chest.
Jul 09, 2010 @ 06:53:09
I am appalled by the non-believers in this thread. Of course fairies are real. I should know. I AM the Tooth Fairy, just ask my kids if you need proof. I even have a little muslin bag of baby teeth.
Jul 09, 2010 @ 07:19:04
Hey, SBC, I remember you. I saw you fly in through my window and take make tooth. Of course, it took you quite a while because I refused to open my mouth…
Jul 09, 2010 @ 07:59:06
I’m just so grateful fairies bury their dead in barrows instead of cremating, evidence, I think, that they want to be discovered.
Jul 09, 2010 @ 08:32:40
True, however, you’d think that there would be easier ways of alerting the mortals to one’s existence.
Jul 09, 2010 @ 09:14:28
Ah yes, Turnip, you were the fiesty little fart who bit me, I almost lost a leg that night. I had to pinch your nose and you turned such a lovely shade of blue before finally opening your mouth.
Jul 09, 2010 @ 10:34:58
Rain, what time tomorrow?
Jul 09, 2010 @ 10:37:00
SBC, do you still have a scar from that?
Jul 09, 2010 @ 16:08:06
That is really cool! That is really, really cool!
I’m very pleased to have read this, as one who often wishes the mythological world of creatures did exist. If fairies is all there are in our world, that’s enough, but maybe they’ll make more discoveries in the future! Dinosaurs existed, didn’t they?
I bet the people in the middle ages and before are definitely not as crazy and delusional as some people think them today. Again, cool article! Good luck on 200 comments. :’D
Jul 09, 2010 @ 20:17:04
If only we could harness that power…
Jul 09, 2010 @ 21:36:53
Rain, what time?!
Jul 09, 2010 @ 21:51:52
Come on people, I don’t want to have to do this alone by posting my darkest secrets! I don’t think I even have 22 dark secrets. Then I’ll have to start posting yours. Where will you be then? Wouldn’t it be easier just to help me out here? Honestly, you don’t want everyone to know about that time… with the meerkats, do you? It’s 10:56 pm. on Friday the tenth of July, what could you possibly be doing other then sitting here helping me out with this? I mean really! God, you’d think you people have lives apart from this. How sad that would be. Perhaps I really am alone. I will do what I can rain, but hey, considering my background, I don’t know how much that is. Night. It has come for m
Jul 09, 2010 @ 22:21:26
Is that really fairy remains, or the result of GMO orchids?
Jul 09, 2010 @ 22:22:26
Fairy, fairy quite contrary. This post makes me want to reread the Artemis Fowl stories. Hmmm…
Jul 09, 2010 @ 22:23:30
Funny, I would have thought fairies would burn their dead on a funeral pyre.
Jul 09, 2010 @ 22:28:42
G Eagle; there are a lot of fairies around here. When I canvassed for the census I even found someone who’d put a “fairy maze” made of moss in her front garden. She said the fairies felt comfortable dancing in it because you couldn’t see it from the street (which you could not, it being up several flights of stairs on a very hilly street).
LW, I think you’re on to something. Surely a figure as renowned as Shakespeare would not have just “made shit up.” It’s well-known that Hamlet was based on a true case (even if there ARE no cliffs in Denmark) as was Antony and Cleopatra. That he would simply fabricate fairies is a ridiculous and unsupportable notion. But this cannot be Titania: we would have seen the obit in the Guardian!
Portia is almost completely unknown to me, but I did like her hair at that Oscar party, with all the little braids and things.
SBS, thank you. That should settle the last of the unbelievers.
Jul 09, 2010 @ 22:34:22
DT excellent, thank you for the corroboration. But if you’d rather keep your baby teeth than get money, one has to wonder about your motivation!
Lewnna, thanks and welcome. There are plenty of other fairy stories and tall tales around this blog.
Alejna, are you saying there are enough unbelievers that we could make a living at it somehow?
Looks like the meerkats got DT after all, right in the middle of a word. God rest his soul.
Angela, I hated Artemis Fowl. Great premise, badly executed. Of COURSE they made millions from it.
Jon, thanks for the comment. It’s vikings that burn their dead on funeral pyres, and as we all know Vikings were very hard on the original Britons, like fairies.
Jul 10, 2010 @ 00:04:33
Portia is the one who first said, “The quality of mercy is never strained.” I had heard she said it to a merchant named Shylock in Venice, but it could have been to a talk-show host named Ellen in Malibu, you know how these things get distorted with each subsequent telling…
Jul 10, 2010 @ 00:07:22
Happy birthday to you,
Happy birthday to you,
Happy birthday, dear Rain,
Happy birthday to you.
Sung to the tune of “Happy Birthday to You,” by LW and Portia the dancing Fairy.
(How many is this?)
Jul 10, 2010 @ 00:57:29
14 more to go!
Thanks for the translation. Merchant of Venice I have neither seen nor read, for some reason. I’m all about the King Lear; it reminds me of the Orestia and of growing up with my parents.
But there, I’ve said too much.
Jul 10, 2010 @ 01:09:16
You’ve co-ordinated this perfectly! Happy Birthday
Jul 10, 2010 @ 01:15:11
“Co-ordinated?” or “instigated?”
Only a year behind schedule, we WILL hit 2k, and perhaps yet another university will put this thread on its New Media curriculum.
Jul 10, 2010 @ 02:45:41
I notice there is still some activity on this thread. Is it true that the fairy will be revived with a secret recipe based on gin? On her birthday?
Jul 10, 2010 @ 03:11:20
Only one way to tell: SEND GIN!
Jul 10, 2010 @ 03:12:06
I notice there are commenters who don’t believe in fairies. Yet they believe in me and I don’t even exist!
Jul 10, 2010 @ 03:16:14
To comment or not to comment, that is THE question.
*comments*
Happy birthday!!
Jul 10, 2010 @ 03:21:43
Ha. My dad was a bit of a King Lear, in fact, King is his middle name, literally, and his last name translates to King in another language, but there, I’ve said too much too. Which daughter were you? The Rain is making more and more sense.
“Rumble thy bellyful! Spit, fire! spout, rain!
Nor rain, wind, thunder, fire, are my daughters:
I tax not you, you elements, with unkindness.”
Jul 10, 2010 @ 03:22:55
Happy birthday!
Jul 10, 2010 @ 03:23:37
Reminds me when I was a kid and used to roll rubber glue until it got all dirty, dark and tacky then shaped around the head of my gnome head with the bright orange hair. It was the top of my pencil. I know, what an abstract memory!
Jul 10, 2010 @ 03:24:16
Well darn, my fairy cake photo didn’t appear in that last comment…
http://azahar.files.wordpress.com/2010/07/fairycake.jpg
Jul 10, 2010 @ 03:24:40
I know a bank where the wild thyme blows,
Where oxlips and the nodding violet grows,
Quite over-canopied with luscious woodbine,
With sweet musk-roses and with eglantine:
There sleeps Titania sometime of the night,
Lull’d in these flowers with dances and delight;
And there the snake throws her enamell’d skin,
Weed wide enough to wrap a fairy in
Jul 10, 2010 @ 03:29:51
And so the end is here
It’s time to face the final Eagle
Jul 10, 2010 @ 03:33:31
God: welcome, nice to see you in the hood.
Cat: thank you! A Shakespearean reference as well, bonus points!
LW, what was your dad’s name, Raj Khan? That is one kickass name. A friend of mine, of German-Canadian extraction chose a hippie name of Shahee because it meant Prince in Urdu. Didn’t realize it meant Martyr in Arabic until the US deported him! Did you know they make you pay for your own ticket?
L Billings as a fairy abuser, you obviously have a large karmic debt, which can be repaid by helping this post get to 2000 comments.
Az, thank you! That’s probably as close to a birthday cake as I’m going to get this year. Have been on a restrictive diet, and most of my friends are more savory cooks than sweet cooks.
Archie, Thanks. Gosh that’s terrific. You’re really talented; have you thought of writing plays or something?
Jul 10, 2010 @ 03:35:41
Oh archie-dude, “Weed wide enough to wrap a fairy in”.
Such divine imagery.
Chill out – bud soaked gin – what a birthday.
Jul 10, 2010 @ 03:51:13
2001? Always a day late and a dollar short, but happy birthday nonetheless!
Jul 10, 2010 @ 03:57:01
Thanks, God and FFE. Probably the only time you’ll see those two conjoined.
Yay! I can now enjoy my birthday knowing it’s started off on the right foot for sure!
Peter gave me airline bottles of JD, Johnny Walker Red, Bombay Sapphire, and Bacardi, plus a Strongbow. And since I’ve been off booze for more than 2 weeks now, and I am having a beverage-primary potluck later today, Sunday I can already see is going to be a writeoff. Yay for medically-induced days off!
Jul 10, 2010 @ 03:57:22
M.O.V. is very good, if not the tiniest bit racist.
I misspoke before in that the Merchant is actually Antonio and Shylock is the Jewish loanshark who lends Antonio money but demands a pound of flesh if he defaults. Which he does.
Portia, the princess, dresses up as a man/lawyer to save the day when her love Antonio cannot re-pay and Shylock wants his flesh, she points out that the “quality of mercy is not strained,” and that by saying nothing about Blood in his contract, he can’t take the flesh unless he can do it without spilling a drop of blood, which of course he can’t. And then she forces him to convert to Christianity.
So it would’ve been a bit “Victor/Victoria”-ish with a boy playing a girl playing a boy back in the day, it’s all very scandalous on a lot of levels, as only Bill can be.
So there is my tale for your birthday, there is a good film version with Al Pacino & Jeremy Irons if you ever get the time away from your keyboard. There’s a lot more to it, so I haven’t ruined the whole thing.
Somehow, Fairy crossed to Mercy.
Jul 10, 2010 @ 03:57:26
Indeed I have considered writing a play.
The plot is based on the memories of a ghost in a Scandinavian castle who dresses up in tree branches and whispers lies into the ears of the king about the behaviour of his beloved wife. Three witches tell the king his fortune but he doesn’t realise that they are his daughters.
It will be a winner!
Jul 10, 2010 @ 04:13:36
Just because I’m an agnostic doesn’t mean I preclude the existence of a central force or entity. Have a gimlet for me.
Jul 10, 2010 @ 04:20:40
2006
Happy Birthday
It is most gratifying that even that non-existent God can be numbered amongst your Grace’s Commenters
Jul 10, 2010 @ 04:20:47
Yat, yoo mde itrain, hapybirthdas/y o yu congsra
Jul 10, 2010 @ 04:33:42
sorya buot my mesedup comnent sbut m’i stil in pan frm my afor menteiond atak so it hrd tp typ.
b haPy bitdy rai n i’l sing yo a sng n a secnod
Jul 10, 2010 @ 04:35:31
This thread has become a living monument to the internet existence of it’s myriad participants.
Belated happy birthday to Rain
(waves to “God” – hello God!)
Jul 10, 2010 @ 04:56:22
Most terribly sorry about that, looks like those posts came out worse than I thought. Meerkats did not treat me nicely this second time. Anyhow: [sing to tune of happy birthday]
Hippo, birdie two ewes,
hippo, birdie two ewes,
hippo, birdie dear raincoaster,
HIPPPO BIRDIE TWO EEEEEEEEWWWWWWWEEEEEEEESSSS!
*insert me clapping and screaming in your direction, here*
Jul 10, 2010 @ 04:58:40
Hey you all know that theory of apocalypse that supposed to happen in 2012, well next comment is 2012 so beware before you post it…
Jul 10, 2010 @ 05:04:45
Crossing the Mercy is always to be recommended, if only as an excuse to listen to a great song.
Sounds like neither Shylock nor Portia knew about liposuction, though. Ah, schools back then were not what they are now.
Archie, can you work a talking donkey or vampire into it? They are all the rage.
FFE, I will have to wait till the grocery stores reopen, but shall obtain many limes the instant they do.
G Eagle, never underestimate my reach!
DT, whatever you’re drinking, I hope someone brings it to my birthday potluck!
KStaff, great to see you again. I had some JD and thought of the Derby two years ago…one day we have to go to Hastings Park. Sadly, they have no wifi!
Jul 10, 2010 @ 09:16:02
So, we’re friends because you have the same sense of humour as my husband? I’m sure he’s told me that Quality of Mercy joke. He’s got others, you should compare notes!
(I think I’m #2013!)
Jul 10, 2010 @ 09:49:46
Hmmm, Perhaps.
Jul 10, 2010 @ 10:07:10
wow – looks convincing but I am no believer…
Jul 10, 2010 @ 17:44:58
Lori, of COURSE he’s told you that joke; he stole it from me! And the Roy Rogers/Dale Evans joke? Also mine. I once got $20 NOT to tell that joke. It’s even longer than the Mercy one.
DT you haven’t met Mr. Lori.
Leeann, stick around. We shall convert you yet!
Jul 10, 2010 @ 17:47:50
I haven’t, I’m sure it would be my pleasure.
Jul 10, 2010 @ 18:15:45
I’ve changed my mind.
Over 2000 commenters have to be in collusion, and I’m not one to follow the slavering hordes, regardless of how popular their ideas might be.
The meerkats had it right after all — fry up the little petulant dusty bastards and eat ‘em with Dijon and scallops, especially on one’s Birthday, and you too may enjoy farting pixie dust for days to come. =)
Jul 10, 2010 @ 20:11:25
Can somebody please tell me what my problem is?
Jul 10, 2010 @ 22:52:37
DT
Just think
If there is an Answer,
there must be a Qvestion
Jul 10, 2010 @ 23:02:16
@Deform’ed Turnip: Yes.
Jul 11, 2010 @ 04:40:22
I do believe in fairies. I do! I do!
I do believe in fairies. I do! I do! I do!
However, I don’t believe in dead fairies as when fairies die they just fade away to nothing. Everyone knows that.
Jul 11, 2010 @ 05:48:35
i beleve in fairys no matter what anyone says i will beleve in fairys for the rest of my life.
and i beleve that, that pic is real.
Jul 11, 2010 @ 06:32:34
2024
I flatter myself that I agree with Bambi on so many things
….. apart of course of whether that Kindly Christian the Ruddmonster should have been consigned to political oblivion and the Governorship of Western AustrAAAlia by a member of the Monstrous Regiment of Women
rhaps we could compromise by appointing him to the late John Buchan’s old Job
BUT Senor Bunk seems to be maintaining a Racoon-Like Sagacity by giving us only part of the answer to that perceptive Vegetable’s Qvestion
Jul 11, 2010 @ 13:21:05
The Roy and Dale joke about the puma? I thought you stole that from me. Doesnn’t matter, though. I stole it from someone else . . . . .
Jul 11, 2010 @ 21:34:40
Bunk: aha, a traitor in our midst! I knew they’d get you: first the Republicans, then the meerkats. Richard Nixon and Dubya were well-known meerkat fanciers.
DT: No.
somethingsthat, that is a completely unsubstantiated claim, and we will have none of those around these parts. We are entirely scientific!
Bambi: wow, I didn’t know deer could type!
G Eagle is it really possible to “banish” someone to obscurity who’s already in…you know…Australia?
FFE: I think we stole it from the same guy.
Jul 11, 2010 @ 21:51:52
Yeah, me!
What a shame, I was hoping… oh well.
Jul 12, 2010 @ 01:28:17
2028
Ja, ja, bestimmt
The way of the Plant (or Republican) is commonly not felicitous with all these Herbivores (& Democrats) about
BUT
Do not despise the Snake
Who knows
…….
She may grow into a Dragon
Das ist es, doch
Jul 12, 2010 @ 20:35:48
FFE– Don’t ever joke about pumas. They’ll kill your career, or worse. Roy and Dale are no longer with us, precisely because they joked about pumas.
Jul 12, 2010 @ 20:38:16
rain– Au contraire. I re-perused the entire thread and realized the true nature of those little cutesy sparkly cretins. Take the tooth fairy, for example. She rewards tots with money for losing teeth. The loss of teeth is then equated with wealth. Stay with me here.
When I was a young whelp, the Tooth Fairy gave me a dime, or sometimes a quarter for each tooth, and back then, a quarter could buy a lot. Now comes inflation, and I imagine the TF is paying around ten to fifty clams in 2010 dollars for each tooth lost. Little kids are learning that they’ve got a mouthful of unearned wealth, and all they have to do is mine the gold.
That’s right. Little kids have figured out that they can cash in their teeth to purchase that Blackberry or X-Box that Daddy won’t, and they can do it with a screwdriver and a ballpeen hammer knowing that Daddy WILL pay for remedial dental work. Ever see a little boy or girl with a chipped tooth? Guess who’s behind it.
Fairies are pure evil.
Jul 12, 2010 @ 22:55:03
TEETH are evil. Ask any old wise man; he probably got rid of his long, long ago.
Jul 13, 2010 @ 18:02:10
Hear, hear, one of mine is getting ready to fall out right now.
Jul 13, 2010 @ 18:02:45
Good riddance.
Jul 13, 2010 @ 20:55:33
How much did you make????
Jul 14, 2010 @ 13:51:42
Well, it hasn’t fallen out yet.
Jul 15, 2010 @ 08:05:31
Hmm… Looks like a foetus, wrapped in leaves to me.
Derbyshire, by the way, despite being my favourite county by a country mile, isn’t lacking when it comes to new-age fruitcakes. Hence the “fairy” I suspect.
Ron,
England.
Jul 15, 2010 @ 20:30:56
New age? Doesn’t she look ancient to you, Ron?
Jul 16, 2010 @ 10:38:28
Ron, don’t make jabs at a woman’s age, every man should this.
You know, I envy your life, Rain.
Jul 16, 2010 @ 21:55:58
DT, are you sure? Rabid Michael Jackson fans and mummified fairies: it’s not all plugins and SEO you know!
Jul 17, 2010 @ 10:42:57
Oh come on Rain, that’s the best part, especially diced, dry-roasted, infused with gin, and served on your best china with mint sprigs. Hervorragende!
So, yes, Rain, of course I’m sure.
Jul 18, 2010 @ 06:01:18
is that the mummified fairies, or the Michael Jackson fans? Who would be, I guess, sort of mummified fairy fans if you think about it…
Jul 18, 2010 @ 08:33:02
or would it be rabid Michael Jackson fairies?
Jul 18, 2010 @ 12:59:23
He didn’t seem to attract many fairies. He preferred to capture young human children and convert them.
Jul 18, 2010 @ 14:24:08
You know, it would be quite easy to do the moon-walk if you could fly.
Jul 18, 2010 @ 14:28:55
Maybe that was why there was such an increase during his lifetime…
Jul 18, 2010 @ 21:14:30
*Turning up VOL. on Wanna Be Starting Something*
La la la, I’m not hearing you, (but song seems fitting).
Cordially,
Michael Jackson MUSIC fan.
I know that’s about as popular as saying you’re a Roman Polanski fan, but hey, love the art, hate the artist. And so it goes. I think Rodin was kind of a pig too. Bacon (Francis, not Kevin) married a 14 yr-old girl and cheated on her with young boys, but somehow in the 16th century that was okay. He’s grateful he pre-dated TMZ.
Jul 19, 2010 @ 12:48:38
I would have to agree with Timethief in that this is one of the most bizarre things I have ever seen on the internet… photo-shopped exotic scenes notwithstanding. lol
With Love and Gratitude,
The Intentional Sage
Jul 22, 2010 @ 10:11:30
Well, finally the evil thing has fallen out.
Jul 22, 2010 @ 13:56:43
Fallen out of where? What has?
What I want to know is, what happened to my comment? I put one there day before yesterday and it’s gone!
Jul 23, 2010 @ 17:08:04
My mouth. My tooth. I’ve no idea, but it probably would’ve given me something better to do.
Jul 23, 2010 @ 19:35:35
If you can’t find it, you can’t get any money for it, even if the tooth fairy IS alive.
Jul 27, 2010 @ 09:55:06
Who said I couldn’t find it?
Jul 28, 2010 @ 13:55:38
I’
Jul 29, 2010 @ 10:55:30
m
Aug 02, 2010 @ 13:12:16
so
Aug 02, 2010 @ 14:46:56
LOL so fucking stupid. i mean you look at the pic and instantly think its real just cause there is a prop bag that is labeled police evidence. (which in fact is not a real evidence bag either.i would know;) and O…M…G like totally guess what!? Anyone can by latex gloves. if you notice in top image. the left hand lower arm bones are incorrect. if it were true then teh fairy would have been like popeye with HUGE fore arms. wing span can not support the mass weight of the body and if this was legit and this thing has been dead for long enough for it to be like this and mummified then the bottom right wing would be able to be bent and reflecting light as it is. DEF a good prop! movie set worthy. though dont be stupid.
Aug 02, 2010 @ 20:26:31
@will–
Okay. Let’s parse this a bit. Only two words in and you drop an immature and unnecessary f-bomb, and it’s not even used in a complete sentences.
You’ve penalized your argument by arbitrarily ignoring capitalization, while at the same time you demonstrate that your caps key has not been removed and swallowed by snakes.
Grammar, I’ll give you the benefit of the doubt as you are obviously typing under serious duress.
You’ve blindly stumbled into several years of careful debate and research, yet you claim to have it all figured out without reading any of the scientific analysis provided by Ms. Raincoaster and others here for your free education on the topic. I suggest you take advantage of the offer of knowledge, and I’ll even spot you three points for reading the following:
1. Popeye was not a fairy.
2. Bumblebees do not have the wing area to support their mass either.
3. Anyone unable to comprehend the simple rules of the employment of apostrophes in sentient writing has no point of view worth serious consideration and their argument is null and void upon posting.
Now please explain how you got your blog commenting license. It’s intuitively obvious to the casual observer that you didn’t pass the test.
Aug 02, 2010 @ 20:30:24
@will– Now tell me which letter doesn’t belong in the comment above, and I’ll give you extra credit for effort.
Aug 03, 2010 @ 02:04:40
Your Grace
2059
Will “…. Anyone can by latex gloves …..”
Yes … but not all of us can SchPell or Kapitalyse
HOWEVER
while I flatter myself that this Eagle agrees with that Sagacious Racoon [Monsieur Str] on so many things
… apart of course on whether California should be allowed to repudiate its Debts and then become a Canadian Dominion, as an alternative to sacking the whole of the State’s Fire-&-Rescue Service
What do Bumble Bees have to do with Deceased Fairies ???
AND surely the Conoscenti [pronunciated "Konn-o-Shenty] should be comparing the fate of this Poor Fairy with that of Mr Liberaci
The Ha! you say. Well, this is certainly unusual to say the least. I think you might be on to something here. So, I say Ha!
G E
Aug 03, 2010 @ 02:29:17
Bunk, as you can see DT has established something of a tradition of misplaced single letters. Not to worry; you are culturally congruent in the thread, as is our miscellaneous, ungrammatical hater who knows (from personal experience?) what a police evidence bag looks like.
GEagle, I believe the Conn O’Sennie are the Little People of Cork, but I could be mistaken. It might be Galway.
Aug 03, 2010 @ 04:40:02
Bunk: *Clap-Clap-Clap-Clap*
You left out one thing: In trying to kill our buzz, you, Will, have inadvertently served up a round of Jello-Shots to everyone. La Chaim! And whenever I personally entertain the notion that my mind is a stressful place to be, I will disabuse myself of the urge to reach for a Prozac and instead think of how much worse it could possibly be. Thank you for that.
Now, I’ve had a particularly horrid day, I got into a car accident with a “tourist” who SLAMMED on his brakes while cutting me off in the middle of a green light crossing Sunset blvd. I was totally set up, and it’s going to be my fault. So please, I’d love to hear your thoughts on the Easter Bunny, I really need a pick-me-up.
Aug 03, 2010 @ 19:33:10
lost weeknight– “Totally set up” happens frequently in So. Cal., but it doesn’t mean it’s your fault. Let the insurance companies argue that. As for the Easter Bunny, when he/she/it presents his/her/it to well-meaning parents, serves primarily to propagate head lice and tooth decay in small gullible children.
Oh, and Herr Eagle, the plutocrats of our once prosperous state know that scaring the C and D students with the fear of losing police and fire protection is one tactic to help them confiscate more hard-earned money from a financially strapped population. Progress from Progressives…
Aug 03, 2010 @ 19:40:20
PIMF… :(
Aug 03, 2010 @ 21:01:02
I was going to say,”I’m so very alone on this forsaken blog.” but I seem to to have wrongly estimated it’s forsakeness.
Nice to see you all…
Aug 03, 2010 @ 23:27:02
Bunk: Yes I’ve turned the matter over to my insurance company and tried to let the whole thing go, but I’m hemorrhaging money this month with my little sister getting married so it couldn’t have come at a worse time. Thank goodness no one was hurt, so maybe my guardian fairy was looking out for me after all. But if you’ve ever seen one of those exposes on rear-end set-ups, this was it, right down to the rented Hyundai.
As far as the Easter Bunny, don’t go all Glenn Close on me, who else is going to hide my eggs?
Aug 04, 2010 @ 14:21:56
You lay eggs? Holy shit, I bet people would pay a lot of money to see that! You might even get on Oprah!
Aug 04, 2010 @ 19:25:29
As for me, it’d take an awful lot of beer to get me on Oprah. I don’t care how wealthy she is. Just thinking about it gives me the willies…
Oh, wait, you’re talking about her show, right? Nevermind. Tell her to call me.
Aug 04, 2010 @ 20:24:35
Hey rain, I think you put ratings on your blogs.
Aug 05, 2010 @ 01:11:17
Bunk, what’s wrong? Don’t you like cougars?
DT I didn’t put them there, WordPress did.
Aug 10, 2010 @ 14:59:36
Oh no! Rain, someone came and destroyed your poor blog, it’s all ugly now. How sad, maybe you should give some strong gin to cheer it up. Maybe then it will be pretty again.
Aug 10, 2010 @ 17:08:24
Same thing happened to planetross’ blog. WorpDress strikes again.
Aug 10, 2010 @ 23:34:52
I kind of like this theme, but it’s only temporary, till the HTML errors get straightened out.
Where the HELL are my pingbacks? I had pingbacks from UNIVERSITIES on this thread!!!!
Aug 26, 2010 @ 18:30:58
Yes, muuuuch better, swirly deformed fish designs, much more fitting!