This is totally legit.
In news bound to rock doctrinaire Evolutionistas everywhere, another set of ancient fairy remains has been found. Assiduous readers of the ol’ raincoaster blog will recall our original reporting on the fossil fairy of Coney Island, which we broke to the larger world several months ago, much to the consternation of the scientific orthodoxy.
Now comes breaking news from Derbyshire, via Neatorama, that the mummified remains of several authentic flower fairies have been located in a barrow somewhere in the countryside. The exact site is being kept secret for obvious reasons; there is no knowing what shameful lengths the charlatans in lab coats might go to in order to erase this stunning blow to their orthodoxy.
The proof is undeniable:
The 2inch remains complete with wings; skin, teeth, and flowing red hair have been examined by anthropologists and forensic experts who can confirm that the body is genuine. X-rays of the “fairy” reveal an anatomically identical skeleton to that of a child. The bones, however, are hollow like those of a bird making them particularly light. The puzzling presence of a navel evne suggests that the beings reproduce the same as humans despite the absence of reproductive organs.
Well, I’d like to see what the “scientific community” can set against that kind of proof, eh? Try your darndest, you godless heathens! Just look at that photo; it’s even got a Police Evidence Bag and latex gloves! You can’t get much more official than that! Ha! I say again, HA!













The Ha! you say. Well, this is certainly unusual to say the least. I think you might be on to something here. So, I say Ha!
That bears no resemblance whatsoever to Quentin Crisp! Fraud!
Brilliant!
Did you see the big news on the BBC: “Photographs of a mummified fairy supposedly found in Derbyshire have been revealed as an April Fool’s prank.”
Oooh. Heavy hitting reporting there boys. Go get thee some high paying jobs at Yahoo.
Oh, just as I was getting excited :-/
The Beeb has lost all credibility, and this is just the final nail in the coffin. Naturally, the lapdog of the establishment would seek to discredit a find of such magnitude; it could shatter their carefully-constructed NeuLab world.
I hope that all readers will join me in a boycott of the BigBrotherCompany until such time as they admit their part in the cryptocracy which keeps much of the so-called “free world” in chains!
Clap your hands!
Oh yeah. I’m always hitting those things with my car out on the heath. They make a real mess of the windscreen.
See, finally a use for squeegee people. Who wants to deal with that mush themselves? Also: corroboration! Who would not take the word of someone named “analglyph”?
Hey. Ease up on the ‘anal’.
If I had a dime for every time I said that…
You’d have $17.05.
At the very least. And that’s just YOUR account.
I hate to be daft but…is this for real? Or humor?
Of course fairies are real! You wanna kill off Tink or something?
I do(nt) belive in faries!!
This is a lame prank. It looks real, but pranks like this are old!
I do(‘nt) belive in faries!
Pranks inolving faries are nnoying. And boring, if your gonna prank at all, make it new!!
Gee, Cthulhu isn’t nearly as great as I expected.
The acolytes are gonna be bummed!
that thing looks real.and freaky. but, i think that fairies should stay in our imagination.
But what happens to them when they die? This poor fairy was obviously unloved.
Clap your hands!
I DO believe in fairies!! I do believe in fairies! I do believe in fairies!!!
Yes – and I DO believe in Santa, the Tooth Fairy and her sidekick the Tooth Mouse, not to mention the Easter Bunny!!! (this is what happens when one has little kids in their lives!!!)
The Tooth Mouse? Do tell. I would hate to think I’ve left one out of the pantheon.
I believe in fairies, too, Tanz. In fact I’m getting my hair fixed by one tomorrow.
Yeah, what is a tooth mouse?
Which reminds me to get my hair cut. Can’t afford to get the teeth done yet, and my dentist is straight anyway. Come to think of it, he IS a bit mousy.
The Tooth Mouse! Heck yes, he deserves to be in the temple too Raincoaster!!! In fact, I think he’d prefer a tooth encrusted one!!!
Apparently, according to folklore and bits and pieces handed down the ages, the Tooth Fairy used to be a mouse!!!! The mouse turned into a fairy to help the good queen defeat the evil king by hiding under his pillow and knocking all his teeth out!
Yip – macarbre I know, but hey – isn’t that where all fairy tales find their origins?? Sugar coated horror stories from centuries gone by!!
So, you see Stiletto, queens and fairies abound!
Yeah, and don’t neglect the Organ Transplant Goblin, either.
Him, you really don’t want to piss off.
No, that’s why I make all those sacrifices of tourists!
Thanks for the tooth mouse backgrounder. How did I get through most of a degree in comparative literature and folk tales without knowing this?
Goblins and Fairies aside, new to all ‘dis’ blog-readin’ and have to say that I have found your blog a fascinating read Raincoaster!!! And yours too Metro. I admire the time it must take you to put it all together!!!!
BTW it really is quite interesting what one can find on Wikipedia these days!! No almost degree needed for that! :-)
Thanks. All compliments gratefully accepted; when Great Cthulhu rises and the Earth is cleared off, you will be eaten first, a high honour indeed!
OMG – but not before I go totally mad I take it!!!
Exactly! You learn fast, young Grasshopper.
Gwash!! Awww – thanks!! Grasshopper eh! That brings us to another tale!! You know, the one about the grasshopper that only wanted to play and live it up all summer long, scoffing at the hardworking little ants along the way – then come winter -he was stuck out in the cold and who took him in … none other than the very same hardworking lil’ bitty ants, that’s who!
And the moral of that story is ….
The moral of that story is: Learn your invertebrate biology. Grasshoppers only live one season.
I guess that’s my cue to bow out ‘gracefully’ – catcha on da waves ‘R’ !!
Nobody hangs around here long without getting a dose of da attitude. Tough it out and stick around.
What’s wrong with your teeth, Raincoaster? The tooth mouse take them all?
Apparently so. I shall go buy myself a new pair of fangs soon.
this is amazing!
Don’t miss the fossil fairy too!
Hair, teeth, if I were a hairdresser or dentist I’d offer my services for free.
Not sayin’ it’d be any good but I’d still try my best.
Hey, they’ve done wonders with Cher!
just imagine, all this time we thought fairies were just imaginary, and they turn out real, so that means sum1 would had to have seen one before and passed down the tale, meaning any imaginary creature could actually have lived! i cant quite picture a heap of giants roaming aroud though….
They’re very stealthy. Mostly nowadays they are in the US, playing professional basketball. It’s all true!
the “fairy” looks real but it still isnt enough for me to think they are real and that they do exist sorry
How can you say that? Every time you doubt, God kills a fairy! Why do you think he took Liberace away from us? EH?
well i need scientific proof that they do exist i’m so sorry
but that picture does look pretty real
Hey, they’ve got the police evidence bag and everything. Maybe it was a murder!
Also, don’t neglect the corroborating evidence:
http://raincoaster.com/2006/11/24/pic-o-the-day-fossilized-fairy/
i do beleive in fairy’s!!! and dont forget unicorns and murmaids and stuff, i beleive they just died cuz noone beleived in them… but i dont think the mummified fairy is real cuz if fairys were real there bodies wouldnt be left behind because that will kill the meaning of “beleiving in them” its cheating if you only beleive in things once youve seen them.
But, don’t you believe in James Brown? And his dead body was all over CNN!
Man, whoever did his mortuary work didn’t do that great of a job, I thought. But then, they didn’t have that much to work with I’m sure.
Just wait til Keith Richards meets his maker.
Are you kidding? Alcohol and heroin are preservatives! He’ll look exactly the same when they dig him up in a thousand years.
This is amazing!!!!! I am absolutly shocked I am so amazed that people found this increadable find!!
Wow
THIS IS SOOOOO WILD WITH A CAPITAL W !!!!!!!!!!!!!!!!
Did you see the other one? Click on the links in the article.
i believe the story might be fake but i also believe that faries exist.
HOW CAN YOU SAY THAT?! If fairies exist, they most definitely would be all over Derbyshire. I hear it’s FULL of fairies.
if there are fairies, there should be fairy dusts… wish peter pan would teach me how to fly with it i will go to derbyshire to grab one. Fly A-W-A-Y!
I think you have to at least buy it dinner first.
faires do not believe u stupid dick fucks
oh and also they could of found the bag and the “wings” look like leafs i get and they body could just be fake so ask yourselfs dat
kelly, you’re right. Fairies do not believe you: I asked them.
mr smuggles, are you saying you collect leaves that look like fairy wings? How remarkable. I ask myself dat all the time…or is that “I axe myself”?
well i find the leaves were i am now u STUPID DICK FUCKER AND ALSO THE BODY COULD BE MADE OUT OF CLAY SO FUCK DAT
SO SHOVE IT UP UR VIGINA OR DICK MOTHER FUCKER CUNT
fairies are not true if u think that they r ture you r a dick fuckers and the wings look like leaves and the body looks like a brunt barbie doll
*VIRIGINA
so raincoaster get a life and dont be a naked masterbating fucker
u r a DICK LICKER if u think fairies r true and its a burnt BARBIE DOLL with LEAVES ON THE BACK.
Dear Mister Sums/Smuggles/Whateveryoucallyourselfnextwhenyou’repretendingtobetwopeople, also known as | eujg@hotmail.com | — | IP: 58.7.76.51
Well sweetheart, ONE of us needs to get a life, that’s for sure.
u r a DICK LICKER if u think fairies r true and its a burnt BARBIE DOLL with LEAVES ON THE BACK.
Hey! I resemble that remark!
http://eatmyfuckingstilettos.files.wordpress.com/2007/05/march07athshot1.jpg
So eat shit Mr Sums!
Holy shit, so you do! If that’s not fate, what is?
Also, impressive lats!
Thank you, Rain! I know how you feel about personal links but I thought it was a perfectly and irresistibly suiting response to his post!
I’m cool with links as long as you’re not popping in once in your lifetime just to drop a link to an unrelated post on your own site. I know you’re not a spammer, no issues there.
And that was just too perfect.
couldn’t you all just be quiet! I wanted to believe!!
We believe! It’s those others who are nay-saying! Look, Stiletto Girl is even living the dream in tattoos and costume!
well im sorry to hurt your feelings but hey we’re in the real world and you have to get used to it so im sorry raincoaster and also do u know a girl called veirty i dont know how to spel her name correcrly but please inform me if you do
oh and also were are two different people
please tell me if you know this girl her name is veirty
are u there raincoaster
I know someone named Verity, but I very much doubt that is the person you’re talking about, as she lives in Mexico.
Those posts were done from the same ISP, and the person input exactly the same email address. Either they were both the same person or you have a stalker, sweetie.
If you live in the real world, you really should be more realistic. Do I know your friends? I rather doubt it.
Fairies may be fiction. Trolls on the other hand …
Grotesque little thing isn’t it? I love how it’s trying to talk like a normal human being.
um shes my bf and i told her about it and she put in a fake email adress like me
um how do I know you’re telling the truth? Verity says you’re a liar.
where i am veirty is a 12 year old girl
are u der raincoaster
why arent you answering raincoaster?????????????????????????????????????????????????????????????????????????????????????????????????????? scared
Because I have better things to do than hang around the internet in case some trolls in the comment section happen to be demanding my attention.
Now that you’ve annoyed me, you should be MUCH MORE afraid.
y should i be afaraids
What’s an afaraid? I don’t believe in afaraids.
Every time someone says i do(“nt) believe in Fairy’s one dies.
So that is why this poor little fairey has died. I DO BELIEVE IN FAIRIES
It looks real enough for me, so I think it is true.
AMEN.
http://news.bbc.co.uk/1/hi/england/derbyshire/6514283.stm
The person who actually designed this host has openly admitted to it.
“Former Derbyshire resident Dan Baines, 31, who designs illusions for magicians, made the fairy as a prank.”
Here is Dan Baines’ personal website: http://www.lebanoncircle.co.uk/DeadFairy.htm
Oh yeah, sure. That’s what he told them on-camera. I’ll be it’s a different story when he’s walking through the woods alone in the dark. You’re sooooooo gullible!
I know they could have lived just like any other “creature”. It is believable and I always did believe. And of course still do. Easy to prove someone right, hard to prove someone wrong in this case.
Wow If they get a hair sample from it what result of animal did it say it was??? wouldn’t it say that the animal was unknown
Of course we know what it was: It was a fairy!!!
police bag and gloves could just be used as a prop to make it look like a more realistic situation.
This is reli gd ! Mi frined actually thought it was real ! Ha ha aha aha aha aha ha ha ha ha ha !
Have your friend discuss it with claire up there. She’s a hateful doubter!
¡¡¡¡NO SE QUE DECIR!!!!!
JESSICA, WHY ARE YOU SHOUTING???
Where do these people come from, Raincoaster? That’s it, I’m going to prank you one day.
ohhh come on.! is that real???;-$
Of COURSE it’s real. It was on the BBC!
Hey Raincoaster!! Long time no chat! Amazed to see the fairy debate continues!! Wow – and some really, “um” poetic, eloquent …. comments up there! Guess it all keeps the blog alive, eh!
And, yes – I do still believe in fairies. Funny. I usually say I only believe in what I can see with my own two eyes, and yet, as far as fairies go – I believe? Huh!
Well I see them all the time around here. You’re just not staying up late enough!
Yes, the fairy debate continues, although slower. I expect most of the fairy commenters are in the lineup for the Harry Potter book at the moment.
Thats some crazy shit! Never seen any thing like it!
i think its fake but i do belive in faries and wen i searched for “real faries” they showed that pic and they said “real fairy found NOT ! ! !” it might be real it might not be u never know love, o:-)
i stay up all night
THEY SHOULD X RAY IT AND SHOW A VIDEO ! ! ! !
love, o:-) lol
Bellas right I DO BELIVE IN FAIRIES I DO I DO I DO I DO I DO ! ! ! !
CASEYS ALSO RIGHT BRING BACK THE MAGICAL CRITERS SAY I BELIVE IN FARIES,UNICORNS,AND MERMAIDS I ALREADY DID SO U SAY IT
WELL I THOUGHT IT
its not a burnted barbie doll cause it has ribs ! ! ! ! ! if u dont think im right look at it again
love, o:-)
they could of found it and it barely had wings so they removed it and put leaves on it and Mr. smugglers ur a dick licker cause u dont belive in it so ha i say again HA one more time HAAAA ! ! ! :-P
i mean mr sums sorry mr smuggler i got it mixed up :-*
dont say u dont bbelive in faries just say i “think” there not real I BELIVE IN FARIES I DO I DO
WTF?! no way…..!! O_O
Like, WAY!
lol it looks like a doll the way the hands are all straight… kinda like in grand theft auto their fingers are always stuck together they dont move individualy…
if you look at the close up and look at the hand it looks like… ok if you make a model car sometimes you have to shave off extra plastic from the parts and thats what it looks like between the thumb and finger
just saying
If you believe in God then you have to believe in fairies.
Fairies are elementals they are of the lower realms of angels.
Us as humans, God has given us gardian angels, now fairies are the same but they are the gardians of animals and plants.
Now I really dont care wether you believe me or not but I’ve seen a fairy, not like a little person with wings but a big ball of light floating through the room.
It’s very sad if you dont believe in Angels, as they sure do help you out a lot.
That’s from the Gospel of St. Timothy Leary, isn’t it?
this is LAME
Sooooo, your comment fits perfectly!
fairys are real ok u can think whatever u wannna think there still real if u ppl took the time to study about them u would believe but u dont because ur all stupid all the ppl that DONT believe there real and i dont care what all u ppl say there real and thats it period done
ive seen a fairy too and if u think im stupid whatever if u think ur a hot shot saying ohh this is stupid bla bla bla bla thats ur opinion not mine or any of the other ppl that believe in them there real creatures god put them on this planet for a reason to make this planet a better place. the fairys arnt little with wings like natalie said and shes right they are a ball of light i was sleeping in my room when it tuged on my hair and the most likely time of night which is june 23 is the most likely time of night to see a fairy and when that happend it was june 23 and no it wasnt a rat i have no rats in my house its been searched and theres none.
Why is June 23 most likely?
I`d like to see the X-rays mentioned, a C-14 test, a DNA examination and Histology of teeth and skin.
That would be areal proff.
Well, do you think they’re going to release blockbusters like that into the public realm? I bet they’re waiting for a book deal.
OMG – you people are so daft. This is totally fake. If it were real, why do we not have it in the museum? Instead is is placed as “police evidence” and posted all over the net.
Get real people!
no it cou;d be real thats why its being checked out at the police stastion. and when they know that if its real or not then they will deside where it should go. any way i think its real. cause how could someone make something that with it showing ribs or the teeth !?
Of course it’s real. The only place you see people who look like that is in zombie films, or The Mummy. Mummies are real–you can see some in museums, right?
And everyone knows zombies are real: it’s commonly known in Hollywood that during the filiming of Day of the Dead , George A. Romero had two houngan medicine men on the set making the legendary “zombie’s cucumber” paste for making people into the living dead. He also employed teams of men to comb the local cafes and diners for desperate young actors, whom he kidnapped, buried alive, and then had made into zombies.
Asked later why he resorted to such methods, he commented that he was straining his budget, and this was a great way to get around paying Actor’s Equity scale, as AE refuses to represent zombie talent, Ryan and Reeves notwithstanding.
Of course the subsequent street protests and riots by his exploited workforce were simply filmed and presented to the unsuspecting public as part of the movie. News outlets were suppressed and all zombie-related activity was dismissed by the mainstream as a publicity stunt, including the legendary Million-Zombie March.
This is at least as factual as the sad history of zombie protest.
UNDEAD RIGHTS NOW!
Thank you.
Metro is the Norma Rae of Cryptotheology.
they could have at least made the leaves not so…. leafy…
Wait for next silly season. We’ll see Fairy 2.0 I doubt not.
wow i havent been on this thing in a while hello peoples… :D the people who do belive in faries good who ever dont U SUCK !!!!!!!!!!!!!!!!!
thank you
Angel O:-)
Would an angel have said such a thing? Go wash your mouth out with Seraphim Soap!
wel how come things like this are never found in countrys where they orionate like ireland when was the last time someone actualy reported something like that there the myths are still alive there and things are constantly being found but they are never given the chance to be much more than a romour they just seem to disapear americans are the only people who seem to actualy find anything so im a little bit sceptical for that reason
You’re not allowed to be skeptical until you can spell “Originate” and learn enough folklore to realize that the fairies of England are not the same as the Little People of Ireland. Sheesh! Don’t even get me STARTED on Scotland and the Redcaps.
Besides, look at the URL: these people are not Americans. They are Lebanese, duh.
Erm… He he… Well, I’d say that someone is very good at making little dolls look like mummified fairies.
Sorry, people, I’d like to believe as much as the rest of the world, but hey, facts are facts.
The fact is, “hope,” that this looks more like a mummified fairy and less like any doll I’ve ever seen. Facts is facts: which does it resemble more to you?
I honestly truely KNOW it’s a fake. If fairies were real, they wouldn’t be called “fairy tales” now would they?
So now you’re claiming that fairy tales are fake, too? Talk about conflation!
I think that athiests made them up to give God NO credit what so ever. Wasn’t it he that made everything in seven days? The people who didn’t believe that God was real, they made up fairies to make a point, we can’t see God but we can’t see fairies either. Humans are cowards, we don’t like to think we’re alone, so our minds automatically find a reason to think that we aren’t alone, so again, that’s probably why lonely people made up the creative creature.
You’re a fairy agnostic? How can we believe anything you say, then? You can’t see fairies the same way you can’t see God, so your skepticism is strangely selective.
shut up!!
fairies are real and so is that!!
thank you =]
That may be true that i’m a fairy agnostic, and I haven’t seen God BUT I have felt him and sensed him and I have NOT sensed or felt a fairy. . . and I would like to believe in fairies, I love fairies, they’re beautiful, whimsical pieces of art. . . but that’s the sad thing, they are just lovely art, nothing else.
Aw hell – everyone knows the only mummified fairy was Quentin Crisp!
fur: you can’t prove any of it. And I have both sensed and felt fairies. They’re all over my neighborhood, in fact, generally dressed in designer jeans.
I would have to say this is Quite Interesting…I cant really say that I Believe this Photo But yet yu never know what is Really out there we are not alone in this Universe…
Indeed. Hard to prove fairies don’t exist…or someone would have done it by now, eh?
whoever doesnt beleive in fairys is wrong fairys are very much of a real person just extra small and has beautiful wings…!
i do beleive in fairies,i do,i do
Don’t listen to the h8ers.
This post is going to be older than the hills if it keeps on going like this!
Well, all I know is that it’s probably more fun trying to find some sign of wee winged folk than it it to find some semblance of sense and humanity in the world today.
Hey, that haunted house thingie is starting to fit really well today . . . .
Are you the ghost of a fairy, FFE? Formerly Fairy, EEK!
I can disprove that assertion easily and with the full agreement of all fairies – I have no taste in clothes, interior decorating or furnishings. And I look like shit in a bustier, ballet slippers and wings – you haven’t seen me handling any Disney World advertising chores, have you? Eh? Eh?
Prove it. Upload some pix.
ican’t bleave that fairys are real i thought they were just a mith but it looks so life like so i am going to say SWEET!!!!!! but i do know that giants were real awhile ago but i never knew this was real.!!!! i would like to know if i was a fairy in my past life. well cool
wow, it looks really real, but im not sure if it is real, i thought faries where a myth but this has convinced me enough to tell all my friends!
WOW!! they are real…my grandmother still doesnt beleive it! shes soooo stubborn….I would like info on how to get a job lookin for things like that faires and such…its so facinating.e-mail me to let me know how to start ajob like yours!
nikkiv16@rock.com
wow they are real!!! i really want to know how to get a job finding fairies and fossiles…that is awsome!!
I’m not sure there’s a living in it. You could search Monster.com…hey, there’s gotta be a connection, don’t you think?
WOW THATS SO COOL!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Lemme guess – you’re using this post as spammer bait, right? Or else it’s become a focal point for some new-wave Dark Ages?
No, I just like trollbaiting. 166 comments and counting…the WordPress record is 500, but this was only posted in April. I want to see where it goes from here.
omg lol
if this is real its surtainly unusual and fairly freaky lol
z
Indeed. If it’s a fake, it’s so good it deserves to be famous anyway!
DAMN THAT LOOKS REAL BUT I STILL LOVE FAIRIES AND FARIES SHOULD STILL BE IN OUR IMAGENATIONS;)
And our gardens’ bottoms!
First blog ive ever read, not much of a reader, not much of a fairy believer to, but this kind of evidence could make Mr.Roger’s shit a brick. But then again, i think its real cos you have to believe in it, i mean come on, with out fairytales about dragons,fairys,and all the other sparklely bullshit, people would stay in a world with george bush as a president….now tell the truth wouldnt you want dream of fairys instead of hearing george bush and watchin Carlos Mencia stupid ass on television every nite? i pick fairys, cos GW is a retard and CM isnt mexican…
i think the story is fake at first i thought it was real im pissed because i do truly belive in fairies and many other ppl do as well i think it is a mean april fools joke to the people who do belive and i am going to laugh one day when someone does find a real one!
also to the hoaxer whom made this fairies arent all cute they are very hostile vicious creatures who dont take to kindly to humans and i hope you never run into a real one because you wont even know wut hit you i assure u they are real and if you dont belive me go walking into the woods at night alone and lsten for there bells i know ppl who have truly seen them whether u belive me or not BEWARE OF THE FAIRIES
“Whom???” Back at your schoolwork, young lady!
Actually, this hoax was created by a magician’s artist. He creates incredible artwork, but he himself said that it was all a joke.
Very well put-together, but all fake. Check it out on Snopes.com
A lot of people say that he’s just saying its a prank to get less publicity. i say, hey, believe what you will. Everyone could use a little magic now and then, right?
Snopes…I’ve already debunked some of their bunk. We all know about Snopes ’round these parts. We do not listen to the unbelievers!
*claps hands*
*sez yeah*
wow i bet you didnt expect this much attention when you published it. I love fairies i think they’re awesome. I can’t beleive how angry people are getting on here! That split personality Smuggles dude/chick got dead pissed off and then wanted your help on spelling! Fricken hell! Some people are wierd and come on you guys! Some of you relly need to learn how to spell!!! A fourteen year old can spell better than you! (and i know cause i’m the 14 year old who can spell better than you) :P lots of love
Ashmee
Let me add to the chorus:
They certainly are real. Not a day goes by that I don’t have to shake one out of the ashtray out on the porch, or clean the mush out when they fly into the fans, or pull one away from the cat (those little bones are hollow and light, but they can cause havoc in a cat’s oesophagus).
Oh–and it’s kinder and cleaner to spray them. Unless you get them on the first blow, you wind up having to step on their heads, which is tricky while they’re flopping around trying to get airborne again.
In fact, they seem to have overpopulated the area, and if anyone can help me find the hive and kill the queen, I’d appreciate some advice right here in this thread.
i think it’s CGIed it can’t be real…..can it?
Metro, I think Shakespeare wrote a play about that.
Emily: of course it’s real! They’ve even got a police evidence bag!
A police evidence bag?
You mean, like a rape kit?
No, the whole thing was IN the police evidence bag. So it was evidence. I guess they were investigating whether or not it had been murdered. You can see it in the pictures.
Well I am still skeptical. Since when was hair preserved? If it were not for the hair I would believe this. Where is this supposed to have been found anyway?
@SG
Surely it would be a very sloppy investigation if they didn’t check to see whether it had been raped as well as murdered?
Actually, hair decomposes very, very slowly. That’s why zombies still have most of their hair.
Metro, a good point.
Everything I learn I learn from Law & Order. Scary, huh?
There are worse places to get your information. You’re better off than those American Idol addicts.
Sorry to break this to you guys but this is fake, some guy made it as april fools joke and sold it on ebay. nice try tho.
It’s pathetic the way you lot make these outrageous claims without any proof. You’d think you’d pay a bit more attention to the facts, which are conspicuously absent from your post. Where is your corroborating material? All I see are claims.
please don’t take away all my dreams, of course fairies are real… BELIEVE
I am a roman catholic woman. And although fairies are not spoken of in the church (as I am sure that they have considered fairies part of the ‘occult’) – I DO NOT consider myself to be a robot of a council of secretive men somewhere in the hills of Rome who ‘decide’ around a long table discussion, what is right for me to believe. In fact, I just so happen to believe in a God who is capable of creating ANYTHING HE WANTS, and that includes FAIRIES. And after combing through other religious texts, it is noted quite often that God is capable of doing ANYTHING HE WANTS, WHENEVER HE CHOOSES to do so. Now, without reading any further, can any of you who comes from any religious or spiritual background argue with that last statement?
I mean, when you think of the vastness of the universe, who the heck are ‘we’ to say what can exist or not? Don’t forget, that we, too, were once ‘thoughts’ breathed into existence by the awesomeness that is GOD. Having said that, if an innocent child (or an adult, for that matter) ‘thinks’ they exist, then what is stopping God from choosing to grant that miracle? Oh yeah, I forgot- Because in a round-about-way, some of you said He can’t.
We are arrogant to think that HIS AWESOMENESS stopped with ‘us’. The same wonderful ‘us’ that kills, steals, gluttons, rapes, and even chooses to turn away from Him. Do you think He is satisfied only in His creation of ‘us’? Why can’t we believe that He is capable of creating things of beauty such as fairies?
Just because we can’t always see them, doesn’t mean that they are not there. Most religious texts speak of angels. Yet I’ll bet most of us have never seen one. Does that also mean that they, too, do not exist?
I heard somewhere that fairies can only be seen by the pure at heart – a gift from a God who has been abandoned by the rest of us caught up in the rat race of life.
Look, I know, we all have to grow up sometime. I am 31 years old. I am a successful business woman. Back in my University days, I studied world religions, psychology, and philosophy. But growing up doesn’t mean we have to curse at others with foul language like the ones in this forum who ‘chose’ to speak poorly and condemn those whose hearts still beat with a faint innocence.
Don’t you think that life would be that much more easier if you choose to believe that anything is possible at the hands of God? It’s not about who’s “too cool” or who’s “too childish”. What it really comes down to is it’s a matter of choice: Do you believe, or don’t you believe, in a Great God? Well, because I NEVER question God’s awesomeness, I choose to believe…. that fairies EXIST.
By the way, I’m not sure why a lot of you are huffing and puffing over this particular mummified fairy having ‘leaves’ for wings. Being an avid fairy follower, I have learned that fairies come with a variety of wings – Butterfly wings (most common), translucent and irridescent wings (like a dragonfly’s), and wings that resemble ‘leaves’ for ambiguity. They are, after all, nature’s angels.
And, although I am not quite sure about the authenticity of the photos, someone here mentioned it would be more believable had the corpse had no hair. Well, having studied Egyptology, I can tell you that hair in a mummified state can remain well preserved. Even after the body has long been decayed.
Well said, Shanara:
“I believe, and there is nothing that can convince me otherwise. No argument, no question, no fact.”
I believe fairies are just as real as God is, and that those among us who are Believers are a unique breed. Thank you so much for your affirmation of my belief!
It is also true, and I know this from personal experience, that hair on a head can be preserved even after soft tissues such as the brain inside that head have long since rotted away.
That’s true: baldness is the least of your problems.
True: and blondeness the least of yours.
*mwah*mwah*
At least I’m a REAL blonde.
My cousin kathy knows everything there is to know about fairies, she would know if this was real or not..she has fairies all over the place. She is a fairy!!! go Kathy, tell us…is it real???????
well my cousin seems to think i know what this is, well im thinkin its not a fairy,im thinkin its a demon from hell, they float around to make people do stupid things this one just got caught in the physical realm….hows that glenna?
Wow, a demon?!? I’m going to ask my shrink!
It is a truth universally acknowledged that a young man in possession of a good fortune must not be in need of a Fairy, especially a dead Fairy from Derbyshire, the est of Counties
He can usually find them at retro dance clubs, from what I hear.
i have seen fairys with my freinds and i am 10 i belive and so should YOU
i think its kinda creepy but itz belivable i am 12 and i do(nt)belive in fairys lol is it true or not ?????????????????????????
no one has pruf that fiarys are made up but now we have pruf there real why are all of you stell not beliving!!!
Because you’re not using the power of the spell checker. USE THE FORCE!
omg- might eb copy right or a fake but ill test it for now i dont know weather or not to belive but ther has bin evadence befor so yea…if it is fake itz a very good fake then xD
Yes, and deserving of a post on its own, wouldn’t you say?
THIS IS SO BULL I DON’T BELEAVE THAT THIS IS REAL.GOD SAID NOTHING ABOUT FARIES IN THE BIBLE. COME ON PEOPLE IF THERE WHERE FARIES WHY CAN’T YOU FIND THE LEFT OVERS OF A DRAGON OR A UNICORN OR EVEN A FOSOLLISED DRAGON EGG? WHATS WRONG WITH YOU!!! DON’T TAke AWAY PEOPLES DREAMS OF TINK!
ICANT HEAR YOU CAN YOU SHOUT A BIT LOUDER?
Isn’t Kant spellt with an initial “K”, not IC
I’m sure Kant would have believed in a Fairy discovered in Derbyshire – after all, he believed in the Autonomy of Human Theoretical Thought
If you can’t believe an ENGLISHMAN, who can you believe ?
Mr Brown and Mr Blair don’t invalidate this – they’re Scotchmen
I would not dare to tell Englishmen what they could think of this.
Because God knows…It wouldn’t do any good.
Some day I’m sober I will post the justification for Kantian Teleologism, which should be impossible which is not.
Seriously,wait for it. I’ve been working on it for 20 years/
Mr G. EAGLE: I am not yet ready to reveal my reasons for Kantian teleologism so I cannot, as yet, support efforts to explain Kantian deontologism. I would hope that you have patience…
I’m placing a wager that this comment thread reaches 300 by the end of November. What say you?
@Stiletto
It might. But RC shouldn’t expect any help from me.
I never do.
Mais peut-etre le Monsieur Metro will favour (err … favor) us with his prediction as to whether this thread will attain 300 hits before or after or (as the case may be) simultaneously with Senor FFE telling us what happened to poor PeeWee or (in the alternative) with a certain Marchionesse’s striking 1 million hits
Tot siens
G E
I’m behind schedule. I should have hit it at the end of September, given the pace I was at this summer.
Thank GOD for Britney sex tape rumours. I can rely on the pervs: they at least will never desert me!
No, we never will, Raincoaster! We do not always comment but we are always watching! When your ship is about to sink it is us who will throw you a life raft!
Better drowned than duffers
If not duffers, won’t drown
Unfortunately for this Fairy, it had not the requisite life-raft, but fortunately for Believers, its remains were preserved in the anoxidant liquid of a deep Derbyshire Lake
I do consider myself non-dufferential at the very least.
Poor Tinkerbelle has not aged well at all. The years have not been kind.
She obviously bought the cheap drugstore moisturizer, poor thing. And Disney didn’t give her much of a pension after all this time, either.
[...] itself is interesting, but what really made my day was the comments to this particular post (”Mummified fairy remains found!“), and raincoaster’s responses to these comments. The comments on this post take the [...]
I beleive that this is real, no matter what the so called “creator of the remains” released to the public. I know that taxadermists create things like this all the time that looks unbeleivably real (e.g., the remains of a ‘jackalope’ or ‘winged cats’) but i just can’t beleive anyone would do this as a prank. surely the man realised that such a discovery would have set off a series of horrable events twords any living specimins caught, and put such off as a prank. kind of noble, yet unbearably stupid on his part. The world needs to realise that beings such as faries, dragons, and seamonsters are evident in every cultures history world-wide, and that there is no connection between said cultures. this in itself provide sturdy evidence that the beings in question exsisted at one point in time or another.when you really think about it, it is entirely possible for faries and dragons to have evovled out of something just as human beings did- and just died out do to mankinds innability to let be what it doesn’t understand. Discovery channel made a program about dragons, and explained every aspect about them in rational, and physically possible terms- even the ability to breathe fire. so these things ARE and i repeat-ARE POSSIBLE. anyone who thinks that they aren’t should go and read a few science books- there are annimals that are “real” that are MUCH more bizzare than any kind of “mythiliogical beast”…
Indeed, the Giant Squid was thought to be completely imaginary until a decade ago. Liberte! Egalite! Calimari!
your unbeleivable(not in the bad way)
But you’ve GOT to believe. Disbelief almost killed Tink…if people stop believing in me, what will happen???
i love fairies and i don’t know if this is for real!!!
please tell me that it is very true!
Yes, it is true, and if you send money to my PO Box all your dreams will be fulfilled.
Wow you are all a bunch of fairies! hears one more towards 300
i believe in fairies even though i have not been blessed with the sight of one. it matters not if this one is real it matters if you believe! thoughts are matter and you create all the time. so to all those who dont believe ha! they exist!
yah shes a fairy for shur i bet!
yeah well then your a fairy lover!!!
oh yah i would deffenatly love that fairy jessi all night long i bet shed love it
i love you too babe…
gahh so my fiance loves me……….. shes still a fairy. i should know 8)
i only come out at night, its safer that way. and now you are closer to 300 than you ever were before.
yeah she comes out of the closet at night….. it scares me
Y’know, it’s true, the more fairies you have, the closer you get to 300, or at least the cast thereof …
Then I’m at the front of the lineup.
[...] proofs were brought forward and each, in turn, mocked. Fossilized fairies. Mummified fairies. Even, in the ultimate legitimization that Western society offers, Retailed Fairies (free shipping [...]
I want to believe in fairies.. but it’s kind of hard in this dead world.. Not enough fantasy, not enough magic.. But in my so strong imagination (which I live in most of the time) there are many different creatures.. but not fairies, unicorns or gnomes.. Wonder why? I love them so much.. And they doesn’t even include my fantasy.. Which is on Andromeda.. With the whole Anime-world.. And me.. *dream*
Why should Andromeda be fairyless? If it’s your imaginary world, go ahead and put them in there. It has atmosphere, right?
You know, ya’ll should believe in the power of Raincoaster. This thread proves she will go on forever.
Thank you. As does the one about the poisonous spider!
Well is the fairy a male or female? Is it gonna be released to the public or what? Have you ever seen a live fairy?
Not sure about the gender, but if you click on the Fairy category you’ll see the post about the finder trying to sell it on EBay.
Her Grace la Marchionesse de WitchHampton under Buzzard de la Zouche “This is totally legit.”
Warum, warum, varroooommmm
Why does an anxious Citizen anxiously check his Wallet for his Credit Cards, upon hearing these menacing mots from a friend of Mesonychoteuthis hamiltoni
I have no idea. Why, you can see the police evidence bag for yourself, and if you still doubt, you had the opportunity to purchase the remains on eBay. I can only conclude that doubters refused the opportunity to do so lest they be faced with the wrongness of the conclusions to which they have jumped.
that is a littel sad. but it is cool that you found one.ever senc I was littel I whanted to be one.
I told you thay were reall
I like fairies and tooth fairies yay if the tooth fairy is real then that thing is!
you guys are such losers! That picture up top is so fake it’s not funny!
Fake? Can you back that up with proof, buddy? I rather think you can’t.
I am still very young, not even in my twenties yet. So i would believe in faries no matter what… and there is proof somewhere out there, we just cant open our eyes to see it. Pay attention, next time you gou out somewhere where its moist, or wet, like the reinforest, you might spot one. Trust me… :(
You know my name i use, mystery girl, theres a purpose behind it. There are many mysteries out there. If we listen to the facts, we WILL fins them. Take fairies to be exact. Someone cant make something like them up! The photo of this fairy is very convincing, and now i believe in faries more then i did before… thank you for helping people realize the truth behind the “fantasy world” i’ll be checking around, so see ya soon…. maybe
The reinforest? Are fairies into bondage?
Faries do exist to all of those dumb asses out there the only reason why they stopped showin is cos people stoped believin in them and all of u ppl that think u r so high and mighty can all go to hell….
There are lot of fairies down there, now that you mention it. Liberace, for one.
Yeah, this does look really cool. I do believe in fairies and vampires and werewolves and mermaids. But what really very annoys me is that as soon as something like this comes up there is one annoying loser who has to put God in the picture frame, OH look what god did HE GAVE US A FAIRY CORPSE!!!!! God punished us by killing the fairies, yeah ok, give me a break. 200 hundred years ago people who believed in god would have tried absolutely everything to cover up the existence of something like this, because according to them humans were as high as it gets. Screw that. You just say God did this because it sought of been proven and you people dont like to look stupid, and im not an atheist, i believe in religion that remembers and loves nature, like the norse gods and ancient egyptian gods. But those were all desrted by those who sought to make up a story that would benefit man kind and not the world we live in. If anything will prove this science will, so leave the scientists ALONE (IM A TEENAGER AND I CAN SEE CLEARER THAN YOU). Juts let anyone love the fairies, prank or not, because its people like you that killed them in the first place.
I will always believe in fairies raincoaster cos I live in Derbyshire and I’ve seen them. Those wings r totally fake though-they would have decomposed ages ago
Hey raincoaster this is an amazin thing u got goin here but I can’t believe it goes on for so long-just about fairies, y can’t people just believe, they’re real!
Sarah r u Sarah Barrett?r u in Lower 5 G?
Yeh, y, r u Ben Hunter? How cum ur not @ school?
Yeh, y, r u Ben Hunter? This whole fairy thing is so weird, I no peeps say it’s not true but they haven’t proved it yet an I still believe (an not cos I’m catholic or anything)so mr smuggles an his bf can fuck off
Yep, I’m off school cos I feel like it, I notice ur not in 2day either. I no u have better things to do an all raincoaster but r u here? stiletto? anyone?
ur not symba from lion king u no ben an u could always talk to me about somethin like, I dunno, fairies?
Is this real? I always thought fairies were supposed to be pretty little things that floated around like merry little nobs getting in the way and sprinkling fairydust in your hair. Bugger… that would be annoying. Anyway, if it was mummified wouldn’t it’s wings be, like, mutilated?
This is a dried fairy; its wings dessicated rather than wither away, because of the unique properties of the immediate area in which it was found.
Zombie fairies; there’s a thought! Somebody call Romero!
WOW!!!!! this is soooo real ..i cant believe that fairies are real! I will believe in them forever!!!
hey are there fairies at Albany, New York or in the town of -Schuylerville?? please I need to known because I believe in faires and all my life i’ve been dreaming of seeing one, and making things that could be useful for them!! :)
Your Grace
What do they teach children in these American Schools these days !!!
In Derbyshire (the best of Counties), everyone knows that fairies are indeed “pretty little things that float around sprinkling fairy-dust in your hair”, while they are alive
- at least, Derbyshire Fairies don’t go round eliciting disguised Anonymous Political Donations, from Property Developing Millionaires
BUT death brings on many changes for Fairies as for other Creatures
G E
their not teaching us about fairies!!..but that would be pretty cool though!!:) I chose to believe in them! oh and just to tell you I know like verything about fairies and they DO NOT! go around srinkling fairy dust on your head! Fairy dust is only used for majic…they dont use majic on humans!
Brooke, I can tell you’re not Irish. Read your Padraic Colum!
http://en.wikipedia.org/wiki/Padraic_Colum
The reason one rarely sees such well-preserved fairy remains is that they are often significantly altered by their passage through the jet engine; or in the more rural areas the digestive systems of dogs and cats.
I had thought to encourage them to take up residence locally, perhaps even establish a breeding colony, by leaving out the traditional bowls of milk. However, this attracted more cats, which as I noted are death to fairies.
Seeking something sweeter, I eventually discovered ethylene-glycol-based antifreeze. While I haven’t sampled it myself, several resources assure me it’s quite tasty. I’ve been leaving it in a dish on the back porch for several weeks now, and the fairies are lapping it up at a rate of knots!
They have yet to establish a colony–in fact I have yet to catch one feeding. However the local predator population seems to have declined, which I regard as a hopeful indicator.
Ah, now that’s using your noggin.
Ok, this thread must die!
… die ??
Warum + waroom = Varoom
[Y + Y = Booming Climate Change]
The Fairies will not go away because these Evolutionizing pScientific Materialists keep unleashing into the atmosphere Bowls of ethylene-glycol-based antifreeze, which (like Disguised Donations to the Labour Party) are hardly Carbon-neutral
G E
hey…
well…
i got a shock!!!
i am really intrested in all these….
however i don’t think it’s true…
could you please send me to my e-mail adress some more details and evidence by the scients????
thank you so much anyway….
yeah im not Irish, im French and part Indian!:)
I’m too lazy to email people, and too stubborn to let this thread die before 300 comments! Onward! 500, I say! 500 or die!
Your Grace
In the Life or Death of a Thread, it is important to ask the Right Question
It is the Right NUMBER that we should seek, not this nagging Anxiety for Evidence nor this worried speculation about the impact of ethylene-glycol-based antifreeze (“Fairy Booze”) on Canadian PermaFrost
Surely the Right Number is :
NOT 42
Nor “0, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 144, 233, 377, 610, 987, 1597, 2584, 4181, 6765, 10946, 17711, 28657, 46368, 75025, 121393 ……”
Inspired by the sagacious Guido Fawkes’ longest thread, I commend a number beyond :
71 x 5
Yr Grace’s obedt servant etc
G E
Hmmmm, it’s been weeks since I visited Guido: has he been seeing a lot of action lately? I know the “Peter Hitchens vs ‘Peter Hitchens’” thread got over 200 comments.
Is he getting Italian mathematicians to comment nowadays?
Her Grace la Marchioness de W under B de la Z
Your Grace
Here in the little Auld Country, Guido Fawkes is (as always) vastly worth a Visit
Senor Guido’s famous thread achieved the almost Magic Number of [(71 x 5) - 1]
Currently, Senor Guido is doing a brilliant Job over “DonorGate”, where our New Vicar (Herr Braun) is being embarrassed by (apparently) doubtfully reported/recorded Mega-Donations to his Working People’s Clerical-Party
I dinnae ken what all the fuss is about – I’m sure the US Republikans raise their Funds on a Grander, more Brazen & Shameless scale, without anyone complaining or suggesting that criminal offences are being committed
However, all this DonorGate fuss means that our Vicar has not been able to enact enhanced Protections, much-needed by Local Fairies – hence their mass-emigration to the Canadian Pacific Rain-Forests where so many are falling as premature prey to Tree Octopodia & Cats/Dogs and ethylene-glycol-based-antifreeze-Addiction
I have the honour (err… honor) to remain your Grace’s MatheMagically-challenged Servant etc
G Eagle
Tree Octopodia would never prey on fairies if they had warm-blooded tourists to gnaw on! Send more!
my god u guys r funnt as
Please leave us another comment with your thoughts. Bring your friends, too! Only 21 more till we hit 300!
Your Grace
Can (or is that a mis-type for Cant) seems not to have completed his Sagacious Komment
Perhaps the Britisch could fly out their Cabinet with all their assistants & other high-paid lackeys (err …. patriotic hard-working Public Servants, the best in the World)
Stressed & troubled folk would of course have to fly Business Class, if only to keep out Poor Seekers-after-Truth (“Journalists” like M Metro et Senor FFE) whose Employers don’t run to Business Class flights
They need the peace & quiet of such lovely Countryside to quietly co-ordinate how to Spin against the DonorGate misREPRESENTATIONS, away from the unWelcome observation of Gentlemen and (in these enLightened times) Ladies of the Press
However, having banned Fox-Hunting in Inglaterra (and at the stroke of a frivolous pen, destroying 250,000+ jobs in the UK Countryside despite its heavy levels of unEmployment) the danger is that they would eat raw Tree Oktopodia as a succulent delicacy, as alternative to Battered Panda Steaks
On reflection, perhaps we should get Mr Bush to send more Americkan tourists
Your Grace’s obedient servant etc
G Eagle
I, myself, can‘t count. 15 to go!
There are 250,000 professional fox hunters in the UK? I had no idea!
I think your Grace means 14 (or is it now 13)
I’m given to understand that it’s, what?, 13 comments to go before you overtake the comments count set by Guido Fawks and his ‘Peter Hitchens’ thread?
And this thread is “proofs were brought forward and each, in turn, mocked. Fossilized fairies. Mummified fairies. Even, in the ultimate legitimization that Western society offers” So, no relation to the Guido thread then? Related Fairies? No related fairies.
I might be in error so I think it expedient to say absolutely nothing about Peter Hitchens or fairies or any relationship between the two.
I just hope Peter Hitchens doesn’t drink Red Bull
and I sincerely hope he isn’t dead
Do ‘Mummified Fairies’ have to be dead?
Anyway, I understand that fairies are annoying little sods full of mischief.
They probably blog.
Well I’ve done my bit and even got a warning message for it for posting too quickly which I thought was impressive considering I know sod all about fairies!
That was some impressive spamming there!
I wonder what all these people expect to find when they google for it…
I don’t know: Liza Minelli’s ex-husband?
Three more, people…don’t fail me now!
Liza Minelli’s ex-husband is a fairy??
Actually that I would believe.
Which one of the many?
At least two: that Broadway choreographer (who saw THAT coming, eh?) and David Gest, the wax figure.
Ding, Ding, Ding! 300! Now where are my Spartans?!?!?!?!
Your Grace
Noch ein grosser Sieg mit 301 Treffer
but
As Obi Ben Kenobi’s freond so sagaciously opined :
“There’s always a bigger fish”
Senor Guido’s thread ran to 354 posts !!!
Yr Grace’s obedt servant etc
G Eagle
Hmmm… hard to tell whether this is real or not…
G Eagle, now what am I going to do with this Champagne?
The record on WordPress is 500, I believe. I think it was Laurie Kendrick that had that.
Your Grace
Well done
[sotto voce]One is reluctant to make any remark that might be construed as insulting to Spartans, but perhaps your Grace could be urged not to get too friendly with your Friendly-Neighbourhood Spartans
These were the Guys who used to shew such tender regard for their Wives that they murdered those babies who did not shew sufficient of the robust Potential of Muscular Christianity
and while some of our Better, most incisive Journalists struggle with their Employers’ Wise Judgments & Generous Remuneration packages
the Spartans used to (without warning) declare War & go round murdering their own Loyal & Quietly-Behaving Employees (“Helots” or in the 1860′s Confederate Vernacular – “Slaves”), just so that the Helots [Greek-Speaking yokels] would know they would get far worse if they ever chose to become revolting – eg by voting Democrat or supporting Leveller opinions or learning Latin
G E
But, but, I was BORN revolting!
Hee hee, brilliant Mr Eagle Sir :-)
Yeah I too was born revolting; revera linguam latinam vix cognovi.
47 to go! We’ll get there!
Easy peasy.
Incidentally, HWMNBN has published an apology from a correspondant at the end of todays post, the delivery of which to blog readers is so smug it’s vomit inducing. The apology makes the one painfully extracted from me look positively shy in it’s brevity. Can we send HWMNBN faeries for xmas? No. I should eschew these thoughts and sleep.
I know a bank where the wild thyme blows,
Where oxlips and the nodding violet grows,
Quite over-canopied with luscious woodbine,
With sweet musk-roses and with eglantine:
There sleeps Titania sometime of the night,
Lull’d in these flowers with dances and delight;
And there the snake throws her enamell’d skin,
Weed wide enough to wrap a fairy in
You COULD Scrooge him, if you felt like it.
http://www.scroogeyourself.com/
Oh that’s brilliant I love that, thanks. Best not send him anything though it just invites bile by return – I just delete his emails now without reading, it serves for a much happier life. He has got my phone number, eek!
Ellee Seymour has a post: ‘Publish and you are damned!’ about unfortunate blog posts and I couldn’t resist this comment:
And as if by magic we can see an apology for a blog post published on Peter Hitchens’ blog at the end of todays post about the film The Golden Compass.
The presentation of this apology to blog readers is so smug it’s vomit inducing. But do not imagine that I do not admire his skill with words, and my personal admiration for him is positively Shakepearian in it’s poetry; like that of Titania for Oberon. But when he launched the strong voice from his chest, and words came driving on the air as thick and fast as winter snowflakes, then, as Odysseus, he could have no mortal rival as an orator!
Sadly I do not have the beauty of Helen of Troy but, it seems, all of the effect.
Cooee, Raincoaster – please read the second email I’ve sent you and would you confirm by reply? Many thanks x
And the third.. message I mean:
Lady dear, if fairies may
For a moment lay aside
Cunning tricks in elves play,
‘Tiss at happy Christmas tide.
We have heard the children say-
Gentle children, whom we love-
Long ago on Christmas-Day
Came a message from above.
Still, as Christmas-tide it comes around,
They remember it again-
Echoes filled the joyful sound
“Peace on earth goodwill to men!”
Yet the hearts must child-like be
Where such heavenly guests abide,
Unto children, in their glee,
All the chill year is Christmas-tide.
Thus, forgetting tricks and play
for a moment, lady dear,
We will wish you, if we may
Merry Christmas, glad New Year.
Philipa: is he stalking you? Maybe Boris could help: Boris loves press!
Ellee is an awesome blogger, someone I HAVE to get to more often. And of course, this post rocketh severely.
I’ll email.
Indeedy, this post doth rocketh.
Hotmail? Give me a day to check it: I’m virtually entirely gmail nowadays.
Oh soz, don’t have your gmail but reply sent to your reply so hope you pick that up. Will ask for your gmail next time.
Anyway, just got the children Shrek 3rd, will look out for fairies but the main one plays a character that looks spookily like a young Boris the beautiful.
raincoaster AT gmail DOT com.
What did young Boris look like? It’s a concept around which I cannot wrap my brain.
C’est une Concepte que on ne desire pas wrapper around la Brainne
Exactement.
Mon dieu Mr Eagle!
I think it was Vogue who ran an article featuring the Bozmeister and I particularly remember a pic of him aged about 21 in which he looked uncannily like ‘Charming’ from Shrek2, only not gay and with a better voice and a backbone, obviously.
PS: thanks Raincoaster, thankyou for your decision. I am indeed calming down, slowly. Handing in my assignment helps. It’s Rousseau next – goody :-))
Liberty, fraternity, property??
Rousseau, an excellent antidote!
Property? I don’t think Rousseau was a Tory!
‘parently the soundbite was originally ‘liberty, equality, property’ as it was essentially a bourgeois revolution but I will look into this and report back..
“Everywhere, Men are born Free,
mais les Dames do the Cooking et the Washing-Up
Rousseau was rich enough to be able to afford to be a Socialist – presumably Cruella de Blair et M. Le Brun are similarly embarrassed with riches
What happened to Rousseau – did he live long enough to have a Blind Date with Mlle de La Guillotine ???
I thought he turned into a painter?
Composer I think, he died a natural death and I think he dumped his children in an orphanage. Dominic Lawson did quite a good piece on men who bang on about liberty and family and whose behaviour is quite the opposite.
Dominic Lawson, however, too often supports those who don’t even do the first.
I’m reading my Tom Paine book at the mo but may treat myself with a book on Rousseau for crimbo. I want to get Simon Schama’s book on the French revolution but do you know it’s cheaper and quicker to buy it from Amazon than it is from my local mall?! They didn’t have anything I wanted in my local bookshop, it was full of pap; biographies of footballers and z-list wannabes, penny dreadfuls and celebrity chefs.
I declined the offer of a free book on wizarding claimed to be aimed at children though it was beautifully presented with pentagram and spells and free parchment. No fairies though :-(
Tom Paine? You sure do like a depressing read at Christmas!
I prefer the Halliburton film version of A Christmas Carol. It’s just like the Alistair Sims version, only they play it backwards so that it has a happy ending.
Cheers me up when I can escape the TV. That’s what a lot of people do here you know – just eat, drink and watch TV, with relatives they’ve managed to avoid all year, it’s the talk of the playground; everyone’s having a good whinge and getting it out of their system so they can smile through gritted teeth at the bitch their brother married or the mother-in-law that hates everything through her painted pink smile. Luckily my relatives are ok – they like quiet when the very loud TV is on so I go in the back with my babes and play till bedtime then read Tom Paine and I’m asleep within 2 pages!
That’s not what happens to me, Philipa: I generally throw Tom Paine across the room and then write really bitchy comments on Tory blogs.
Metro: if Cheney were to be visited by the ghosts that Haliburton has created, he’d be kept busy till New Years at least!
Would that be a crisis of Con-seance?
Just saying this, how utterly stupid!
Fairies are a figament of childrens imagination.
AND THAT’S COMING FROM A 13 YEAR OLD!
Char “…. figament of childrens imagination …. ”
All Children are of course very welcome in this Kindly & Tolerant Space … even perceptive and sagacious faery-unbelievers/skeptics
SchPelling is the burden of Adolt imagination and it improves with age, at least prior to dementia setting in
Was it Galileo’s ADULT imagination that came up with the misconception that the Earth goes round the Sun
… whereas inspired by Einstein, 20th Century Physicists kNow all Motion is relative
…
Rach, how do we KNOW you’re only 13? How do we know you exist at all? We have to take it on faith, I guess…
Mr Eagle – “all motion is relative” – you’re not kidding! That’s all some relatives talk about.
Can’t bitch on Tory blogs at my folks as it turns Mum into something sounding like Terry Jones from the Life of Brian, which admittedly can be a laugh but only once.
I don’t think ‘Rach’ is a child of 13 at all. She might be 14 at which age everything is stupid. Bless. Or she might be a 220lb trucker named Duane who’s in denial. I think we need more proof, at least on the fairy front.
62 left!
Yes, everyone knows Duane is a fairy!
wow i dont know what to think.
when i lived in texas when i was in 2-3 grade, me and my best friend tasha DID see fairies at our school, at my apartment, in her yard, basically everywhere! one day we were exploring and we came across a tree with a bush. we peeked inside and saw a colony of fairies! the leaders name was laurabella, and she was about to have a little baby fairy! i would go there everyday and see them. they showed the their ruines, and cloths. laurabella had white wings and dress, and she “said”(couldnt talk to us ut signed to me) that she was going to name the baby fairy after me, and that she would visit me. but when i moved to socal in 3 grade, there were no fairies and nobody beleived in them. im in high school now, and laurabella and her baby have never come to see me.
maybe it was just our imagination? idk but this has convinced me otherwise! this looks so incredible!
I have a very strong premonition that you haven’t seen the last of laurabella and her baby.
Your Grace
It is a Truth universally acknowledged that educating females can have unexpected (as the Mond=Tochter indicates) consequences, as the years advance
Without female education, we would be deprived of those glowing Jewels in the UK Governmental Firmament
These Ladies have brought such glamour und political effectiveness – such supporters (as they gobble up their massive Government expense allowances) of Mr Blair, until he moved on to a higher plane of existence
eg Mrs Jack Dromey (err in Canuckistani – Ms Harriet Harman)
eg Mrs Ed Balls (err in Antipodean – Ms Yvette Cooper – even as we type, she is doing more to wreck the English Housing Market with her “HIPS” packs, than the combined Greeds of the US Sub-Prime Mortgage Lenders and Northern Rock)
eg Mrs David Mills (err … Ms Tessa Jowells)
eg Mrs Tony Blair (Cruella Booth aka Cherie Antoinette)
eg Mrs Derek John Gadd (… Ms Ruth Kelly) – the member of Opus Dei who is a pre-eminent contender in a well-populated field for the prize of most light-weight Education Ministers – the sort of woman who would exclude Faerie as a subject in the Englisch National Curriculum, as well as criminalizing Catholic Adoption Agencies
355 comments is the goal? I can see the whites of its eyes.
G Eagle, don’t be so narrow-minded. I saw Guido’s “Tory Totty” thread, and the pickings there don’t look much more promising, either aesthetically or politically.
Your Grace
… but I am so much older than you – allowances must be made
AND Your Grace et Mr AerChie can luxuriate in not being narrow-minded, when your Countries’ affairs are so well presided over (of course under our Gracious Queen. God Bless her) by those awefully nice Chaps Mr Harper & Mr Rudd
but even wide-minded Colonials et exColonials would be endorsing this SECOND BLAST OF THE TRUMPET against the MONSTROUS REGIMENT of WOMEN … if Canada & the USA was under the Government of the afore=mentioned Ladies
Perhaps this explains why Gordon currently looks so …..
Lucky for your Grace that your Grace had not registered to take a UK Driving-Test, in readiness for Britain’s leading Bloggerist asking Canada’s leading Bloggerista for remunerated help – if you had, your personal details might well be in the hands of the US mafia
Mrs Derek Gadd has now apologized in the House for losing the personal details of 3-million Learner-Drivers – perhaps we should ask FFE (our distinguished US Correspondent/Investigative Journalist) to try to recover them – apparently they went missing on a Hard Disk in the USA
However, if your Grace’s name is indeed amongst the “3 million”, I suppose your Grace could go on a UK Witness-Protection programme, with a New Hidden identity
… err … but perhaps this would not be such a good idea
International Criminals could well have now acquired the Inland Revenue’s “lost” 25-million personal files, which include the assumed names & locations (& National Insurance tax numbers) of all those on the UK’s Witness Protection Programmes
Harrumphus, harrumpha, harrumphissimum
Yr Grace’s obedient servant etc
G Eagle
PS Me miserum – still another 12 to go … und I see I have included not Mrs Ian Ducat in the Schedule of Illustrious Ladies who so illuminate British political Life
I knote the abundunce of posts from a certain G Eagle of whome many tails are tolled. He no longer has credibility as he, above, on Octembere the fiveth, referred to “Scotchmen”. And he was not referring unto the makers of a form of uisge beatha named Laphroaig. He was referring, insultingly, to guid honest Scotsmen. Undoubtedly he is blinded by his foolish detestation of the followers of Keir Hardy. He has shocked me into correct spelling.
Someday soon, he could well be attacked by an enraged sporran and kilt! And all the Derbyshire Fairies in the world will not save him!
Ask not for whom the belle tolls – - – !
(344?)
No Sir, can it be, Archie, that Mr Eagle has made such a mistake? It must be so and a heinous error it is to any scotsman to be sure. I predict that if the word gets out the little wee haggi will be hunting oot the poor man. Beg forgiveness Mr Eagle for a haggis with a mission is a sight to behold.
Crivens!
Indeed, and he seems to be blaming the US mafia on the female of the species. Given my neighborhood and gender, this is not inclined to endear him to me.
He must have gotten up on the wrong side of the porridge this morning or something.
Oh waily, waily, waily, Sweet Philipa, as you are already a member of the Grey Eminence’s “Monstrous Regiment of Women”, I fear your opinions may be ignored, as he seems to be taking on the attitudes and habits of that other grey person, the Wintersmith. But let him be in nae doot! Nae King! Nae quin! Nae Laird! Nae Master! We willna’ be fooled again! For we are the Wee Free Men!
And we will cut off his porridge!
Don’t you need a license to do that? It doesn’t matter; the NHS has a twenty-month waiting list for porrigectomies.
Oh Aye? I’ll jump him to the top of the queue and I will perform the
dismembermentoperation with a blunt spoon!Let’s wait and see: with all porridge-related medical conditions, it’s best to give them 48 hours to solve themselves before bringing in the hoses.
Ach no Archie, the Wintersmith is no grey, he’s white and bites like the frost on your face and stings your eyes and steals your breath in the wind. He dances like snow in the breeze and threatens like thunder. He has the power of the Earth and is tamed by the brightness of a sunny smile. Nae lad, Mr Eagle’s not like the Wintersmith, we can easily cut off his porridge.
But as Raincoaster decrees – 48hrs before bringing in the hoses. (why hoses? you’ve got a spoon, what more do we need? – it must be a haggis thingy, ah waily waily, not the haggis beastie)
Her Grace La Marchionnesse de WitchHampton under Buzzard
Your Grace
Doomed
We’re all doomed
In January 2009, in her remoteness outside the London Congestion Zone, residing within a Racing Pigeon’s flight of Shepherd’s Bush, even the Lady ApilihP will be endorsing the SECOND BLAST OF THE TRUMPET when oor Hilary is moved into 1600 Pennsylvania Avenue … and insisteth on passing the Port from the Left to the Right
Doomed – we’ll all be reduced to drinking Aqua Vitae in the Gallic – och, hoots, man
Just think of the US Spelling=Imperialism which now (even before oor Hilary’s Advent) creepeth even into this Blogge Eruditissimum, withstanding not that it is read by so many Ladies and Intelligent Children and by Monsieur Metro
Porrige …. Neighborhood …
and BTW
Freond is not a Spelling Mistake – it’s Anglo-Saxon
and
the korrekt spelling of Equine in the Plebeian Vernacular is “hoRse”, nicht “hose”
Doomed – is Jesus to return and the World end before we ascend to the Magic Number [71x5]
I have the honour (… ummm … honor) to remain your Grace’s 352nd obedient servant etc
G Eagle
PS Le Chevalier Aerchie’s Petition to Save the Whale (err … in AntiPodean – Waily)
NOW is the time for All Good Bloggers to visit Aerchie & Sign the Petition to save Motherhood, Apple Pie and the Cetaceans NOW
I would always pass the port to the left, unless I was sat on the hosts right. Hilary is Boz’s choice but I have never endorsed her nor would I. Jesus isn’t to return, he never left – we are only doomed by our own actions, especially those actions that court the wrath and displeasure of the dreaded Haggi..
oh waily waily!!
354, my friends.
G. Eagle, when is Arthur coming back? That’s what I want to know!
Shrek’s got the annoying little rascal
What is this Shrek of which you speak?
356!
Why aye, the big green beastie!
Do you not have green beasties in Canada?
Hey I saw a prog on the bears in Canada moving into the towns of ski resorts to feed. They were magnificent creatures but people would happen upon them and then take pictures and the bears would amble off – you’d be in more danger in London! Well you would in hackney.
We have only Ogopogo.
But yes, we have bears, but they’re not that harmless. People routinely mistake them for chow-chows, which is a mistake. One eedjut decided to have his kid feed a honey sandwich to the bear…which was a grizzly. Now they call the kid “Lefty.”
Yes the teddy bear image does rather give the wrong impression. Sounds like the kind of dumb parent you see pushing the pram, with baby, into the road whilst themselves waiting safely on the pavement to cross.
Sadly my babe, the junior journo, has had to come home from school with a raging temperature. If you have any influence with the fairies I’d like to have her well for at least Xmas please. The annoying thing is that out of hours medical care is non existent in this country unless you go to A&E.
Fairies rarely heal people, in my experience. They DO cause a lot of fevers, though, so maybe they’re watching what you type here!
A&E? The Arts and Entertainment network? I don’t think they can help. This mythical country where doctors are on 24 hour call over the holidays? It does not exist, and never has. Just read A Junky’s Christmas; even the drunken sot of a doctor in that one wouldn’t take calls on the holidays.
My sister used to work switchboard in a hospital, and she suggested that rather than bring sick kids in, parents call in and ask to speak to a nurse, who could make the determination of whether or not it would be better to bring the child in, with all the waiting around that entails, or to try a bit of on-site triage and see if the child improved.
360, by the way. I have seriously beaten Guido Fawkes, proving once again that people are really interested in who’s really a fairy.
360 – well done!
Managed to get my babe to a doctor so she’s on antibiotics. But in all fairness this mythical country where doctors are on call 24/7 is in fact the Accident and Emergency dept in any NHS hospital in the UK. My son spent xmas from ambulance to A&E to ward one year and they tried so hard to make it fun for him with presents and a santa who had to wave from the door of his isolation room. ‘Daddy’ wouldn’t even come onto the ward but this stranger ho ho’d to every child. That mattered.
You mean where “residents and interns” are on call 24/7!
And yes, they really do try hard in children’s wards at Christmas. It’s heartbreaking for them to have to be in there at that time.
Her Grace La Marchionnesse de WitchHampton under Buzzard
Your Grace
Doomed
We’re all doomed
Yes – 364 – but is the Gentle Laurie’s 500 record to remain safe
Doomed – bring on the Horses
I have the honour (… ummm … honor) to remain your Grace’s obedient servant etc
G Eagle
I have yet to see the post in question, so I remain skeptical. Besides, at this rate it’ll just be passed by this thread in June or so.
We do our best.
Happy Christmas all :-)
Merry Christmas! Maybe next year I can come over there and wish you Merry Christmas in person. I’ve decided to become rich; wish me luck.
Check this out
http://www.crypticmedia.com/content/fairy-caught-flying-in-house.php
And this
Another Fairy Caught on Film?
This anomalous flying, glowing object was photographed by reader Neil Wallace at Spofforth Castle, North Yorkshire, England. “Perhaps there is more to this faerie thing than meets the eye!” Neil says. “I was the only one there and was braving out a night time photo shoot. Spofforth Castle is reputed to be haunted by a young maiden who committed suicide supposedly by falling to her death from one of the towers, and has been frequently seen walking the grounds in and around the castle.” You can see the full photo in the Paranormal Gallery.
Aha! New life to the controversy! Thanks!
I wish you the best of luck and you would be most welcome here!
Thanks! I shall keep you posted (although I did once show up at my friends’ house, having idly boasted of doing so months in advance. Such a shame it was two-thirty in the morning and they didn’t quite have the strength to appreciate the joke.
)
fairies are real and I’m 15 stupid people who do not bielive in fairies are stupid.
But surely the fact they are stupid makes them stupid? Or am I missing something here?
And we shall not comment on the intellectual level of people who spell it “bielive” of course.
that looks so sad
:(
it looks so sad like sam said
:(
Well, it IS dead. You’d be pretty sad, too. Fairies don’t normally die at all; this one must have been killed in a battle or some accident.
Old age?
Nope, fairies never die of old age. They’re immortal! Maybe it was killed by a curse?
Bonjour, la Vestre Grace
The puir wee Lassie – she seems rather thin
Peut-etre, elle est morte parce que elle a mangée de trop de Porridge avec le salt et pas de beaucoup de sucre tres nummé et nourishant et fattenant
Cause of D’Eath = Dieting & Eating Disorder
Is that what made your friend the Mesonychoteuthis Hamiltoni float to the surface off New Zealand on Monsieur AerChie’s Blogge
Ah, that would explain it rather well. Perhaps we are looking at Kate Moss’s great-great-great-great-great grandmother?
As for the ways of the Colossal Squid, they are mysterious even to the fairies.
i know fairies are real.I have a fairy that keeps an eye on me.i also have a sister in law that can see them.just coz u don’t see them,doesn’t mean that they are not real.u can’t see love but u know that it’s there!!!!!!!
Her Grace La Marchionesse de WitchH etc
WHERE EAGLES dare
La vestre Grace
Noel Joyeux et Best Wishes pur l’Annee Nouvelle
Quand vous estes plus riche, we shall hope in 2008 to see you in Inglaterra – je puis recommender la Cooking de la Magicale Mdm Grise-Aigle
La vestre Grace’s servant obedient etc
G E
It is time we worked harder at mummifying the Guido Personage. Preferably long before the day after November 4th, 2008.
What do Grey Eagles cook? Bald Eagles eat a lot of salmon…I shall do my best to become rich enough to annoy in person on two or more continents by this time next year.
Archie: it looks like we shall leave Guido in the dust long before then. Although I think he’s more of a cinder than a mummy, unless my history is all wrong.
There are always things that were told which have for some reason passed down the line as tales. No one knows if they were real, but who knows what our past bred! With science or without it, you can’t always prove something right. It’s possible that fairies do exist, or at least existed long ago. It’s also possible that they do without scientific evidence because science isn’t always on our side- nor 100% correct. The truth is hidden within the past, and sometimes science can’t find it. So maybe the fairy there is real. Maybe it’s not. Maybe fairies have existed long ago. We may never know throughout the life of this planet. But to have a possibility takes a step closer to the proof. You can’t say something’s real, or say it’s not real- no matter how much evidence there is, because you don’t control the fate of this planet’s life (historical to present) nor do you know all of it’s past. Science is so difficult that we can never understand everything about this planet to stay short, but think about what the universe has that will take forever to find! That would make my head hurt…
If you’ve seen one- then there’s a chance that they’re real^.^
i think these pics are fake. <3
Science is not difficult – it is the observation and analysis of the natural world. Getting it right is the difficult bit. It IS possible to ascertain what is real – the light in the fridge routine is a con spouted by men to confuse you long enough to get you naked.
Mr Eagle Sir – porridge with salt in? Ugh!
Happy New Year Y’all!
Her Grace La Marchionesse de W’Hampton under Buzzard de la Zouche
Your Grace
I flatter mysen that the Lady ApilihP und this Eagle agree on so many things – at least, we seem to be of one mind on the merits of EgdirroP con sale [pSalt]
BUT as Trinity observed to Neo, it’s the QUESTION that DRIVES us
Much may be admired for sheer talent und a good voice … mit [with] opinionation circumscribed mit such an Economy of Language, but we must not let the veracious Dame Bassey so drearily distract us, however welcome may be such une Visiteuse si distinguée
UND it is not what Eagles cook – peut-etre it is plus interessant to know what MDM Eagle cooks [... mmm .... yummy gooseberry phoule ...]
Rather as Pythagoras perceived, it is THE NUMBER
Elle n’est pas 391 – c’est plus prochaine a [2x2 * 10x10] + <1+101, ut vincimus la Gentille Laura’s Blogge-Record
Je reste le Vestre Servant
L’Aigle Gris
Patience, my friends. All things in time, but few before the New Year at least.
All you need is Faith, Trust, and Pixie Dust!
Or if those don’t work then a shedload of money usually does the trick.
May we all have everything we want in the new year :-)
im 9 years old and i belive it. 1 because i rote to a fairy and they said they were 6-8 inches tall. i left my note on my drive and did NOT tell my parents. no lie
yes i right to the fairys no lie but their is evedance this is fake. but if their was no evedance i would belive it
I’m sorry I didn’t understand that – should there be a hyphen in eve-dance? Do fairies dance on new years eve? You’ll have to let me know as I can no longer be bothered with all that auld lang syne stuff – grim.
Yes, fairies dance on New Year’s Eve and all full moons and Christmas, too. But they don’t touch haggis; the mere taste of haggis would make them mortal!
Haggis is yummy but chasing them always makes me dizzy.. and it freaks me out when they turn and start chasing YOU! ARGH! Hey enjoy the dance if you get the chance but be careful ;-)
Her Grace La Marchionesse de W’H under Buzzard de la Zouche
Your Grace
The Lady ApilihP has achieved a Milestone of Wisdom
It is a Truth universally acknowledged amongst the Cognoscenti of Occult Mysteries :
Doomed
We’re all Doomed
The Hunter must always BEWARE, lest the Hunter becometh the Hunted, on the Way to painfully-becoming Late (= Dead in Botswanan or FruhStuck for a Gaelic-speaking Haggis)
A Haggis most Ravenous is indeed an anxious Sight – but just think hWat it must have been like before Caledonia was inhabited by Homo pSeudo Sapiens, WHEN Giant Haggises (in Gaelic Haggoi) roamed the Land in Quest of Beavers, Panda Cutlets, Raw Squirrels and pSalted EgdirroP to afford a varied Diet to the Plump & Greedy
AND BTW
Exactly what did this Late Fairy have to do with D B Cooper – is it true that the Body was discovered with used $20 dollar bills from the early 1970′s
One would not like to think ill of a Derbyshire Fairy
Your Grace’s obedient servant etc
G Eagle
well i sorta blive in faries but yur right they should stay in our head but i showd it to my dad but he said its a load of s***(poo) but im not botherd to what peeps think stacexxx
p.s maybe the bbc said it was april fool coz the FBI told them 2 just maybe
I believe DB Cooper was on the run from the murder of this poor fairy; it would explain so much! Stacy’s on the right track, insisting on a BBC-FBI conspiracy to cover up the truth.
Philipa, the thought of being chased by a wild haggis will now haunt my dreams.
402!!!
I want to be chased by some wild haggis.
WOW YOU CAN SO TELL THE WINGS ARE OLD LEAFS FROM A TREE =) KINDA DUMB TO TRY AND FAKE FARIES OUT . aND THAT DEAD LITTLE BODY , WHERE THE HELL DID YOU GET THAT FROM ? IN A MEXICAN PARADE OF EL DIA DE LOS MUERTOS? HAHA J.K
There are no fairies in Mexico, silly! Because they have no mushrooms, they can have no fairy rings. Simple logic.
Raincoaster I saw this and thought of you.
Shame xmas is over – don’t tell me, like men, you prefer the real thing, even if they are a bit dead?
I prefer the real thing to imaginary except in certain circumstances, such as being sung to by a witch underground while Puddleglum tries to remember something important.
Hee hee, excellent. Have I mentioned Quasar 9′s blog? He’s got a post up at the mo about magic circles concentrating energy and some pretty pics from outer space. Apparently stars have a heartbeat! Don’t think that’s gonna help a dead fairy but there you go.
haha…it looks so real….shame…..it could of made a lot of money if it was…
Oh my god there is a real fairy in that picture? :O i will pray for that fairy and wish i can see the fairys i wish i can see them i believe in them i sereiosly do!!! please tell me how to see a fairy! please i want to see them :’( :’( :’(
If some one is making a joke about a real fairy! THEN STOP!!!! i want some one to stop that pranks i wanted to see them and i wanted to fine somthing from a fairy! we dont want pranks anymore i want to see a real fairy please i want to see it!!!
OH MY GOD SOME POEPLE DONT EVEN CARE ABOUT FAIRYS AND THEY DONT BELIEVE IF YOU DONT BELIEVE THEN DONT MAKE PRANKS LIKE A SKELETON OF THE FAIRY AND I WISH THAT WOULDENT HAPPEN IN APRIL FOOLS I JUST WISH ALL I WANTED IS TO SEE A FAIRY AND FOUND A DISCOVERY ABOUT THE FAIRY WHAT HAPPENS SOME ONE FOUND THE FAKE FAIRY AND THEY BROUGHT IT TO DESCOVERY CHANNAL AND NOW THEY FOUND OUT IT WAS FAKE THEN A MEN OR A WOMEN THEY WILL CRY! CRY! CRY! SOME ONE WAS TRYING TO FINE A FAIRY FOR YEARS I DONTK NOW WHO BUT SOME ONE MIGHT DO IT FOR YEARS NOW AND I FEEL VERRY SAD RIGHT NOW SO STOP RIGHT NOW SO YOU WILL FINELY KNOW IT WAS REAL! GOT IT!?
MARIE WHY ARE YOU YELLING? Take an exlax and relax!
wooooow i cant belive it i really do belive in Faries and i love them!!!!
I LOVE FAIRIES AND WELL ME AND MY FRIEND ARE MAKING A HOUSE FOR THEM AND A PROGECT!!!!!!!!!!!!!
Fairies don’t live in the Projects, yo!
Why not, Rain? Fairies are equal opportunity!
This is true, but as Fairies live in a monarchy, they rely on the King to provide housing, which he does in the form of barrows, etc. Low-rent, low-rise, these are not part of the Fairy dwelling experience.
The wings are leaves! O.o
Not at all; as you can see in the renowned Flower Fairy books, many fairies have somewhat leafy- or blossomy-looking wings. It’s the most natural thing in the world.
okay so here it goes.fairies are like angels rite? if so i beleive. yet the picture is alittle skechy.i can’ say it’s fake nor real.the body looks real……but the wings don’t look real. anything is possible.well…..almost everything
Anything except Tom Cruise being straight.
I CANT CALM DOWN BECAUSE EVERYONE ALWAYS MAKES PRANKS ABOUT FAIRYS! :’(
IM GOING TO SEARCH ONE FAIRY IS REAL! I HATE FAKE FAIRY FOR PRANKS THATS NOT FARE!!!! IM GOING TO SEARCH ONE ONES AND FOR ALL!!!!! IM NOT GOING TO GIVE UP I WANT TO SEE A FAIRY SO MUCH AND IM GOING TO FINED IT AND IM GOING TO TELL THE DESCOVERY CHANNAL!!!!!!!!
Everyone? Always? That doesn’t leave much time for running the Vast Right-Wing Conspiracy, does it?
hahaha…..no, it doesn’t
i guess
if fairies dnt exist (which they do!!!!) then why years ago before camera trickery did those two little girls get pics of those fairies? and yes they admitted some of them were fake but thy also said that some were real and photography analysists studied those photographs and said the wings in them were moving how did two little girls who had never picked up a camera before manage to do that? also people believe in god so what so wrong bout believing in fairies, unicorns and such like? i dont believe in god but i dont go critcising everyone, i dont get everyones big problem. FAIRIES EXIST GET OVER IT!
ps i believe in fairies and i’m clapping for them!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
People believed Liberace was straight, too.
Why are you clapping for them?
People clapped for Liberace, too. It was a more innocent time.
Innocent of standards.
yea somewhat.have you guys seen that new pic of another claimed fairy shot on that new place?
I have two dead fairies on this blog: one mummified, one fossilized. Have you got a link to the one you’re talking about?
If its kept secret then how do you know about it?>
Nothing can be hidden from raincoaster!
Oh good grief, Liberace was a fairy??
No I can’t believe that, fairies have some taste and use magic and pixie dust rather than plastic surgery and rhinestones.
I think all the flesh they cut off Liberace was made into Bobby Crush but away from the host it withered and died.
See? Nobody clapped :-(
i was clapping to keep all the fairies alive that a lot of u are killing by saying you don’t believe in them when given all the evidence they so obviously do
still clapping!!
and anyone that doesn’t believe in them is either too old to be with it anymore or a complete and utter reject that has nothing better to do with their time than sit and play computer games day in day out.
I agree Pixie dust, you keep clapping!
er.. what happens if you’re an utter reject and too old to be with it but you still believe in fairies? Get sectioned, drugged and put in a home I guess.
no i don’t have the link sorry
What have computer games got to do with anything?!
Quite so. And fairies, being immortal, are the least inclined to the bigotry of ageism.
UP THERE IS MY AUNTS EMAIL.ANYWAY….I CANT BELIVE MY EYES.IHAVE ALWAYS WONDERED IF FAIRIES WERE REAL.AND IF THEY ARE ALWAYS ALIVE HOW WILL THEY SERVIVE IN WINTER?I HAVE ALWAYS WANTED TO SEE A FAIRY SINCE I WAS SIX I AM 10 KNOW AND IN FORTH GRADE,DIRTY BLONDE HAIR,CHEEK BONES,GREEN EYES,4FT9,AND IWEIGH 90.
I NEED TO SEE A REAL LIVE FAIRIEY.1/15/O8
HOW COME THOOSE PEOPLE DONT BELIVE IN FARIES?
BECAUSE YOU USE ALL CAPS! ITS YOAR FOLT!
And everyone knows there’s no such thing as a “fairiey” duh. It’s “Fairy” yo!
ITS FAKE AND I HATE FAIRIES AND THER BETTER OFF DEAD.
RAINCOOSTER YOU ARE STUPID AND YOU DONT KNOW HOW TO SOELL.
PIXIE DUST GET IN YOUR HEAD ITS A FAKE AND I DO HAVE BETTER THINGS TO DO THEN SIT ALL DAY UNLIKE YOU GET REAL ITS A FREEKING FAKE FAIRIES ARE FAKE IF I SEE ONE FLYING AROUND THEN I AGREE UNTILL THEN ITS A FAKE, THEN AGIN I MIGHT JUST HIT IT WITH MY SHOE.
RAIN COASTER I MEANT SPELL…….HELLO
KILL TINK
STUPID COUSIN JOSH TINK IS BADBUT………..
TINK SUCKS SO HARD SHE A TINK FAN BOOOO
TINK SUCHS ANDROCKS
MY COUSIN IS GAY SHE LIKES TINK BUT SHE SUCK ASS ILL KILL HER IF SHE WAS REAL BRB GOT TO KILL LITTLE COUSIN
I SUCK
JOSH SLEEPS WITH A DOG
JOSH HAS A CRUSH ON FERGIE
NAAAAA SHE JUST FINE AND THATS IT BUT REANNA LIKE BRITANY AND WANTS TO BE LIKE HER NO JOKE HOW LAME
BRITTT I DO NOT YOU LIKE HER.
BS YOU KNOW HAOW MANE KIDS SHE HAD ILL PASS.
JOSH IS SO COOL HES MY HERO
He’s exactly the same person as you. The tech never lies, dumbass.
Her Grace the Marchionesse of W etc
Your Grace
SECOND BLAST OF THE TRUMPET AGAINST THE MONSTROUS REGIMENT OF WOMEN
When the Electoral Commission has finished exonerating that terriblY nice Youthful Peter Hain, perhaps the Commission will have leisure & resources to investigate this Mummified Fairy and give her a Clean Bill of Health, as well
Colonials/exColonials will struggle to understand or even care at all about the Kindly exRugby disrupter, who has now achieved true meaning in Life & Respectability by becoming a Minister of the Crown
The tragedy is less that on this occasion young Cephas has quite unCharacteristically shewn a certain “je ne sais quoi” in returning his Election Expenses, while focusing on making the UK Work & Pensions Dept the envy of those US Citizens unable to afford Health Care insurance
After all, the UK Cabinet is full of curiously-insightful Ladies (eg Mrs Derek Gadd, Mrs David Hill etc etc) on the basis of their Membership of the Monstrous Regiment of Women
* A Gentle-Eagle of course does not comment on Ladies’ looks or brains or how this qualifies them for high Political Office
Pete’s real sadness is that (as observed at the heroic Mr Guido Fawkes’s place) Pete spent £100,000 (or was it US$400,000 +) but he could only achieve 5th Place in the Election of Labour Deputy-Fuehrer, behind the Winner Mrs Jack Dromey
I flatter myself that I agree on so many things with the Lady ApilihP (while understanding neither the incisive Lady OttelitS nor that distinguished Equine Mr KStafford), but Pete indeed has alternatives to “Get[ting] sectioned, drugged and put in a home”, if (contrary to expectation) Mr Brown shews enough decisiveness to teach Pete that Political Life can be “solitary brutish nasty and short”
Pete could study for an Open University degree in Fairies … or the UK could appoint to join Mr Mendelsohn as a European Commissioner
Yr Grace’s obedt servant etc
GE
I’m not quite sure I follow the “Peter Hain is a crook, therefore blame the women” thing. I mean, it’s not as if THAT got by on its looks!
http://icanhascheezburger.files.wordpress.com/2008/01/funny-pictures-glowing-cat-tinkerbell.jpg
I love how the “JOSH” banter ceased after you outed him publicly. Buy why, I must ask? Surely he could’ve debated further whether he fornicates with canines? I mean….at least for our amusement, right?
As for the fairy…The first photo must be the famed “mid-masturbation” shot I’ve heard so much about. :)
In the second pic it looks like they are about to roll him into, well you know. Dude, there’s even stems and seeds on the paper behind him!
I simply assume that ALL people who use all caps exclusively fuck dogs…or are fucked by them!
and yes, I wonder how high you get if you lace your doobie with pixie dust!
hahahahahahhaha! XD
paper mache and leaves and we have ourselves breaking news!
UNBEELEEVAR!
Your Grace
I THINK … err …. i think for your german readers, your grace means unGlaeuber … or is that unGlaublicher …..
and, in a philosophy exam, as for WHY – why not or why not what
es macht man denken, nee
das ist es doch
yr grace’s obedient servant etc
ge
Our German readers? BOTH of them? You’ll spoil the lads!
As for the philosophy question: define “why.”
Ok, no offence to anyone who thinks it’s real but… if it was really a mummified faery, why has it still got {pretty clean looking for a faery thats been mummified} hair?
I’m really not trying to ruin anyones ideas on faery existance or anything but it sorta confuses me… Blessed Be! x
Salena,
You are obviously painfully unaware of the advancements in fairy hair products over the last decade. They’ve got some wonderfully balancing shampoos and some conditioners that are to die for. We are, after all, talking about a “fairy.” Should we not expect it’s hair to be perfectly groomed? You don’t know many fairies, do you? You should probably get out more.
We believe in fairies its said that every time a child says i dont believe in fairies a fairy somewhere drops down dead they are just little helpers of the earth
well said, JTK – people like Salena should be ashamed of themselves. They have fairy blood on their hands thanks to their repeated denials.
How many fairies must die, Salena? How many??
476
Gut gesagt, MeinPferd – Wieviel, doch, Wieviel
[well said, mine Equine, how many indeed]
We all know why the Britisch economy is in a mess – all these Monstrous Women like Mrs Jack Dromey & Mrs Derek Gadd running the Government & criminalising Catholic Adoption Agencies – and not voting for that nice Cephas Hain as Deputy Leader of the Party
Now that they’re all losing their Jobs at Northern Rock, it’s not wonder that so many Fairies have fled to Canada and taken to drinking Monsieur Metro’s ethylene-glycol-based-antifreeze
Das ist es, doch
Es macht man denken, nee
[This is it, init,
It makes yer fink, dunnit]
wait this explains it! lot of poeple dont believe in them so all the fairys die some poeple or lot of poeple do believe they can see 1 fairy this explains it of course!! :O
Stumbled over a Canadian group who were obviously fairy motivated.
Yup, we miss you dudes.
Herr Eagle – I don’t know how you could think there might be fairy related individuals in the cabinet – perish the thought!
That’s why I can’t keep any booze around here. It’s the fairies! I bet they drank all Metro’s vodka, too!
this is super scary!! :]
Yes, the unsbashed fairy slaughter that Salena is condoning is extremely frightening.
Indeed. As is the fact that they’re drinking all my booze!
The Faerie kingdom is alive and well, if people can believe in miracles, why can’t I believe in Faeries?
Keep the Faery Dream Alive.
Woo, Australia.
Aren’t the “godless heathens” the people that normally wouldn’t be so skeptical of something like this. It seems to me that a devout religious person would be the more likely party to question the validity of this “fairy”, mainly because we know of these creatures from FAIRY TALES, not religious texts.
Ah but the very religious know that their truth is the only truth.
And if you’re a Muslim they definately don’t believe in fairies! I think they have another name for them.
oh i wish faeries were real but… :C too bad… :C:C:C:C:C:C:C:C:C:C:C:C:C:C:C:C
so i dont really care what that dude who “made” the dead fairy carcass says, even if its real or not, fairies are DEFINATLY real! They are either real in my imagination or really real in this world! I have yet to see one but who cares! I’m going to have fun believing and if they are real then thats one less dead one because i believe, i always have and i always will! I sat here and read ALL of these comments, and i like the theory that they could be some form of angels…who knows…but when people says God didn’t mention them in the Bible, you are right, but did he mention every type of crazy aquatic creature either? I don’t recall, and even though we are the only ones who were made in his image fairies are not in any way human like! =] so thank you, they are real =]
<3 Cally
Well, SOMEBODY is drinking all my gin, that I know for sure!
I hope what’s in my imagination isn’t real or I really had sex with… I need more gin.
Who? Paul Reubens?
Good painter he was, don’t think he was a fairy though. Maybe he got the fairies to paint for him – he probably hid the gin.
Philipa, are you sleeping with a Muslim dipsomaniac painter? Do tell all!
I have always wanted to be a fairy!!!!!!!!! :) Lol!
Well you still may have the chance, if you live near San Francisco.
Good grief no! I would never sleep with a muslim, you have to marry the bastards first – I’ve only ever slept with bastards I could get rid of.
(for those who think that a racist remark let me assure you that in my experience all men are bastards, regardless of their ethnicity or religious practice)
Never slept with a fairy though..
..at least I don’t think I have.
@Philipa – so you are quite comfortable making blatantly sexist comments? Yet you are defensive about making blatantly racist comments. When are you going to begin making blatantly specieist comments and start putting down Fairies?
Fairy-hater! You are oppressing our dreams!
Oh goody – this can now move in a new direction!
I think this shitts bad ass dude I would if faeries were real as long as they werent hurt & they werent skankishly dressed lol…probably impossible…I WANNA BE A FAERIE!!.or be a draenei from world of warcraft
Her Grace La Marchionnesse de WitchHampton under Buzzard etc
Your Grace
AerChie hat recht [A. hits the targets yet again]
Doomed – We’re all doomed
498 … Yes – another thread record must be transmogrified
Ducks …. and ever more Qwacking Ducks are coming home to roost, as Gordon Bruin’s Weputation for Economic Pwudence & pwomoting Monstrous (lightweight) Ladies gets ever stranger
…. and ex America semper aliquid novi [always something bizarre from the Land beyond the Rim of the Known World] – oor Hilary gets ever closer to the generous Trough at 1600 Pennsylvania Avenue
In the Best of Colonies, large Animals face the twin threats of Specie-ism und Size-ism, when SMALL (… err … small) predators like Falcons & Beavers get the best posts from the SreggolB most distinguished
AND what about the Workers, including that puir Mesonychoteuthis hamiltoni ending in the forced accommodation of a Giant Kiwi Fridge en route to Japanese Kalimari Dishes with Sliced Whale slivers
Doomed – bring on the Hoses, save the Panda
I have the honour (… ummm … honor) to remain your Grace’s obedient servant etc
G Eagle
ArchieArchive – you are correct; I have no conscience making sexist remarks, indeed I consider it a sport. In fact I guess many men would agree with me – with regard to the opposite sex let us sport while we may.
Gin helps.
Apparently the fairies keep drinking the gin :-/
Sushi – what language are you communicating in, pray?
I speak Eagle. Save the panda.
(never eaten Panda)
It’s not racist: it’s religiousist!
Sushi/Chelsea, you can’t be a fairy until you pick ONE name.
Philipa, pandas are buddhist. Would you eat a buddhist on a first date?
DING! 500!!!!!
@Philipa, I also enjoy making sexist comments but I’m not really sexist, I just like to poke fun at lesser mortals – - -
@His Greyness, the flighty one, How will the hoses stop the Tory promoted globular warning?
@Rain, Pandas are delicious in a white wine sauce.
Gin is but a fading memory. Along with Port and Chardonny. Living in a dry community can be HELL!
(Let’s aim at 600)
Raincoaster – I wouldn’t eat anyone on a first date, nor the second. Ok I might have a nibble on the second.
Hee hee, Archie – you like to poke lesser mortals?
raincoaster Dec 20 at 6:06 am “… with all porridge-related medical conditions, it’s best to give them 48 hours to solve themselves before bringing in the hoses”
Bonjour, Herr AerChie
I dinnae ken how HOSES will save the Planet – but her Grace has revealed their efficacy for (among other illnesses) Persistent EdgirroP-itis
C’est tout tragique for such a young man to have run out of White Port – no wonder the Colonies are succumbing to Labour … peut-etre that puir wee Faerie succumbed to a stroke induced by high blood-pressure upon witnessing the last-surviving White Port flagon passing from left to right
Alles Gute
G Eagle
Oh, BTW, in your Place, everyone will enjoy your Shark-Embracing non-Buddhist Oktopus …. but Is it wise or prudent to poke the Lady ApilihP – she may turn her last Tree-Oktopus on you …. unless of course she’s already fed it to some random Buddhist ….
I never touched that random buddhist – I was framed!
fake o.o*
No, I assure you Philipa is entirely real. If she says she didn’t eat the random buddhist, she didn’t eat him and that’s that.
@Philipa, most of those lesser mortals I poke tend to laugh – so I guess they find it funny – umm – is that what I meant to say? btw, I am not a random Buddhist – I am just random
Is this poking a sneaky way to tenderize them?
Perhaps this poor fairy was poked to death! It’s all Facebook’s fault!
@Herr G Eagle, I find oat pudding to be quite a worthy meal – unlike the fowl feuds eaten by the Sassenachs
Which reminds me to do that Offal Shame banned haggis post.
Offal Shame – - – grrrrrr
Please do – Pipe him in – my blog needs a stolen haggis – - -
btw, I poked Philipa and now she is speechless!
elves and fairys are real!
Well of course they are Patrick.
Archie keeps poking me to see if I’m done but that’ll never happen if he doesn’t turn me over!
Haggis, banned?? Yes that is an offal shame.
Should I tell Buff you’re poking each other?
Offal Shame? That is no way to speak of the great chieftain o’ the puddin’ race – - -
Turns Philipa over
I loved the one boobie limerick Archie – they don’t make ‘em like that any more.
Am I done yet cause I think I need basting..
Get. A. Room.
This is a fuckin’ KID’S THREAD YOU TWO! Goddam!
Fairies are not just for kids!
Are you saying you’re pan-sexual now? Make up your mind, man!
I’ll explain after the children have gone to bed – - -
Um… how kids are made?
Sorry Raincoaster, obviously the fairies bring them *hangs head in shame*
Pan-sexual eh Archie? How are the lost boys??
That’s so funny, because when I was little my parents always thought fairies were trying to take us away. We live in a more enlightened time now, obviously.
@Philipa, those boys are totally lost! The “Pan” part of the description is quite correct – Nymph chaser by nature, cloven-footed Capricornian by birth – - -
Have some Madeira, M’Dear
@Rain, Many an old wive’s tale contains unexpected truth!
Raincoaster, I’m crying with laughter, this thread rocks :-D
Rocking fairies? Pride week isn’t till August!
i dont believe in fairies
OMG, does anyone else hear that tiny, distant funeral march?
Sucks to be you, bethany. I dare you to challenge the existence of fairies after seeing this definitive proof. This will blow your mind.
What say you? Shall you continue to deny in the face of prof?!?!?!?!?!
(oh gawd, rain….this is soooo much fun!)
err….”proof” :)
One more for ya! :)
Ah, yes. PeterPan. His site had three point five million hits the last time I saw it, and he had just proposed to his “Tink.” At first I laughed at him, but after some reading I’ve actually developed a real respect for the guy. He just loves being this persona, and he means all that pixie peace stuff just the way Oprah means her spiel. He’s a sweet, crazy guy and I admire him for being so public and for accepting that award in the way that he did (google it; I’m too lazy to find the link). Respect.
Well maybe, but I’m afraid I couldn’t last out the full vid experience – only in America.
I’m a cynical Brit, what can I say? We have people here who live the Elvis experience – knock yourself out (as long as I don’t have to join in).
Cynical Brits abound – wait, that makes you sound like a Kangaroo – - – (Kangaroo Tail is quite popular with the locals out here in the desert)
Yes, Rain, I am going to my room!
Non, je ne regrette rien, – Sorry, listening to the Little Sparrow – a definite fairy person.
Whenever anyone mentions a kangaroo I remember a little ditty taught to me by a reprobate some time ago that starts.. Tie me kangaroo down sport, tie me kangaroo down (shag a wallaby).. and it goes on.
I’ll spare you the rest, the fairies have probably been at the gin and you’ll only get grumpy, Raincoaster.
BTW, how is Snow White, still in rehab?
Do they abound as well as the Four Hopping Ninjas of the Apocalypse? OMG, are they BRITISH??????
So many are British somewhere along the line, we used to rule the world you know..
..and we have a Time Lord.
He’s not British; he’s Galliffreyan, duh. I well remember his conversation with The Brigadier in which the B said, “It’ll have to be one of us, you know, we can’t trust the rest,” and the Doctor paused a moment, smiled craftily and said, “Well, naturally not. The rest are all foreigners!” to which the Brigadier nodded before he caught himself.
Well slap my bottom and call me baby, you’re right!
Of course.
A smug Cephlapod is so.. other-worldly.
Cthulhu is not in the least smug; he’s simply ravenous for souls. You’re projecting.
HOLLY SHAZ!!!!
That’s amazing!!
I believe!!! *bows*
Welcome. Spread the word. The Fairies depend on you.
“Well slap my bottom and call me baby”
I was going to until I realised the children were not in bed. Rain is already annoyed at me for corrupting the miners – well, actually they were already corrupt but no one talks about it.
Archie – blame Thatcher, everyone does.
Not without good reason.
I really think this fairy is real so dont forget to name her thinkerbell
That’s a mighty fine name, given all the thoughts she’s inspired.
I can’t blame the thatcher – my roof is tiled! I have no idea what is causing the wet spots.
Cute!
Archie, I would reply to that, but I have far too much innate dignity.
Your Grace
THE 2ND BLAST OF THE TRUMPET AGST THE MONSTROUS REGIMENT OF WOMEN THATCHERS
Ich weiss nicht,was soll es bedeuten,
das ich so traurig bin
I don’t understand what the talented Anti-Soviet Deviationist Aerchie-Dude is saying
ABER (err … but …)
Methinks he doth protest too much
There is NO RAIN in the Western Anti=Podes, wherein resides such an incisive & entertaining Promoter of Human=Menacing Pseudo-Animals (Drop-Bears, Desert-Sharks, Tree OktoPodia & the Wild Antipodean Rudd-Creature etc)
ERGO the holes in his roof cannot pScientifically afford the explanation of the Wet Spots on his Floor
… nor can it be spilling White Port over the Cigars after the retirement of the Ladies – ALL the White Port in his Desert has apparently been consumed in a (SCHOCKINGLY) anit-Clockwise direction
WHENCE, as a more felicitous alternative to Mummification, so many UK Fairies have selected Metro-Land as a Target to emigrate to, instead of Van Diemen’s Land
Yr Grace’s obedt servant etc
G E
PS No Kangaroos were hurt or injured in the making of this Post – can the AerChie=Dude give us a similar assurance over his comments
Perhaps those pussy-eating dragons have bitten off more than they can chew? And a large, invisible, and very, very satisfied Persian cat rests atop Archie’s house?
Errrr … your Grace – it’s CHESHIRE cats who become invisible
…. but I rather apprehend that Pussy-Munching Dragons predate away from the Western Desert to avoid the witty taunts of the egregious Archie-dude [Homo Sapientissimus AerchiDudius Ferox et Lepidus]….
…. has anyone warned them about the perils of sampling M Metro’s ethylene-glycol-based-antifreeze saucer-offerings
Er.. Hang on, Archie has a Pussy-Munching Dragon or Achie is a Pussy-Munching Dragon?
I’m so sorry, I’m confused Mr Eagle, Sir.
and who’s the homo-sissy fox?
I thought raincoaster was a fox..
and the fairy was dead (or if you’re in Alabama, deyad)
and archie was downunder…. !
SRRY DONT BELIVE THAT
No, it’s true, Raincoaster is a fox!
(I’ve seen the pictures)
And that fairy is definately dead.
It’s an ex fairy.
Archie is being haunted by a gigantic Cheshire/Persian cross?
That explains so much.
I’m not a fox. But I’m not a chick either.
Philipa: who did Archie go downunder on?
Tch! Tch! One does not go down under on. One simply goes down under. And I never name names – except to ET – - –
I am terrified of cross Cheshire Persians. So is my inner dragon.
But…
Why is your roof wet?
Jawohl
WARUM ist das Dach [roof] des AerChies NASS [vet] – in a DESERT
und HOW MUCH is it his Inner-Dragon causing Global Warming in the AntiPodes, with the consequent flight of Fairies to the COOLER Environs of MetroLandia, with its high-class cooking even if gin & high-class beer supplies are being consumed
I cannot tell – the children are not yet in bed, the fairies are listening and they tattle to Father Christmas so I wouldn’t get ant pressies – not a single gift-wrapped pussie, siamese, persian or even manx (although they do not have a tail).
Now, have I changed the subject sufficiently?
@the nonumlauted MeinHerren GrEagLe, It is true my roof is quite dry for this is a desert. Yet the assumption that it was my roof which is wet was incorrect – the wet spots are lower! Possibly due to the excessive consumption of gin (and in its absence, absinthe). Why, last even I noticed the Port, of a sufficiently Ruby hue, being passed to the starboard. I was forced to leave the room in shock! That such ungentlemanly conduct could be tolerated in these climes where every touch of the true civilisation must be kept and celebrated. I fear there could be a stray Metrolandian masquerading as a gentleman.
Sorry Raincoaster – in that piccy of you in a bedsheet I was sure I detected a bushy tail, my mistake.
Ah Absinthe – I hhave pahssed ohhhceans hov tihme to see youh; my favourite bad movie.
Archie you’ve changed the subject… back to your wet spots!? Modesty forbids me to comment further on this subject.
Ahh Philipa, I do apologise for accidentally including you in the discussion of wet spots. May I say categorically to the assembled multitudes that we are just good friends!
There, that should clear your name and restore your reputation – - -
Archie: you get ant pressies? Are you an ant?
If they never pass the port to starboard, remind me never to book a starboard cabin. It would be such a pain, having to go to the bar for it!
That ant’s a mistake, emmet!
Archie, well if you’re going to be like that!! :-|
Look, I’m sorry but it’s been at least ooh 20 minutes and there has been no…. well.
I don’t know why I shouldn’t be included in a thread concerning DIY (I live alone) or wet spots (I didn’t always live alone yet have now steeled myself to the reality of DIY and have purchased tools), however, i don’t thatch,
but would quite like to be a fairy..
having done the dragon thing.
“It’s been at least twenty minutes – ”
I’m sorry I rolled over and went to sleep. I was quite exhausted. From so much thatching.
Fairies are nice enough but for genuine excitement you can’t beat a dragon!
Archie, you’ve obviously never worked in the fashion industry.
Actually, Aerchie, anyone who chooses to beat a dragon will find the brief remainder of their life filled with a great degree of excitement.
Beating fairies can, so Raincoaster assures me, be fun, but is apparently less interesting.
Oh, and “thatch” is a rather crude metaphor, no? Why not simply go with the rolling granduer of “toupée”?
How about “merkin?”
@Metro, The Toupee has been trumped!
@Rain, there are too many merkins just south of your land border!
Can’t argue with that!
Damn, I guess that kills this thread – - -
I like to beat my dragon several times a week. I usually end up with that same “final expression of Tutankhamen” look on my face that you see in the first fairy picture.
Mein Pferd Stafford
It restores our faith in Equinity that it is a distinguished & witty Cavallo that keeps alive this thread, unlike the Fairy who maintenant is si tragiquement “late”
But perhaps beating dragons was nae the raison for the Prince’s unhappy death-grimace
… there may be une autre explanation pour le mort del Prince Tooting-Common – it may have been the prospekt of oor Hilary moving in to 1600 Pennsylvania Avenue
… but peut etre it was the terror induced by completing a US Internal Revenue Service Tax Return
It makes yer fink, dunnit
GE
that is sooo not real its probably this artificial plastis head whats next ?? peter pn ?? lol …
I agree that King Tut would prefer Obama, if only to have a relative on the throne again.
#’s, I can state for the record that neither the fairy’s, nor G. Eagle’s heads are plastic.
While the Eagle may not have a plastic head, I feel sure that, as an espouser of Republican causes and a denouncer of the abilities of the distaff side, his head my not be filled with much at all. He allows his natural raptorness to take over when discussing the defenceless. Rather than dropping bombs, it may be necessary to export some Desert Sharks to Slough. Providing the Mars factory is protected.
That’s so important. Good to see we are as of one mind in setting priorities.
We need to do some research into the amount of plastic in Philipa’s head – I think it may be melting at the moment. And I should send her my patented anti-desert shark talisman.
OMG!
is dead,’
She’s pro-Tory, so no doubt she’s experiencing a bit of a meltdown at the moment.
felicia, you’re dead? Whoa, cool. What’s it like on The Other Side?
I don’t believe you just told me P is a Tory Pro! Or was something missed in the translation?
And felicia is such a Goth!
This must be Canadian speak, something we Americans have been trying to decipher for a long time.
Well hey Americans have been trying to decipher the English language ‘for a long time’ and they haven’t managed it yet.
Archie – there is no plastic in my head thankyou, I decided against that operation; sorry to disappoint – do you prefer women plastically enhanced? Raincoaster is right; I’d really rather discuss politics just now. Given my aversion to plastic and the current Tory leader :-/
..he’s no angel but he’s no fairy either.
Felicia – is anybody there??
Weird….just saw Stiletto’s commment. I basically said the same thing in the forums yesterday. Yes people, fairies exist in more places than you imagine.
Philipa, was that a rhetorical question? :)
He’s no angel, he’s no fairy, but he IS a Ken doll. I bet he stole those kids from Britney’s family; they drop them like dingleberries in the Spears clan, they’d never miss a couple more. And apparently Britney’s got an English accent… hmm, where’d she pick THAT up?
Not a rhetorical question no, if felicia is dead and able to blog then I’ve a few questions..
maybe the first one would be to Raincoaster as she’s the tech expert – how would you ping a dead person?
Raincoaster – I should have said: ‘Raincoaster is right; I’d really rather NOT discuss politics just now’; with the exception of the fabulous Bozmeister I don’t think much of the rest and the Daily Bellylaugh just isn’t funny any more, I wouldn’t use it to wrap my chips.
Fairies are everywhere? So that is where all the socks go, one of every colour and pattern, just one.
How do you ping a dead person? Easy: use the black Pingoat of the woods with a thousand young.
Vicus has been having some fun with Boris over on his blog lately. Lovely pictures.
Socks, of course, go through the wormhole generated by the vortex of heat and energy in the dryer. I thought everyone knew that.
Not so. Socks make fine faerie sleeping bags. Just don’t ask where they get their MacIntoshes.
Ha ha, excellent!
Metro still has it.
He should probably give it back but hey…
The Ha! the Lady ApilihP says. Well, this is certainly unusual to say the least. I think you might be on to something here. So, I say Ha!
119 x 5 …. Ha !!
and BTW – where do Fairies get their MacKintoshes from
Alas, puir wee EglAE, I knew him well.
Are you in pain, old friend?
For schurely only an illness of most grievous nature could cause such a vandalism of the Queen’s English.
A preposition is nothing to end a sentence with.
Quite so.
I think they get them from the Trojans, don’t they?
WOW YOU GUYS ARE SO REATARDED THATS SOOOOOOOO FAKE!!!!!!!!!!!!
YOU PEOPLE NEED TO GET A LIFE YOU SMOKE TO MUCH CRACK
And yet, somehow we’re capable of turning on/off the “caps lock” feature on our keyboards. It’s a fine line between ability and disability indeed.
And for the record, how much is “too much” crack? Is there an okay amount? Can you get some for me? What about for the fairies? They threatened me with harm if I could not produce more crack.
That kid is “TO REATARDED” for words.
PS 600 Comments! YAY! < — see, now that is a legitimate use of all caps.
I wonder what my contribution has been? I’m just glad that someone is championing the cause that fairies existed, or existed. I’m ashamed that none of our political candidates have expressed their views on this matter.
I challenge anyone for proof that fairies do not exist.
(Mwwaahhahahahahahaha)
well, no better excuse for multiple postings than the common misspelling. “exist or existed” in the above. :)
kstaff, you had comment #600! Also about twenty-five others. An excellent showing for a latecomer to the thread!
I think that Mormon has definitely stated that fairies exist, and they should be illegal.
I think they are most definately illegal in the UK or they would have been taxed by now. Or maybe they have been made legal under this government – they brought in lots of airy-fairy laws.
I find that the secret of getting more crack and indeed more faries is to expose a big Bottom.
Oh, Philipa, you should HEAR the British Fairies I know complain about their taxes! “And all going to those fucking schools! Damn Breeders!”
I think you are right about attracting more crack. Or you could just hire plumbers.
I believe, upon reading, that faeries are actually attracted when the Bottom is actually concealed, rather than displaying large quantities of crack.
In some cases it seems to be acceptable if said Bottom is disguised as an ass.
However, I have also discovered why the faeries have abandoned the Albion Isles in favour of the Great White North: A sufficiency of fairies is often associated with the presence of a Puck.
Which explains so much about Junior A coaches.
Ah, you see! If you wrestle with a problem long enough all is revealed! The connection between Junior A hockey and the de-Fairification of Albion. Wordsworth would definitely whip up an ode over that!
Nothing wrong with a good Puck.
Or if you’re a fairy there’s nothing more attractive than a nice ass.
So I’m told.
Metro?
Raincoaster I think he already did as Fairies are not a new thing:
Fairy Land! Thee all men greet with joy; how few,
Whose souls take pride in freedom, virtue, fame,
Part from thee without pity dyed in shame:
But he may have been writing about Italy..(?)
I believe in fairies
@Pippa:
Of course I’m not a fairy. I’m a Metro-sexual. Also, not being a member of the Harperite party, I am not fossilized.
Though a nice Bottom always has my admiration; It’s always fun to play with a talented one … So I always consider that an asset. Or is that a miniature donkey? I forget.
However, as a thespian (yes, it’s true, I admit it!), I’m always up for a good Puck.
Philipa: no WAY did Metro write that! Don’t let him tell you otherwise.
Layla, keep the faith. Belief in the self is the foundation of action.
Metro is usually up for just about anything in my experience. It’s one of his best qualities.
A compliment?
You must have been dry for a few days now.
I was going to make a comment about fairies but I realised it would be off topic – - -
Metro: Days and days and days. It’s like dog years…an eternity, measured in shotglasses.
Fairies? What means this word “fairies?”
I have no idea, but someone called Peter (who refuses to grow up) seems to like them..
Metro I was always of the opinion you were a Metro-sexual and simply assumed you knew about these things, which obviously you do. I too like a nice Bottom and have enjoyed a good Puck in my time :-) Unlike you though I’m always in receipt and not the giver – ah you theatre folk!
Layla – you believe, therefore you are.. and have to defacate. (Hey, defacation happens!) I too believe in fairies. I don’t believe in Archie though – he’s just a happy thought.
Metro is very fond of a good Bottom, but methinks you don’t know as much about theatre folk as you claim if you think they’re all tops!
JUST a happy thought? Do you realise, young Lady P, just how much hard, grinding work there is in being happy? Fairies won’t talk to me, I’m becoming a world champion curmudgeon and Thor is aiming at me! Not that I have any sympathy for Rain. I have been drinkless since last year! Late last year, admittedly, and the drought breaks tomorrow night!
Metro deserves wings – that way he can be a flying Puck – - -
Canadians of Metro’s persuasion generally prefer buffalo wings. Try catching a flying buffalo some time!
Archie I’m sure you’re most accomplished at hard grinding and I’ve heard tell that sort of thing becomes more difficult as you get older so perhaps you should have a little rest and a drink, for medicinal purposes. I hope you have a relaxing flaccid drink-sodden tommorow night x
Raincoaster, once again you expose my naivite – I know bugger all about theatre folk.
You took the words right out of my mouth.
Be fair – this is about fairies, probably wearing Fairisle pullovers, fairly new ones, so a little fair play would be fairly well in order. Planning for the fairies fairisle fair is fairly well under way.
I need a drink!
Cripes! I wish you’d taken the words out of Archies mouth – is he quite well do you think?
Taken up knitting maybe..
I can see that knitting can be relaxing but I’d still rather have a good Puck with a nice Bottom thrown in for good measure. A good measure is important – hope you get one Archie x
Sobriety. Only you can prevent it.
Oh, I have a good measure – now I hope I get one – - -
I have no intention of preventing sobriety!
“Good,” Philipa–”Is he quite good, do you think?” Or are you asking something else?
I could also use a drink. This is by way of being a ground state for me. Everyone was born with a certain amount of natural alcohol in their bodies. I just happened to be born two drinks short and have been trying to catch up ever since.
Unfortunately, after a Raincoaster visit it takes quite a while to rebuild the supply chain.
As for good measures, well the women hereabouts say sex is like snow. To a certain extent, I share this view. In that while it’s happening, I never see any fairies about.
Measure for measure, I think it is rather good.
Well Metro, I believe Archie is accomplished at hard grinding but of course I have no knowledge of the state of his tools for that activity. I think he should take a good measure, certainly, he seems to be in want of one and I know just how he feels as I indulged in a glass myself this evening, for community.
As for good measures, well the women hereabouts say sex is like snow.
I agree, it never occurs in my neck of the woods! If I remember that far back it was just like snow – something you’ve often dreamed of but the reality is a disappointing wet mess. How do Fairies make little fairies I wonder? Raincoaster will know…
Measure for measure, my favourite Shakespeare sit-com.
U know faries are true.There are also mermaids too.
While measures are needed, I prefer taming the shrew – I once did the lighting for an amateur production of Kiss Me Kate which was Broadway’s version of the play. Wonderful fun even without a Bottom.
Sex with Metro is like snow? Cold and slushy? It falls from the sky (like the bolt of Tash)? Flakey?
I’ll have to take your word for it Raincoaster.
You lucky girl, you.
Flakey? Don’t people usually use some kind of lotion for that?
You obviously haven’t seen the advert of the girl in the bath.
Which unfortunately reminds me of David’s Marat.
The girl in the bath – ahhhhh – Chocolate – another Vitamin C!
Aparently chocolate mimics the effect of dopamine in the brain, I think – kinda simulates being in love, and is an aphrodisiac apparently.
Dunno about all that – it tastes yummy!
Unlike..
anyway, back to fairies..
ewww is that real?
Yup! Chocolate is real and sold in a store by you.
So fairies taste yummy? Now we know why they are almost extinct! It is time your wonderfully left-leaning leaders put fairycide on the law books!
Damn straight! Is it the Tories that are behind it? Oh my god! Thank god Boris has slimmed down; he’s obviously eating fewer fairies than he used to. I’ve always heard Tories had a fondness for fairies…
Raincoaster!!!
*pip is speechless*
Oh, they all went to boarding school. You know it’s true what they say.
Check out Guido’s blog for “Top Tory Totty” of the male and female variety. I’d venture to say that if the Tories were more equal-opportunity in the distribution of wealth they’d have had much more attractive men there. Some of those women are professionally “companionable” if you know what I mean.
Let’s get this straight, Rain. You are saying that fairies are alive, healthy and swarming in the Houses of Parliament?
Yes. They call them “researchers” and “Special Advisors.” Check out Guido’s blog!
Yes but I’m not comfortable with the belief that Boris has eaten any fairies.
I know, I’m English and conservative, pass the macaroons.
I, also, am skeptical of tales of Boris’ fairy-eating past. What is certain beyond the shadow of a doubt is that since declaring his candidacy for Mayor of London he has lost some weight, perhaps through a change of diet, and he has not been caught in embarrassing proximity to any researchers, fairy or not. There’s a long way to go till the election, though.
I will always wish Boris well but I hate the thought of him not being an MP and in the house of commons – he should be there IMHO.
The Mayoralty of London is but a brief interlude on his unstoppable rise to the top, I am sure. Hell, I wouldn’t be surprised to see him standing for EU president, his previous statements (including the book he signed for me) notwithstanding. One day he’ll be in Westminster again, opening Parliament with a crown on his head.
Her Grace La Marchionesse de W etc
Your Grace
Quelle Night=Mare
The Middle-East Peacemaker ANTONIO becomes Il Presidente dell’Europa (Viele Volker, Ein Reich, Ein Fuhrer, Kein UmLaut) on his triumphant path to Wealth und the repayment of his mega-Mortgage – assisted by Cruella’s modest fees for giving Charity after-dinner speeches in the AntiPodes und elsewhere
BUT to the admiring amazement of his Grandad (last Ottoman-Sultan’s Foreign Minister), one can hope for der Boz-Meister becoming Londinium’s Mayor, in place of Red Ken, on his way to becoming El Presidente dell’E…
BUT where will Ken go – does he have an alternative to replacing ANTONIO as The Middle-East Peacemaker
No wonder Derbyshire Fairies have either given up the Struggle for Life or emigrated to MetroLandia, notwithstanding the Local Fairy-Predators and the perils of drinking from M. Metro’s Garden-Saucers
Your Grace’s obedient servant etc
G Eagle [5x13x2x5]
Wot Herr Eagle said.
Antonio? *spit* ting!
DUde its obviously fake look at the wings their Leaves for gods sake. At least try harder… By the way he used doll hair the hair has no dna. However the bones may be made of pigeon or chicken bones. Or maybe wood.
How do you know the hair has no DNA? Where is your proof? One cannot make scientific postulates without backup evidence. Speculation is amateurish and unseemly.
G Eagle: [5×13x2×5]? I’m a blogger, dammit, not a theoretical mathematician!
Good FSM! Bob could be right!
Amazing that the insight of a mere (as I picture him) beardless stripling, somehow crippled or deformed in a way that makes manipulation of the caps lock key and basic spelling a laborious chore, could somehow seize upon a detail that has for six hundred previous comments completely eluded older and sometimes wiser heads.
Herr EaGle (Unumluated), “[5×13×2×5]” Would these be your co-ordinates in the Space Time continuum? By my calculations you should be able to see the vale of fairies from there. From Quentin Crisp (BBQ flavour) all the way to Oscar Willed.
@Metro! Sir, your blasphemous reference to the ungodly FSM has been noted. The IPU Star Chamber is watching you – - -
Archie, you’ve tasted the delights of Quentin Crisp? I always expected him to be more flowery…perhaps lavender, with top notes of verbena.
That may have been in his younger days. Since his cremation he is definitely BBQ flavoured.
Eew! You didn’t put it in your mouth Archie?
Eew :-P
Well – yes – but I didn’t inhale!
I think somehow he’d be rather delighted to have been snorted up like Keef’s dad.
Gross. Honestly the things a man will resort to when in the desert; if it’s not ‘forbidden love’ with animals it’s getting your mouth around a fairy.
What’s being ‘snorted up’?
No, don’t tell me, probably something revolting concerning mummified remains.
And all for the want of a real woman..
I really don’t think that the love of a good woman would have suited Quentin Crisp at all. He’d much prefer getting hoovered by some burly Australian.
Hmn good point. He never dusted, you know, didn’t believe in it.
Ladies, Quentin’s cremated remains were the original fairy dust – - -
A big-burly Australian? You mean like Mark “Jacko” Jackson?
Remember him from the Energizer commercials?
“The new energizah, it’s gonna surprise yah…Oi!!!”
No, I meant Archie. I think he’d be Quentin’s type, don’t you?
I prefer the young Steve Irwin, of course. Solid steel body and a distaste for clothing Those two traits go very, very well together.
Rejecting the love of old Crisp
And feeling for him not a wisp.
I much prefer tits
Not Pommy halfwits
And lovers who don’t have a lisp!
Well that pretty much rules out any Brits, eh?
I feel utterly rejected.
If you only spoke with a proper Australian accent…perhaps you could take enunciation lessons?
“pommy halfwits”? I don’t think any accent is going to overcome that prejudice!
Nope, I’m with you on this one Raincoaster: “I prefer the young Steve Irwin, of course. Solid steel body and a distaste for clothing Those two traits go very, very well together” – shame he’s gone :-(
…err …
[shifting awkwardly from one taloned foot to the next ... and back]
…. Perhaps your Grace means :
“AustrAAAlian”
Perhaps I do. The mental image of a youthful, skyclad Steve Irwin may have addled me for perhaps a second or two.
I think that God created everything for a reason, and maybe some poeple don’t beleive faries exist, but who are poeple to say what can exist, we only have one creater and his name is GOD, I strongly believe he created creatures we have not yet discover or found. I LOVE YOU ALEX
So is his name GOD or ALEX?
I want to know what a creater is…is it some kind of House Elf? A house elf named God Alex? Freaky.
‘House Elf?” So that’s what those bastards are!!!!
Creater sounds like a performance enhancing substance to me.
Maybe Steve Irwin was on it. If so, good stuff!
@ Philipa; not all Pommies are halfwits – some of them are wonderfully talented. Oscar Wilde, Noel Coward, Queen Victoria, Philipa, Keir Hardie and Gracie Fields. JK Rowlings almost makes it to the list while CS LEWIS and JRR Tolkien are definitely on it. As is Dawn French. A pity about Maggie the roof repairer.
I have left the desert and have returned to Perth. I watched the fairies holding up the wings all the way and they did a sterling job. Thank you Australian Flying Fairies.
Glad you’re home safe and well Archie, well done fairies, and yes, I agree with you, it’s such a shame Maggie the roof repairer is now too old to hold office – she’s just what this country needs right now :-)
Happy pointless ceremonial day y’all x
OSCAR WILDE WAS AN IRISHMAN, you antipodean barbarian!
Here are some Flying Fairies for ya:
Hee hee love the vid.
Raincoaster is right Archie – Wilde was indeed an Irishman.
And Errol Flynn was an Aussie, mate, crikey!
@ Philipa – GRRRRRR You are incorrigible! Does that mean you are insatiable as well?
@Rain, He may have been born a Mick but he was tried under Pommie Law! and Yes, I have so many barbs stuck in me I am a definite, fully qualified barbarian!
@Archie – I’ve yet to find a man that can stay the distance! (or stay in the room – please no-one tell me I’m scary again as I have no idea what ‘neebling means’ and you won’t tell me)
Well of course he was tried under English law – he was living in England at the time and taking a Lords son up the west-end farce, which was not only asking for trouble but against the law. Doh!
And I too am a Barbarian, I am NOT a Roman – Romani ite domum!! Bloody I-ties.
yes, the English were like the Americans, always putting their own laws where they’re not welcome.
Boris is a Roman,though, Philipa. I hear he goes Roman every night.
I won’t ask about neebling provided you don’t ask about farnarkling!
Volo comparare nonnulla tegumembra.
Raincoaster:
yes, the English were like the Americans, always putting their own laws where they’re not welcome.
um… you mean like their own country?? Hmn, terrible. And like the Americans??? I reject that comparison completely! The Americans would have been better off with us in charge but they would have the French..
If Boris in anything foreign Raincoaster, he’s a Turk.
And WTF does ‘neebling’ mean? You enjoy the torture, I can tell – may fairies raid your liquor cabinet.
@Archie, Age. Fac ut gaudeam.
‘neebling’ – I came, I saw, I googled, I got nothing meaningful :-/
I’m trying hard not to laugh – it scares the children.
That is the difference between those who come from Mars and thoose who come from Venus – I googled, I saw, I came – - -
Faries come all the way from Mars, and Venus? That’s a long damn way! Through vacuum, yet.
Hmmm. Maybe that explains all that “cosmic dust” stuff the scientists are always rabbiting on about.
Perhaps the fairy above was exhausted? Maybe it isn’t so much mummified as fried by the heat of entry.
I’m relatively sure England’s laws were unwelcome up the rectums of the greatest writers of the Victorian Age, every last of them.
I haven’t heard of Boris being in anything foreign: he prefers them home-grown.
Metro: so every time someone disbelieves in fairies, one falls to Earth as a meteorite, burning up as it falls? What a metaphor!
Isn’t it though? That’s why I get paid to write workplace safety crap I’m increasingly convinced no-one bothers to read.
Tell you what, you can use it free of charge. Though I retain copyright under fair use.
When have I ever used you fairly?
I like the “fried at the heat of entry” hypothesis. Perhaps we can combine that theory along with one of the theories of how water became so prevalent on Earth. The “ice comet” theory.
We’ll twist it around and make it an “ice fairy” hypothesis. Clearly biblical creatures travelling through space time were bombarding the surface of the planet. The ice debris they “cooked off” or left behind gave rise to our oceans and saturated our atmosphere with water vapor.
In due time a giant monolith appeared and taught man to crush skulls with bones. Years later Genesis would pay homage to this awakening by featuring the Kroft puppets in the video for “Land of Confusion.”
The rest, as they say, is history.
Good lord I’m random today! :)
By the way, has anyone thought of doing a “mummified lolfairy” picture?
Not as far as I know. Hint. Hint.
So, spaceships are made of snowballs? Honest to god, there’s a story about some would-be terrorists who trained in Canada and who were thinking about putting explosives inside of snowballs. I suppose they figured they’d need a getaway dogsled, too.
700!!
Git out! And me with no Champagne! Oh well, payday is tomorrow!
BLOG PARTY! BLOG PARTY!
Only 700 fairies? Lets hope they can recommence breeding and we can get their numbers up further. Forget the champagne, Fairies need toadstools. Special toadstools. With red dots on them!
You mean Red caps Archie? I’ve read they can be familiar, or was that A familiar.. no matter, 700 is enough for a breeding programme and they can be mischievous little breeders so I understand. There’s hope yet :-)
Don’t know about Hinkypunks though, I think they are in decline :-(
Oh yes. Redcaps. I seem to forget a lot of that stuff. Can’t imagine why. I believe I was in the 70′s but I can’t remember that, either. Just so long as I am not a Redshirt!
Oh Madam, I must regretfully decline as well.
Archie – Decline whom or what? A fairy?
Or decline generally??
I am in a general decline – like a hinkypunk – it is downhill all the way. [sob]
Senor KStaffordPferd
Well done – the Genesis Utube is so clever !!!
Yr obedt servt etc
G E
Those were puppets?
Some were puppets – I noticed the roof repairer made a live appearance – beer does wonders to the eyesight – I wonder if fairies drink beer. I hope they have better hangover cures that I do.
I think I need some of that beer.
I’m sorry, I drank it all myself. I didn’t even offer any toi the fairies but then they were nibbling on toadstooly things
Toadstoly things? Like in the attack of the Mushroom people?
Jawohl
Das ist es, doch
[This is it, i'n'it]
The Ha! you say. Well, this is certainly unusual to say the least. I think you might be on to something here. So, I say Ha!
@Aerchie:
The thing about the toadstools it that you’re not supposed to nibble them yourself before offering them around …
Among other things, it’ll cut down on the number of fairies you have to share your beer with. Or you could just keep a swatter handy.
Swotting Fairies? Why? Are they at Hogwarts?
Hey, we are being lax here people! This post has slipped to #3 in Rain’s list! The Fairies will not be impressed!
uh oh. There she is. I was wondering why i wasnt finding quarters under my pillow…
in exchange for all my teeth.
Blame the coefficient of friction of the atmosphere.
I mean, the US government is talking about shooting down some soi-disant “spy satellite” orbiting above us, but we know what’s really up there.
Thwarted in his ambition to organize a Glorious Democratic War in Iran as he did in Iraq, George the Lesser is striking at the heart of Queen Mab’s territory.
I wouldn’t want to be him. I heard they’re building the library on a fairy hill. And we all know he can’t stand fairies.
Yeah, as if the George Dubya Bush presidential library would be too big to be picked up and moved to another location.
Place’d be about the size of a phone booth and would contain nothing but Archie comics and books with chewable cardboard covers. Oh, and a few Sears catalogues with suspiciously worn lingerie sections.
Of course they’d need to keep the collection small, to allow room for the toilet and sink.
Good heavens, Metro. What does that have to do with fairies? Are you implying something? And on President’s Day, too.
What did the President have on sale from President’s Choice today?
Pretzels, one can only hope.
Will this new Presidential Library have lots of coloured pencils so that the visitors can colour in all the pretty pictures in all the books?
The fairy thread has stalled – FFS clap someone, quick!
Of course that should have read clap, someone, quick – I wasn’t suggesting… well, anyway.
I do believe in fairies,
I do I do I do believe in fairies,
I do ;;-)
Raincoaster – I saw this and thought of you – I thought the spiders looked very beautiful.
Philipa, Archie does NOT have the clap. Shame on you.
“I saw these sea spiders and thought of you” awwwww. Words to warm the frosty cockles of my heart. I hadn’t seen the video, but I did read the article. Thanks!
I meant it in a nice way :-) and as for Archie, well I have had this rash since…
well anyway, he’s back home and I’m turning to fairies again :-(
You live in England, where there are always fairies all around you.
@philipa, I thought I told you not to be rash! I have crayfish, not crabs!
Archie you’re getting wierd now, crayfish? I think you should embrace a fairy immediately and let them work their magic on you..
He’d only end up giving the fairy crayfish too.
There are fairy crayfish? I didn’t know that!
Well, maybe only 10% of crayfish.
They have the freaking thing in a lab! and these people who are trying to find out if its true or fake are pro!i mean thik what you think but this looks too real for me.Also ( in a lab )!
WTF is a dead fairy doing in a labrador?
I think he should be told off and sent for dog training immediately.
Not only the fairy is in the lab. The OP is in there as well – bloody big dog if you ask me! I wonder if it is part fairy as well.
It’s probably neutered at least.
Best thing to do with a dog.
Do you think Archie should be neutered? It’s suppsed to stop them roaming but I just love the pictures and stories of his travels so I’d say no, even with the crayfish. I suppose a fairy could sort those suckers out but I’d still say no – what do you think?
I don’t think we should neuter Archie. Buff would never forgive us, for one thing. For another, I understand neuters get along well with fairies as well, but are less likely to be invited to stay for dinner. If you want to know what they talk about at those parties, it’s probably best to leave Archie as-is.
Well yes I’ve seen the benefits of a man being paid to sod off from under your feet (brother-in-law in the Navy) so I’m definately with you on this – Archie should remain un-fairyfied.
He may not agree though and may quite like the idea – give his crayfish something to do; for all we know it’s already happened!
@Philipa:
If fairies could sort out suckers there’d be no Raincoaster.
While I have never seen fairy in a lab, I have occasionally spotted the fragments of wing or tiny teeth that are the result of fairies ending up in a cat or an owl.
I hasten to point out also, that as an Antipodean, Aerchie may in fact not have crayfish, although Moreton Bay bugs are a likely possibility.
Um … only seconds after posting that comment the first sentence is mocking me. Need I clarify the squid reference?
Nope, got that re: the tentacled one. The bugs look a bit frightening and every time I think of a huge crustacean I think of how they scream when dropped in boiling water, I know that’s supposed to be air escaping but… wouldn’t you if someone had dropped you in boiling water?? I like the advice: “demands a racy, dry and crisp wine to refresh the palate. Try a leaner style of young semillon sauvignon blanc blend. ooh! I’ll have a box of that mate! That reminds me of the fosters ad was it? They went to get a load of beer and put a bottle of sherry for the ladies on top of the beer in the truck and it collapsed, so did I, excellent.
I don’t think you get many fairies in the outback…?
Babies. Babies make the same sound; it’s just the air escaping.
For shame–to think of doing that to a baby. Everyone knows babies go with a boistrous red. Try a nice heavy merlot. Oh, and barbequeing keeps the wild flavour better than boiling.
I live in the city: we only have battery-raised babies around here. Besides, you wouldn’t eat a free range Downtown EastSide baby, would you?
Hey, you can’t make an omlette without cracking a few babies.
Battery raised babies – Good, good , good vibrations – - -
Veal should always be pan-fried!
(From the preface of “To Serve Man”.)
I’m always confused about which fork to use, particularly when someone says, “Stick a fork in him: he’s done!”
I prefer to use the “flesh falling off the bone method”. I have found that four out of five fairies use the same method, but we can’t show you their faces.
‘To serve man’?? No thank you!
Quite right in not showing the faces of fairies – give a man a mask and he’ll tell you the truth, and I’m sure the same applies to fairies.
Alas, in serving man, there is little discrimination between the sexes.
On the contrary; it’s one of the few times I don’t object to sexism. “No, no, the book is quite specific. THAT is a man, THIS is a woman. You wouldn’t make pizza with “potato sauce” would you?”
Raincoaster’s right Archie, and when it comes to serving either I’d really rather not see a future where the words ‘do you want fries with that?’ becomes my mantra.
It is not the mantra that concerns me – it is when they are the last words heard – - –
“To Serve Man” is not a social etiquette manual – it is a cookbook!
I’m not seeing the problem, Archie. There IS no “To Serve Woman” book, is there? Voila, no problem.
Yup! Slap another sucker on the barbie :-)
Remember the scene in Green Fried Tomatoes and the Whistle Stop Cafe..
Eating fairy dangerous for man
Yep, saw that. Eating fairies has always been very dangerous, even before the spread of AIDS.
I checked the “prankers” website and this is what it said, copied and pasted-
The 8inch remains complete with wings; skin, teeth and flowing red hair have been examined by anthropologists and forensic experts who can confirm the body is genuine. X-rays of the ‘fairy’ reveal an anatomically identical skeliton to that of a child.
It goes on, too. I DEFINETLY believe in fairies. raincoaster, I love this picture and now I have proof to my soul that fairies actually excist. Thanks for inspiring me with my manga/anime!
♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥
Falling thru the sky
♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥
And here is the link if all of you people want to check it out. Goodbye!
http://images.google.com/imgres?imgurl=http://raincoaster.files.wordpress.com/2007/04/dead-fairy-closeup.jpg&imgrefurl=http://raincoaster.com/2007/04/01/mummified-fairy-remains-found/&h=543&w=410&sz=50&hl=en&start=34&um=1&tbnid=ughnPcDNORMl6M:&tbnh=132&tbnw=100&prev=/images%3Fq%3Dfairy%26start%3D20%26ndsp%3D20%26um%3D1%26hl%3Den%26rls%3Dcom.microsoft:en-us:IE-SearchBox%26rlz%3D1I7GZHZ%26sa%3DN
And, this has the image attached to it that brought me to this place.
This time, I will sign off. Goodbye! (for real)
There you go, doubters. PROOF!
Goodbye, and do let us know where you get to when you fall through the sky. What’s on the other side?
I fully believe in fairies. I have socialised with them and I like their sense of humour. I only wish my girlfriend looked as good as they do when they are glammed up.
But I do! Wings and everything!
Well, we have yet to see THAT photographic proof. But the odds are good.
When I’m wearing wings I can roller skate and wear tight white jeans and little flirty dresses in the disco, and ride a bicycle and do loads of things I couldn’t do before – wings are great!
I used to be able to do all that; we called it The Eighties.
Lucky me; I’m only in my forties. However some days I can empathise real well, especially after cheap chardonnay the night before :~} I blame it on the fairies – they won’t steal cheap white wine.
There is your mistake – ask them to steal cheap red wine! A cheap merlot is always better than a cheap chardonny.
I’m with Archie, but alas the fairies seem to prefer spirits. It must be the volatility.
if you click on the picture where it shows the entire fairy, it will take you to another website, on that website if you scroll all the way down in red letters it says that it’s just a fake and the winner of some contest will get the ….action….figure thing…. so yeah. just thought you buttholes should know.
Hey – we have a poster without a butthole!!!!
Now that IS an interesting thought – without a butthole he must be absolutely full of sh1t!
Miguel – are you totally constipated?
Actually, Miguel, if you look at that site closely you will see that the retraction was printed some days after the original article. This could indicate a genuine retraction or it could be that he was contacted by the fairies and told to retract! Now, have you any proof, one way or the other?
So the topic is now Miguel, his butthole, sh1t and retraction due to constipation. I recommend a curry, Miguel mate. Eat in a curry house no Indian or Pakistani ever would and results are guaranteed, especially on a monday night. Go for the phal and you’ll fly to the bathroom as if with wings. It’ll give the waiters a laugh too.
I’m sorry you’re with Archie Raincoaster as I was hoping you’d be with us in the UK earning lots of money for doing very little (so the job description seemed to read). When I get my poor person pension (lottery win) you’ll have a first class round the world ticket and can see us both.
And anyway, Archie isn’t talking to me; I am in the wilderness of Archie’s private attentions – I blame the fairies.
Eventually I shall be with you. If Cameron gets in, I figure I can get some cash out of his “Off the Dole, Into the Dosh” programs, teaching useless skills like Blackberrying and so on. And I’ve got the EU passport eligibility, so that’s bonus points: I can even work legally.
Archie isn’t speaking to you? I think it’s just that he’s concentrating on Miguel, who is as Archie so rightfully noted, full of something and it’s not pixie dust.
Where has that Eagle gotten to?
Bonjour, your Grace
Cet Aigle is vishing dat he were in his Forties
Yr obedt servant
G E
Ahh, young Philipa, I am not aware of not speaking with you – I have just come (sic) from making a comment on the latest of your postings. I have been rather quiet for the past couple of days but that was due to f**king real life! There isn’t a fairy to be seen out there at the moment. It is too hot and the humidity wrecks their wings! I think they have migrated.
GE: Please don’t regret the passing of years: they are proof positive that you don’t give up easily, if nothing else. Besides, everyone loves a distinguished older raptor. No doubt Archie will make a pun on that in his next comment…
He has apparently been very busy f**king, or so he says!
Ahh that explains it – I asked Archie privately if he missed anything of the desert even though he’s glad to be home; answer is obviously no, F*ck all! And yep, we’ve got all the fairies – Raincoaster was right (again!) there’s loads of ‘em over here. Cameron may need a Fairy co-ordinator. I’ll leave that one to you Raincoaster.
Mr Eagle Sir – ‘everyone loves a distinguished older raptor’
Oh yes, I’m a hag from WAAAAY back. I’m terribly popular with fairies.
I guessed you were part of the hags movement – creating high quality, innovative online environments that are aesthetically pleasing are one of the keys to HAGS success. You provide one of the largest ranges of virtual adult fun environments catering for a range of ages and abilities, from the traditional conservative & UniPlay/MultiPlay (in an election year) through to your innovative Agito collection for the hard-line left-wingers who spend a lot of time alone. Raptors are made as welcome as those with the softest of tentacles and most fragile of wings and other things.
You’re a star and maker of pleasures – what can I say?!
Oh, pshaw! I’m blushing, and that looks TERRIBLE with the overall green cast to the tentacles.
looks like burned barbie doll ;o)
Can’t be; where are her tits?
Oh! Do you want them back?
Happy mommas day big blog momma.
And Archie, give Raincoaster her tits back, you’ve played with them long enough.
RAIN’S Tits? I thought they were yours!
Oh, dats unleft – it is England’s Mother’s Day – We don’t have that in the antipodes until May.
Long live the Mothman!
~m
I had a fairy hit my winshield while driving home last night. It was still half alive when I pulled over so I just drowned it really quick in a nearbye creek. I figured that was the humane thing to do.
I started driving home and realized my mistake. I turned around, recovered the drowned fairy corpse, and drove immediately to the nearest freakshow, where I promptly sold the remains for a $250 profit.
Now Philipa will want to know if it had Rain’s tits – - -
Well I wasn’t going to say anything, but now that you mention it I do remember thinking the fairy had fantastic tits. I admit. I copped a feel as she struggled for breath. They were sort of squishy.
Your Grace
2ND BLAST OF THE TRUMPET AGAINST THE MONSTROUS REGIMENT OF …
We approach another numerical milestone – it is refreshing that ===m should again shew a WISDOM beyond his youthful years by introducing such an elevated intellektuel tone with his suitably serious asperation
but one must ask serious pScientific Qvestions :
Wer ist der Mothman ?
UND
WHY are there apparently 2 widely-separate Mothman populations in West Virginia (wherever that is) and Charleston
Isn’t Charleston in South Carolina – the place where the YANKEES commenceated a certain infelicitousness with the Cotton States, in days when the Republikans seem to have been quite left-wing
…. and is it really the Amerikan Way to be content with such a lowly profit of $250 (£80 sterling) – wouldn’t he have got more by selling it on e-bay – British MPs (& their taxpayer-funded relatives) are much greedier
Yr Grace’s obedt servant etc
G E
so, like, is this forreal….or is it just some lame ass shit again?
Yes, Amy, there are fairies. They exist as certainly as love, and generosity and devotion exist, and you know that they abound and give to your life its highest beauty and joy. Alas! how dreary would be the world if there were no Fairies! It would be as dreary as if there were no Amy’s. There would be no childlike faith, then, no poetry, no romance to make tolerable this existence. We should have no enjoyment, except in sense and sight. The eternal light with which childhood fills the world would be extinguished.
Not believe in fairies! You might as well not believe in Santa Claus!
Oh, just accidentally, in the absence of the hostess with the mostest, I will arrogantly post the 800th comment on this most excellent post.
Fairies Rule!
Fairies do indeed rule.
And as for the hostest with the mostest – has she in fact been visiting Britain?
So, kstaff is a necrophiliac fairy-molester? The things we learn about our commenters every damn day!
This is so totaly absolutly fake ok but before everyone gose all death to the non-beliver i do beive veri mutch so i just dont think this is real there are fairies out there
sorry for any spelling mistakes i reali cant spell
bibi :)
Boy howdy can you ever not spell. “Kiki” is spelled with K’s, not B’s! But if you are Kiki of Kiki and Herb you can spell it any damn way you like; drag queen’s perogative.
Hey tht was harsh and KiKi is a name i pick up wen i was lik errrrrm 4 coz i couldn’t say out eles and it stuck
bibi=byebye lol
cya
You can’t be bibi and Kiki: you have to be one or the other. I don’t make up these rules of the intertubes, I just report them.
point made its kiki ok
I am heartened and, indeed, even humbled at having helped you work through this identity crisis to a point of full personhood and resolution. Go forth, Kiki, and comment proudly!
thank you oh great one for enlightening to the erroe of mi ways i will take your advice and go forth
Is there no end to the miracles? SEE?!?!?! IT MUST BE A REAL FAIRY: IT’S MAGIC!!!!
Indeed, but Kiki will not truly be enlightened until he hath molested a dead (or dying) fairy. Only then can true wisdom be reached.
Regarding West Virginia/Charleston – one of the peculiar things about West Virginia (beyond the literacy rate compared to the per capita volume of firearms registrations)is that it contains both a “Charleston” and a “Charlestown.” In other words, to my knowledge, the Mothman believing populaces are within the same stately lines of demarkation.
Maybe it’s a tesseract, a warp in the space/time continuum which occurs in the presence of Mothman?
then id rather not reach true wisdom thx
As I was once told by this gorgeous guru (gura? guri?–Female type, anyway):
“No-one belives the truth anymore unless it’s attractively packaged.”
Which explains why so many people refuse to believe in this fairy. I mean, would a little moisturizer have hurt?
but just cause this fairy isnt real dosn’t mean there not out there and its still guru
Metro’s just not into elderporn. Ignore the narrowminded so-and-so.
And fairies are VERY out there; at least, all the ones I know are.
You know, that puts all your “Great Old Ones” postings in a totally new light.
Of course your obsession makes sense; You will soon be an Old One yourself,if the ancient proto-Aramaic script written in an odd, dusty red ink upon the spider-skin parchment of your birth certificate is to be believed.
Hardly: thanks to my terrarium-like living conditions in this haven of dampness and darkness, I look years younger than my age as my skin retains a fetchingly moist pallor.
[...] I finally found my own mummified fairy remains. [...]
Re.”Regarding West Virginia/Charleston . . .”
Another peculiar thing about West Virginia – there is (or probably was, by now)actually a 7-11 franchise in the town of War. No faeries there, but I did find a burrito two months past its expiration date.
Expired burritos tend to give me gas. As a child, my mother would claim the “flatulence fairy” had come to visit my stomach.
We should do some cheaply made, badly edited, home video and claim it’s further proof of fairy existence. I’m thinking some stop-motion claymation animation would be fitting and proper here.
There’s a War in West Virginia? I didn’t know there was oil there!
It is Bush and his geographically challenged advisers. They thought that was where Chavez was acting as President!
Hey, they were close – right capital letter and right hemisphere. They are getting better.
Wah, Ahh do declayare, Miss Scarlet RegenCoaster
Wasn’t it OIL that made those demm Yenkeees to impose Democracy on Texas and those demm Rebel States in 1861
Yr obedt servant etc
G E
Actually, oil didn’t really become an issue between the north and south until the kinfolk said “Jed, move away from there.”
Well, the South needed oil for their panzers and luftwaffe, so the fairies had suggested they occupy West Virginia.
Wait, I’m confused – are we talking Bavaria or the southern U.S.?
Know how you can tell you’re in southern Germany? They all sing Deutschland uber Y’alles.
FFE, that Beverly Hillbillies reference was one of your best, but the second comment was not too scruffy either.
Just as long as nobody tells McCain about Alberta…
Too late – McCain thinks Alberta is the peach capital of the world.
ir is it that McCain thinks the main export of Alberta is hair clippers?
At any rate . . . weeeeeeeee doggies!
Okay, those two went over my head. Or under it. Either way, what a time to be out of gin!
It’s hell being a semi-literate American . . . .
Alberta peaches
Weeeeeee doggies: Jed Clampett’s favorite exclamation
Alberta clipper
There’s fodder for “John McCain is soooo dumb . . . .” jokes for you.
MeinPferd der Graf KStaff
Just think
If those demm Yenkees hadn’t invented the Internal Combustion Engine for their Shermans and if Mr Lincoln hedn’t bin able to use the Internal Revenue Service to finance the Yoo Ess Army Air Force to make life so unPleasing for those kindly Chaps in der LuftWaffe
Yes, Sirreee, Virginia would’a kept West Virginia & its hosses and Robert E Lee would’a captured 1600 Pennsylvania Avenue with his Cavalry and painted it GRAY, a more congenial colour ( … errr … color) for the Fairy-Kind and Texas would have been in the Confederacy, instead of getting its revenge by sending Multiple Bushes to the White House
Well, this is it, init
G Eagle
AND America
FIRST: Apologies if my responses to this thread are less frequent. Having recently passed the 800 comment barrier, it has also recently passed the ability of my browser to easily comprehend and/or open it. Nonetheless, remain assured that I am devoted to the cause of Fairy Realism and indeed only two days ago purchased a book on some chick called Opal who claimed to be in touch with the fairy realm. I shall report back once I have finished her memoir. She does look damnably familiar, like an atavistic survivor of some prehistoric cult or, come to that, a blood relative.
SECOND: I wasn’t under the impression it was the US Airforce, but rather the Army and Marines, that made the difference. The real air heroes of WW II (and I say this as the offspring of a Canadian Air Force Master Sergeant) were the British. No?
Your Grace
Yes
Apparently, 40% of RAF Bomber crews came from the Dominions (Canada, Australia/New Zealand & Zuid Afrika)
…. but of course in 1939, folk in these Dominions (with complications in Zuid Afrika) regarded themselves as British and many continued to do so even into the early 1970′s
AND as an Equal Opportunity Bloggerizer you are, we trust, equally devoted to Fairy unRealism
Yr Grace’s obedient servant etc
G Eagle
Damn, she dragged me back in . . . .
Axccording to the results of the Strategic Bombing Survey, U.S. precision bombing generally had little real effect on the war except when aimed at the oil industry/POL infrastructure. British strategic bombing again had little real long-term impact on Germany’s industrial capacity except when aimed at the POL. And most everyone knows that the Soviet advance into the oil fields of Rumania may have had a far greater impact on Germany’s oil supply.
That said, American and British bomber crews suffered the most fearsome losses of any Allied aircrew over Europe, with the possible exception of Soviet air personnel and the Luftwaffe’s fighter force.
Imagine being a Lancaster or Halifax crew blotted out by a Me 110 or Ju 88 nightfighter, or the experience of seeing your B-17 or B-24 disintegrate around you as your plane and a staffel of FW 190s close at almost 600 MPH.
But yes, one has to give credit to the RAF/FAA/Commonwealth/European pilots who hunkered down and defended the Home Islands in 1940 and on.
And the U.S. Navy pilots who were the ‘first team’ in 1941-1942 against the Japanese.
And the Russian pilots who managed to survive and succeed after the events of 1941.
Plenty of credit to go around
Buon Giorno, Senor FFE
We should be cautious about accepting the Strategic Bombing Survey’s suggestion that U.S. precision bombing generally had little real effect on the war [admittedly, except when aimed at the oil industry/POL infrastructure]
Admittedly, US Precision Bombing was not very precise … and it seems that our German Friends did not really take ze War seriously enough to massively boost Weapons Production, until the Allied Bombing Campaign (and perhaps losses on the Russian Front) began to impact heavily
BUT just think :
1. Vast Quantities of Men, Artillery & Aircraft were diverted to defend Germany – how much damage would they have done if the Germans had been able to use them on the Russian Front, where a Russian Victory was far from assured until late 1944
2. How much greater in volume & effect would German Arms production have been, if the Bombing had not caused massive damage/distraction to German Factories & Transportation Facilities
3. Allied & Occupation Morale must have been massively encouraged by the fact that the omni=triumphant, omni-successful Germans were seen to be suffering massive retaliation – we were actually able to fight back
Tot siens
G E
M. Eagle,
Granted, the psychological value of strategic bombing was undeniable, and it tied down a great deal of materiel and manpower. But its effect in bringing the war to a quick close is less clear.
I’ve been of the opinion that the most effective strategic use of airpower was the combined effect of Coastal Command, Army Air Force and U.S. Navy four-engined heavies and escort carriers against the U-boot threat. In that role, there was a much more dramatic effect in opening the sea lanes to vast quantities of shipping to support the operations against Germany and Japan.
Of course, breaching dams and putting continuous stress upon industry and transportation nodes didn’t hurt us either.
and where’s dose fairies now?
Jawohl
und vot indeed about dose Fairies … und let us not forget that dos Fairies were ready to swoop and decimate German Tank Produktion, if only dose USAAF Chappies had paid just one more visit to the Schweinfurt Ball-bearing Factory
G E
Well, it’s clear that Fairies, like Switzerland, were entirely neutral throughout the War. This could have been very different, had the Germans hit a few specific locations in, ferinstance, Cornwall.
… or Kalifornia
True: there are lots of fairies in California.
coolio! i BELIEVE!!! oh and sorry for the no-caps. i never get to do that… i totally think it’s real. fairies RULE!!! i spend all of my computer time searching for pics of fairies. oh yes, and Raincoaster, u rule, and mr smuggles/mr sum or whatever u call yourself, COULD YA USE ANY MORE CURSES???? jeez. and yes USE YOUR SPELLCHECK!! it DOES exist! i have an imaginary friend and she’s a fairy.
See!!
At least 40 of my dorm neighbors in grad school were fairies, and they dressed better than did my girlfriend. Go figure.
My favorite use of WW2 airpower is when the antiquated WW1 “swordfish” of the RAF nailed the Bismarck’s rudder.
There’s just something about bi-planes attacking pocket-battleships that I find appealing.
MeinPferd der Graf KStaff
The Bismarck Campaign was a classic example of the efficacious& gratifying deployment of superior sea-power
The 35,000 ton Bismarck was more than a match for any individual Britisch Battleship
eg the Britisch insisted on sending the Prince of Wales into battle with civilian contractors on board before its construction was completed – predictably, its guns ceased firing at the most embarrassing moment, even without the encouragement which our German friends were so eager to give
eg HMS Hood looked impressive, but appearances =flattered only to deceive – the Britisch had “economized” by failing to instal armour (… err … armor, in der Amerikanische Dialekt) at the rear and never got round to remedying this in the almost two decades of leisure that they had before 1939
UND the Bismarck had more than its fair share of luck
eg a lucky plunging shot hit the unarmoured rear of HMS Hood, just before she completed her turn to face her armoured front towards the Bismarck
ABER [but] bad luck, if you have enough of it, eventually evens out UND buffoonery in sufficient volumes eventually becomes a strength
We kept on attacking and sooner or later the blows were going to be effective
eg HMS Hood’s broadsides did not hit the Bismarck, but a shell did minor damage to Bismarck’s oil tanks, which became an increasing inconvenience as sea-water mixed with oil which thus became unusable
UND
Apparently, our German Friends could not believe how slowly the Swordfish were flying
Also [ergo], their sophisticated anti-aircraft guns were aimed in front of the Swordfish, at points where they thought the Swordfish would reach, but which the Swordfish weren’t fast enough to reach in time to collide with the German shells
and a lucky torpedo hit the Bismarck’s rudder, slowing her down and crippling her steering
Of course, any fairy on board could have told the German Kapitan of his peril and how to counteract the Swordfish, but one of the downsides of murdering large numbers of decent human beings & Fairies is that the Fairies had been terrorized off the Bismarck and were not there to give timely warning
Well, this is it, init
G Eagle
“buffoonery in sufficient volumes eventually becomes a strength”
I think I just found my new motto.
Good motto
but I wouldn’t attach it to WW2; people died and I wouldn’t attach any buffoonery to my relatives who fought in that war. War is nasty and bloody and horrible and many die horrible deaths, yet they still go out and fight. People are fighting and dying now in Iraq due not to a buffoon but a lying ambitious politician, may he never know a days peace. But he is not at the front line and won’t die. And that just makes me angry.
And it is often buffoonery. I’m re-reading Flashman, the first one when he was in Afghanistan, and the monstrous slaughter because of stupidity would break your heart.
But the stupidity is not from the men dying on the front line, it is from the lying git who caused the bloody war.
Just wanted to write that again just in case any people in other countries, like Australia or the USA, were harbouring warm cosy feelings over the Bliar bastard.
Sorry back to fairies..
Oh, trust me, everyone in other countries has long since forgotten about him.
Except Iraq, of course.
Funny – I thought Philipa was talking about our own head shrubbery.
I always revel in the irony that we helped create the monster of al Qaida in our own headlong rush to give the Soviets in Afghanistan a taste of Vietnam. Yes, we had an obligation to go into Afghanistan and finish that particular rat hunt, but no one in power here was going to own up to the real reason for that and 9/11.
As for Iraq? Well, I wouldn’t give Bush any credit for being particularly smart or intelligently ambitious. A buffoon, certainly, and led by the nose by avaricious, venal buffons with a level of animal cunning only marginally above most roadkill.
oh WOW this looks like real shit I love fairies and unicorns are real too they have a breed of sheep or goat that have one horn that could be it and dragons? pfft. Comodo Dragon guys they do exist and when the stories have been passed down from generation to generation, their going to change thats how it happens just to show they ARE real better believe it.
FFE has a point and I have to agree with *mysticfairy* – both Bush and Bliar look like real shit.
I think Unicorns are a moot er.. point, however..
I’ve never heard of a “Comodo Dragon” before. Perhaps in light of the discussion of naval battles the noted *mysticfairy* was referring to a Commodore Dragon?
Although I can find no record of such on the HMS Hood crew list, nor on that of the Bismark.
Perhaps it was a slight mis-spelling? Those with connections in Ry’leh might be able to inquire whether Lord Dagon holds staff rank.
Or perhaps mf refers to commode dragons? Celebrated fantasist Terry Pratchett has noted that it is necessary to close the lid on the privy so that the dragon of unhappiness should not fly up one’s bottom.
He also notes that there was probably no such creature until people began believing in one.
Hence the picture above has been evolving, as more and more belief in dead, dessicated fairies accrues, it must be becoming more real. Therefore we should all believe in it …
Nothing to do with faith on the dragon front (every man should have one) shutting the lid on the privy does not prevent the dragon of unhappiness flying up one’s bottom, although opening ones mouth too loudly does attract the little beast I’ve found, shh-it just happens, wherever you are.
Ahhh, look at that. Now that those noisy humans have quietened down, all the fairies are sleeping. It is so sweet.
Of course the terrible Afghanistani situation which was causing the pesky humans to raise their voices could have been easily solved had the Empire not fallen and had Sir Sidney Ruff-Diamond and the kilted Third Foot and Mouth regiment been dispatched early in the conflict, the problem would have been solved!
The environs of the Khyber Pass have been decidedly unpeaceful for centuries. Why do the politicians of today think they can solve the problem now?
While Blair (and Howard) may have been gullible in respect of Iraq, it should never be forgotten that it was Bush and his cronies who told the bigger lies; told them first and told them loudest!
Now, let us tiptoe out and leave these fairies to their well deserved rest.
Archie, let us hope no-one directs them to the works of Flashman. Nothing good can come of that.
My great-uncle Flash was a cad
With ladies he was quite a lad.
Despite his great shame
My hero became.
Is that why I’m evil and bad?
[...] Khyber Passed Posted on March 22, 2008 by archiearchive FCD Elsewhere, in a serious discussion on Iraq, Afghanistan, Fairies and the entire Western World, I have found it necessary to invoke that redoubtable British regiment, the kilted Third Foot and [...]
Yes. And why we love you.
Also: mysticfairy, nobody who knows me doubts for a moment the reality of dragons.
Ah so
As Chinese Ploverb say :
Do not despise the Snake
Who knows, she may grow into a Dragon
Careful…I’m on painkillers and apt to be unpredictable. Uh. As compared to usual.
Does this mean your unpredictability is unpredictable? So that, at unpredictable moments you will become predictable, or is your unpredictability totally predictable? And is predictable unpredictability true unpredictabilness?
Inquiring minds, once they have resumed normal service, wish to know.
Her Grace, la Marchionesse de W etc
Your Grace
Jawohl
Enquiring & UnEnquiring minds alike DEMAND the right to know the ANSWERS to the Questions raised by the People’s Sage AerChius Dudius … or is there only ONE Answer and if so, what is the Question
… and, if you were a US Citizen, how would all this IMPACT on your choice of Demokrat Candidate for November
eg do you vote for oor Hilary with her reassuring Anglo-Saxon name and her undoubted appeal to US Dragons, but she seems to be a little fierce (this might lose the unMummifed Fairy Vote)
OR
Do you favour the Kindly Mr Obama, who presumably knows that Kenya is near Somalia but neither are in the Amerikas
This is all very Vorrying, with all those US Fairy Hunting Carriers in the Gulf
Yr Grace’s obedient servant etc
G Eagle
WAT???!!!
i got lost at the unpredictable shindig
now i’m totally lost!!
so again i say WAT???!!!
pleez re-explain to me cuz my brain hurtz
does anyone else’s??
i forgot to say
FAIRIES ARE DA BOMB!!!!!!!!
@puppyluvz, I only ask the questions which must be asked. It doesn’t mean I understand them
If I were a US citizen I would without hesitation defect.
Puppyluvz, thank you for informing us that you are confused. We, having read your comments, agree.
Archie: it’s hard to predict.
omg this is sooooo cool!!! fairies rock!!! i’ve seen one before but wasn’t exactly sure and now i know for definate!!
also…well done on all all these comments, i hav bean shockingly entertained this last day and a half reading them!! lol. you do realise if it keeps going you’ll make it to a year running??
St. Calum
Well you will get there first, St Calum. I’m only walking there!
good point. not the athletic type myself! lol.
Just so ya all know; I ain’t a liar. I’ve seen many fairies before…….. and once, about a week ago…… I saw a unicorn. The first fairy I saw was a cute little fella who just so happened to be in my hallway at about 11:12 p.m. The second time I saw a fairy was at maybe nine o’clock p.m. She was a very pale skinned fairy with black hair down to her knees. She was surrounded in a cloud of darkness…. I KNOW she had magical abilities.
I believe in fairies more than I believe in my brothers. :)
Raincoaster…….. I worship you!!!!! You believe in fairies and are soooooo wise! Please respond to my previous post.
Okay, I’m calling BS here and guessing that “fairy believer” is Raincoaster not logged in. :)
Makes sense – she has been very unpredictable of late. Or so I have predicted – - -
It certainly was not me. I’ve never seen the Fairy of Darkness, and I know for a fact that ALL fairies have magical abilities.
I’m quite sure this thread will go longer than a year. It’s the #1 source of search engine referrals to my blog, for some reason, other than “Britney Spears sex tape”.
Thanks guys!!! I was SOO totally lost and had no idea what was being said but now I understand and yes I’m a US citizen.
FAIRIES R DA BOMB!!!!!!!!!!
and r way kooler than anything ever
i wish i could see one :’)
i’m jealous of any1 who has :(
o yea
archie stop confusing me with ur predctable, unpredictableness!!!
GOSH ur so predictably, unpredictable at he most unpredictably, predictable times!!!!
At SHE most unpredictably, predictable times. Please keep your genders straight: both this fairy and I are female, obviously. Just look at us.
Sorry!!!! I meant to say THE most unpredictably, predictable times.
unpredictable wat im lost
+ wat in the world does puppyluvz mean
i beleive that the fairy remains are creepy they give me thr shivers
Yes, the fairy remains are creepy but do u believe in fairies?
we all want to know!!
AND puppyluvz doesn’t have to mean anything i’m not stupid so i won’t use my real name!!!
DUH!!
:)
maybe thats why i didnt use my real name
so im not stupid anyway u put it ill always say the im not stupid
What does redmonk mean?
HMMMM!!!
qwertyuiopasdfghjklzxcvbnmkghrtkjgyhdfjkshgkldfkhvliryiutjrehwklhfnksdnsdghjtghreblflirtfgjhynbnwillghjghjfjjflirtvfnxckjfhrkjbfnbvvbgfjdg
wat??
Wat???
WAT????
well there is a red monkey on top of my moniter so i thought that enstead of my real name because u never know if there is a computer haker on
i dont even understand wat i said yet i laugh at my self HAHAHAHAHAHAHAHAHAHAHAHAHAHA!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
hurry up peop[le!!!!!!!!!!!!!!!!!!!!!
is anyone on cause i think that im the only one on
whatever
im scared because at the jewel osco strp mall people are geting beat up for no reason
WAT R U TALKIN BOUT
WAT STRIP MALL
WAT JEWEL OSCO
WHAT
that creepy isnt it
well i gotta type in the 900th comment so i gotta hurry
i will now post the 901st comment
fairies are da bomb
FAIRIES are da bomb!
FAIRIES ARE da bomb!!
FAIRIES ARE DA bomb!!!
FAIRIRS ARE DA BOMB!!!!
yay
;)
Thanks, guys! We are now unofficially the longest comment thread I have EVER SEEN. Maybe Gawker’s Foxy Brown one is bigger but I haven’t seen it therefore it doesn’t count, right???
900 comments and less than a year old! Couldn’t have done it without you all; hell, you did most of the heavy lifting.
YAY
Longest one u’ve ever seen!
HMMM…
I’ve seen one before that was more than 1,100 and it was only up for 6 months. Thats where it stopped though. No one else said any comments and it just ended so i hope u guys can do better than that and i hope it keeps going and doesn’t end like that one did.
GOOD LUCK!!!!
KEEP POSTING COMMENTS!!
i know i will :)
i have a question.
Why is it when people draw fairies or you look them up on the internet they are made up to be like they are the most beautiful things ever?
I mean it.
If you look up a fairy image on google you will find unaturally skinny, huge breasted women!
WHY?!?!?!?!?!
AND why are they so close to nudity?
Put some clothes on them!!!!
ITS NOT RIGHT!!!
raincoaster and anyone else who reads this please tell me because no matter how hard us women try we can’t and won’t ever look like that.
Plus, why do women have all of the looks standards!
we have to be skinny with big breasts or we are looked down upon. With guys you can be fat an lazy with gray hair and no one cares. If you think I’m lying look on the news. The guys can look however they want as long as they’re dressed up, but the women are very “perfect”.
WHY?!?!?!
Its not fair to the women!
IT NEVER HAS BEEN!!!!1
So please tell me raincoaster and anyone out there who agreez or disagreez.
I honestly from the bottom of my heart want ot know why us women have to be so “perfect”.
It makes me sick jsut thinking about it because I’m very tomboyish and I know I don’t live up to those standards.
Well that’s easy. Women are not fairies: fairies are supernatural beings and so just as men don’t look like angels and kids don’t look like archons, women don’t look like fairies. Only a fool would expect them to.
Google image search is managed by pervs. It’s true!
Guys cannot look however they want without consequence. Fat, ugly guys are prone to being called fat and ugly. If you think that’s not true, you need to re-establish the balance in the universe by telling someone about a fat, ugly guy you saw. It’s only right and just.
If you look on the news the guys are classified in two diferent catagories.
The young newbies, and the old fat guys in suits.
Seriously.
Maybe its only in America, but those are the two types of guys on there.
I’m not only talking about the fairies though. Women have always been treated as lower beings compared to men.
I wasn’t saying men had no standards for looks either, but women have more than I can count and it makes me mad. If women have that many so should men. Its only fair.
So again I will ask why do women have all the standards for looks?
puppyluvz thats just hullaryous HAHAHAHAHAHAHAHAHA!!!!!!!!!
i personally dont think that the fairy remains are real
does any one else have the same feeling but they might just be real there is a slit possibilite that they might be but they might be fake fairy believer what do you think im pretty sure that you’ll say yes i think that fairys are real
The thread appears to be slowly disintegrating into lolspeak. “Im in ur peet bogz, messin wif ur theerez.”
As to the reality of fairies, if I may borrow from the immortal Mr. Pratchett:
WHAT METRO?!?!?!?!?!
Well redmonk if you don’t believe the fairy remains are real, do you think that fairies themselves are real?
If you think that fairies are real, than why do you not believe that the remains are real?
what i don’t understand
well i said that the might be real but the might not some times i believe in fairys but some tomes i don’t
WHAT?!?!?!?!
PLEASE RE-POST YOUR COMMENT AFTER USING SPELL-CHECK
well i said that they might not be real, but they might be
Sometimes i believe in fairies, but sometimes i don’t
It all depends on my mood
well Puppyluvz what do u think?????????????????
Hmmmmmmmmmmm
so is anyone else on beside me and puppyluvz
How can you believe and not believe in fairies?
You have to choose one or the other, not both at the same time.
So do you believe in fairies or not?
well ill believe it if i see it
Do you believe in GOD?
well yes i do so be quite
Well have you seen him?
yes in my dreams acculaly
no acucally
Well how do you believe in him if you havent seen him?
I believe in fairies and God and I have seen neither.
well i have
Right tell us about this then please.
well then ok
it all started back at the farm
I have to ask first which have you seen God or a fairy?
what farm
where is this farm
i’m redmonk
Well “mr. carpender/redmonk/my sister” please finish your lying story. we all would like to know what you saw on this made-up farm.
:)
i was trying to be funny but it didn’t work and id like to say sorry to Puppyluvz
it’s ok
you know that if you wouldn’t have told me at our house that you were my sister i would’ve never known!!
sorry for talking about nothing raincoaster!!
:’(
Big though this comment list is, it still has a way to go to catch up with the 1533 comments which PZ Myers has attracted in the past 7 days with his tale of being expelled from “Expelled”
However, I don’t think that will have the staying power of the Fairies :)
wow
Wow, that is a lot of comments for only 7 days but it will never last as long as ours. Fairies are a big deal, whatever that is isn’t a big deal. So we will last long and we’ll get more comments than anything EVER!!
i have to agree wit puppyluvz thats a lot but this site can beat ‘em easy
GOOD LUCK!!!
its funny, i came across this site just as i was (still am btw) drawing a fairy xD
is this real? a part of me wants to believe it is, but then again, it could be made of plaster and the locks of hair could be some u just cut off and pasted on her skull
i do believe in fairies though
and elfs, and all sorts of magical creatures
and i dont care if that sounds noob, lol
fairies rock
Ah, it’s time for my periodic Quentin Crisp comment . . . .
FFE(former frontier editor),
I’m sorry to tell you this but I have never heard of Queen Crispin. I do not know why that is, maybe because I’m American, maybe not. You seem to know who they are so I am asking you to please tell me.
Thanx,
Puppyluvz
Psh. I just love how you say the fairy is 2 inches tall, but when viewed held in hand it’s much longer than that. Are you even sure you know how long an inch is?
Tear down all of our hopes and dreams. First Santa, then tooth fairy, then easter bunny,Whats next? GOD! You guy’s should the imaginary things. Take that for Ha. Bye the way I am twelve years old. Thanks for the dream crushing.
And just think, sweet young Isabella, the worst has yet to come. You’ll get married one day and found out that you’re barren. And then you will concede what the rest of us long suspect – that God is dead.
MuHAHAHA!
GOD IS DEAD?!!!
NOOOOOOOOOOOOO!!!!!!!!!!!
all this time I thought I was praying to a guy that is alive.
wait a minute…
God has to be dead to be in heaven so that means he’s partially alive right?
I’M SO CONFUSED!!!
and does anyone know where raincoaster has been?
she hasn’t posted any comments in quite a while…
Hmm…
Puppyluvs – Quentin Crisp was an English fairy, now defunct, however hard you clap or believe in fairies – they come, they go :-(
Echo – when held in the hand an inch is always longer.
Stiletto what a joy you are but if God exists at all then he can’t die. Surely you missed an evil cackle on the getting married bit? The prospect of an unappetising buffet lunch for people she doesn’t know and never did like when she met these distant relatives as a child, all getting drunk on her budget while her shiny new husband sweats his way through ABBA and YMCA until finally passing out in the hotel room with as much passion for her as a dead fairy.
Raincoaster is also an illusion.
Aw c’mon Puppyluvz! I’m an American and I heard of Quentin Crisp years before the Internet.
http://en.wikipedia.org/wiki/Quentin_Crisp
I am indeed an illusion. An illusion with a computer so b0rked it won’t open this thread most of the time. My apologies; it is heartening to know that I’m missed, if only because you want to keep your eye on the cougar in the room.
SG, what’s worse is you get married, find out HE’s a fairy. That’s the worst.
FFE, no pun? NO PUN? I’m shocked!
And it’s a well-known fact that fairies appear larger in photographs. They’re magical, duh!
okay, okay.
Crisps – betcha can’t eat just one!
totally myth!!!
all believers are mentally sick.
FFE – eew! Laughing out loud but… ha ha haa
hahah you guys are all crazy, I love it!
And don’t worry puppyluvz here in ottawa there is a sign on one of the churches that clearly states “Jesus is alive” haha no joke, I laugh everytime I pass it :P
And as far as this fairy goes…it is clearly a fake, but that doesn’t mean somethig doesn’t exist, especially because you say the word and everyone gets an image, if something isn’t real on any level then how can so many peole know what you are talking about. There is always a little truth in a myth. When you lose the ability to believe in anything magical at all or possibilities you have a sad sad life my friend :P
I’m shocked at these as hoc dismissals of the fairy. Don’t you people see the EVIDENCE bag? That means the cops were investigating. I see no proof opposing the reality that this fairy is real. None. Offer it up if you’ve got it.
FFE: I certainly couldn’t eat even one.
Glad to hear from you again raincoaster.
FFE: Quentin Crisp looks like the grandad on the movie “Luck of the Irish”, but thank you for giving me a site to look at even though it was wikipedia.(YUCK)
Stealth: Love the name and thats kinda funny because the bible says he died and the God subject confuses me because he is and isn’t alive at the same time, he can’t be killed which means he’s alive but he is up in heaven which is where dead people go.
So is he alive or not i need a straight answer, not a maybe at certain times, but a yes or no.
Please tell me
:)
thanks
Puppyluvz – he is alive in spirit but not in body on earth, yet he is all around us. Watch the film ‘Nuns on the run’ – Robbie Coltrane does a good explanation in that.
Oh God Tony Blair is launching his ‘faith foundation’ this year you can ask him.
I have faith that his foundation is sound; he just needs to add some bench presses and yoga, and ditch the wife.
I thought Cherie was the motivation to pray for some sort of divine intervention . . .
[...] Sometimes you just have to make a Quentin Crisp joke as a matter of principle . . . or boredom. I blame Raincoaster for starting the mummified fairy remains movement. [...]
[...] in a strange and hitherto only mythical phenomenon. Like Ourouboros swallowing his own tail, a fleeting tangent on the Mummified Fairy post has spawned its own spinoff on FFE’s blog, to which I’m [...]
In a humble attempt to immantise the Eschaton I note that there is now a post on Quentin Crisps
All Hail Eris! All Hail Discordia (No hemp scrip was exchanged in the posting of this comment)
Test. This is only a Test If it works, I’m really, really sorry! :)
I just found this site and it is Fabulous! Fairies are most assuredly real, I live next door to 2 of them and they are also Fabulous! Many are Queens and most have wonderful taste. NOT tasty (mere humans are not allowed to taste of the fairy lest they be drawn into the realm of Fairy forever, and I am trying to keep this clean…) I have asked one of the Queens to sprinkle those commenting with magical spelling dust and I was told to impart this one bit of wisdom: “I before E except after C or when sounding like A as in neighbor or weigh.” IM’ing is going to be the death of the Queen’s english.
@dissfunktional; I think you may have upset the fairies with that one – they don’t have testes!
Lady Mags, we need more fairy poetry in this world. That brought a tear to the eye.
Archie, what do you mean? Of COURSE fairies have testes. If there’s a Queen, there’s got to be a King, too, no?
Quentin was the King of the fairies?
Oh Puck!
Oh!
My!
GAWD!
It’s ELVIS!
ELVIS IS THE KING OF THE FAIRIES!
[looks closely] Nope , that is some guy named Trent!
Trent is the KING OF THE FAIRIES!
I think you may be right!
http://www.lolnin.com/?p=180
See, I’m not just a pretty face – or as I have been told, not EVEN a pretty face!
Which one are you in the picture? I think Trent is wearing the cloak.
The dark one floating at the rear – - -
How do we know this is a fairy?
Maybe its a pixie.
Do any of you know for sure its a fairy or is it just that calling it a fairy is the first thing that came to mind because it is more talked about. Pixies do exist. So do fairies.
http://students.ou.edu/R/Rhiannon.Roblyer-1/storye
check out this site and tell me for sure if that is a fiary of a pixie if you can raincoaster
http://students.ou.edu/R/Rhiannon.Roblyer-1/storyextra.html
sorry it didn’t copy the whole site
visit this site and tell me if this is a pixie or a fairy if you can raincoaster
Oh, pixies are a whole OTHER issue. I’ve got a post about pixies coming up soon and we shall deal with them at that time.
That, in the picture, is DEFINITELY a fairy. Those Academic and Pre-Raphaelite painters knew their metaphysics.
Well, if I married for money, it would be a dream come true! And if he were old, it’d be almost too good to be true! No wifely duties if you know what I mean. Plus I’d have the most styling house in town!
We both could take on lovers – he just better stay away from MINE.
That’s my retirement plan. Go to Palm Springs, where all the rich showbiz gays retire, find a doddering Catholic with a mother complex, and ask him how he wants to meet his mother in Heaven. With “Mom, I was fucking the pool boy” or “Mom, I just got married!”
He wins, I win. Mom wins. Everybody’s happy.
Marrying for money is totally the way to go.
Stilleto, if all the young women married older men for their money who would be left for the older women?
Or should we just forget the older women since they would probably be dead in a few years anyway?
If the system is enforced, the older women will turn into rich widowed cougars and be bonking all the very young men.
OR
They could settle for the companionship of fairies. They wouldn’t be the first women to do so.
HA HA HA HA HA!!
Honestly I wouldnt want to marry a fairy no matter how rich(or cute) because if it was true love I couldn’t put him through my death since they live forever or for a really, really, REALLY long time.
PLUS one of my standards for guys is that they have to be near my height(at most a few inches below) or taller than me.
They also aren’t allowed to have any powers I don’t have.
Examples: flying, magic doing, ect.
Well, fairies CAN do magic; just look at the makeover of Ashlee Simpson!
Even they don’t have that much magic(or the ones who did it weren’t very good).
I would be jealous if they could do magic and I couldn’t.
That’s why I won’t marry a fairy.
Hey, fairies MADE Bette Midler’s career.
O.k. I still won’t marry one.
:P
More for me. Fine.
“That’s my retirement plan. Go to Palm Springs, where all the rich showbiz gays retire, find a doddering Catholic with a mother complex, and ask him how he wants to meet his mother in Heaven. With “Mom, I was fucking the pool boy” or “Mom, I just got married!””
Tread carefully in Palm Springs. My very conservative Republican friend vacationed there and ended up calling an escort service and ordered up one of each! This after being rejected by a couple in a hot tub.
Very strange things happen in Palm Springs!
Sounds like my kind of place, actually.
I have come to the conclusion that fairies such. And they are proud of their technique!
SUCK! Not Such!
You’re giving coded messages in German and you expect me not to notice? FAUGH!
Your Grace
Germanisch ist es nicht, because it would have read “suchEN”
Perhaps it is Thai – Thai is a language remarkable
eg the same word (pronounced something like “mew”) means “Cat” or ” Horse” or “No” – apparently it depends on the tone used for the word
Not many people know that
but perhaps it explains how the Thais avoided being colonized by the French, who have difficulties pronouncing their own Froggisch, let alone deciphering Tones
Yr Grace’s obedient servant etc
G E
Looks like someone has their hands Thai-ed
I want an obedient servant!!!! \/
..
__
My dog isn’t very good at that so its not fair.
I WANT AN OBEDIENT SERVENT!!!!!!
please? :(
First, you have to get a blog. Then you have to be polite to G Eagle. If you’re really lucky he might bust out the Latin, too.
I, myself, always say “cat” or “horse” when I mean no.
I agree – I have a blog and Mr Eagle’s comments are a joy, not that I speak Latin, or can remember much german – in fact I had occasion to remember some german and ‘geschwindigkeitsbegrenzung’ sprang to mind, at great speed. As I’m in the UK I’m amazed I didn’t get fined for thought crime over the national prescribed rate.
Well really, how many times every day do we use ‘geschwindigkeitsbegrenzung’ eh?
Come on, people: ONE MORE COMMMENT!
oH woow is amazing!
oH woow is amazing!
Are you over a thousand now on this thread? This month is the year anniversary of this post.
Let’s go for two? ;)
Yes, a thousand and three I believe. The sky is the limit!
No it isn’t.
Philipia is right the sky isn’t the limit.
Neither is the moon.
Or the stars.
Can you guess what is?
The ground.
More like the gutter.
Gordon?
This is FAKE! look at the wings! if this was real they would not be there! there would only be bone and thats a maby!
Again, as always, nothing but empty claims. I see no proof to back up your outrageous statements. Where can you show me an x-ray of a fairy indicating that the wings have bones? Do butterfly wings have bones? I think not.
Back to the drawing board, fraudster!
The drawing board … where one has, presumably tacked down the specimen preceeding dissection?
Although I think the wings may, in fact, have bones. One of the local owls regurgitates pellets at the foot on one of our trees, the pellets usually contain quite a number of small bones.
Since owls are voracious predators, and nocturnal for the most part, their daily prey would include a fairy or two from time to time, fairies also being nocturnal (when did you last see a fairy in daylight?).
Therefore some of those bones must be fairy bones, QED.
We could possibly do a skeletal reconstruction, and in the process provide the world with it’s third known fairy sample. If anyone out there is particularly good at jigsaw puzzles, I could mail you some of the owl pellets.
Many of them strongly resemble those malted milk easter eggs (I think the steady consumption of fairys is responsible for the bright colouration) so you’d have to take them apart very carefully to avoid them crumbling.
Metro, I haven’t seen any fairys in daylight. But then again, none at night either.
Yet, about the malted easter eggs thing.
I think my dog ate the fairy.
@Metro, Owls have nightly fare, not daily fare.
And this false pumping up of the comment numbvers is obviously for the fairies – - -
Wait- are you saying that OWLS lay those coloured malted eggs? Ewwwwww, gross!
My Dad said something about malted eggs although I don’t quite remember what. He is an owl expert. I should tell him that the owls supposedly lay them and see what he thinks.
:)
He told me I was crazy and all of you guys are crazy for believing in fairies and owls laying malted eggs. He also says he hates malted eggs and he can make that picture of the fairy using a program on his computer. I still believe it’s real though.
He sounds like an embittered old man. Tell me: can he PROVE owls don’t lay malted eggs? Oh, sure, he’ll probably try to shortcut and bamboozle you by proving they lay regular owl eggs, too, but that is NO PROOF they don’t lay malted eggs as well.
As for his claims of computer fraud ability, I say the proof is in the Photoshop: let’s see what he can do.
this feller wasn’t made via photoshop. i know that for a fact. i can prove it.
Presumably the buyer will come forward at some point to clarify. I heard there was an autopsy as well; pretty hard to slip a fake past a coroner!
Fairies not only exist but they keep us young!
Look at the dis-believers – they are all old! And getting older!
That is undeniable. And no-one would call either of us “Mature” would they, now?
A second childhood is a wonderful thing and full of magic
Owl experts? How exactly does one get qualified as an “expert” on owls? Did he go to Temple University or something?
He has owl the facts?
Raincoaster, you’re a hoot!
Takes pun to know pun.
Your Grace
3rd BLAST of the TRUMPET AGST the MONSTROUS REGIMENT of TRENDY LEFTIES
Doomed
We’re all Doomed
Troubling events around the World may render Fairies desperate enough to resort to forced migration to Metrolandia
1. Tonight (Lundi) the BBC News (Science) website was reporting the imminent escape of a Mesonychoteuthis Hamiltoni from its (for us) previously-safe confinement in a New Zealand Freezer
* will Archius Dudius be safe from its arms, now that he has abandoned inland Perth for Coral Beach, within tentacle-reach of the Sea
* he will not get any protection from his heroic Promotion of Human=Menacing Pseudo-Animals – Drop-Bears, Desert-Sharks, Tree OktoPodia & the Wild Antipodean Rudd-Creature
2. From her secret residence outside the London Congestion Zone but within a Racing Pigeon’s Flight of Shepherd’s Bush, the Lady ApilihP’s plans are coming to fruition on Thursday – her Ladyship’s Friend (herein called “der BozMeister”) is about to triumphantly become Mayor of London, replacing the People’s Champion, Puir Kennetho Rosso (a Politician to be trusted with the People’s Money)
AND
3. What happens if in November that nice Mr Obama is unable to prevent oor Hilaareh getting a 4-year Lease of 1600 Pennsylvania Avenue – what then will save America from her ordering the US Navy to pass the Port to the Right
Very vorrying
Yr Grace’s obedient servant etc
G E
… nor can it be spilling White Port over the Cigars after the retirement of the Ladies – ALL the White Port in his Desert has apparently been consumed in a (SCHOCKINGLY) anit-Clockwise direction
WHENCE, as a more felicitous alternative to Mummification, so many UK Fairies have selected Metro-Land as a Target to emigrate to, instead of Van Diemen’s Land
Yr Grace’s obedt servant etc
G E
G: How do you come up with those long messages? And how do you come up with some of those long words. I usually have to keep a dictionary handy when reading them.
I don’t know how he’s an owl expert he just is.
I asked him if he had proof and he said no its just not possible then he stormed off because I made him mad. Wonder why?
ttyl and ttfn
1029
Guten Tag, Puppy-Luv
It is a Truth universally acknowledged that your Dad is a most veracious fellow, on the possession of whom you are most to be congratulated
En Arche in ‘o Logos, kai ‘o Logos in pro ton Theon …
Why, Ah doo declayah, as my friend Mr Bingley also so incisively observed, it really is hard on a Man [or an Eagle] to be reminded in the Evening of the Silly things he said in the Morning
… errr … Mesonychoteuthis Hamiltoni = Giant Squid
I remain your (& her Grace’s) obedient servant etc
G Eagle
What does En Arche in ‘o Logos, kai ‘o Logos in pro ton Theon and incisively mean?
And why should I be congratulated?
Thanks
Pup
Also G I noticed I think that was the shortest comment you have made on this list.
Pup
Puppyluvz
Salve
DER BOZ=MEISTER REGIERT, DOCH
[Red Ken told to Get Lost by Grandson of last Turkish Sultan's Foreign Minister]
In the beginning was the Word (“Logos”) and the Word was with God ….
Your greatly esteemed Forebear is not only an Owl Expert, but he seems to possess a most insightful Mind, as well as having Offspring of great Intellectual Courage & Sagacity
BUT now aux affaires importantes, one of her Grace’s most distinguished Kommenters now moves in the most elevated circles of this Kingdom – she is a Friend of Effendi BozMeister, who was last night elected to High Office in Inglaterra’s largest conurbation
The Lady Philipa must NOW be treated with due & suitable respect by ALL (and that includes YOU, Aerchie Dudie)
Tot siens e buona fortuna
atque Vale
L’Aigle Gris
Archie is of course well-known to Fairyland and is immune from ill-effects, at least as long as he refrains from really pointed criticism of the works of Liberace.
Philipa’s friend has manifested his destiny upon London; opponents may take solace in the fact that his influence is now local, rather than national.
If Hillary wins, she will let Bill do whatever he wants, same as always. Like, HELLOOOOOOOOOOO! TRACK RECORD!!!!!
Puppyluvs, none of us completely understand G. Eagle. It is an undertaking best ah, undertaken, with an Africaans dictionary in one hand and a Latin dictionary in the other. And a drink in the other.
i beleve this how do u make all those efects what id like to see is dna resalts and test.my hobbie is studying faries.im only 11 and ive observed how to find faries ive lighsend 2 movies read books gone in certian stores 2 observe there atmosphere.if u asked me any ? i can anser
I didn’t know I had three hands.
1)drink
2)Latin dictionary
3)Africaan’s dictionary
I’ll have to find that third hand soon or i swear my brain will melt with all the words G puts in his/her messages.
G: Thanks for ruining my hope for you finally making short comments.
Amazing! but kinda sad, haha. Poor dead fairy :’(
11:53 pm?? where the heck are you people, anyway??
Well, they’re not so much “hands” as “tentacles” but you get the idea. Three full still leaves the rest for typing.
Where are we? I’m right here, fending off squirrels and distributing free albums for my boyfriend Trent Reznor. See the rest of the site!
Sami
Je ne comprends pas
Are you sad pour la Faerie
or are you suggesting etwas about the Kommenters
G: I’m sorry to announce that I will be no longer reading your comment because they make my brain hurt.
Sami: I think they’re European but don’t quote me on that.
Raincoaster: I would like to sadly announce I cannot find that third hand or any of the other tentacles I’m supposed to have. Please tell me where I can buy some(you can find almost anything nowadays that’s why I ask).
Pup
La Vestre Grace
E troppo rico pour la manually-limited Puppyluvz a criticiser les Mots longs de l’Aigle Gris, quand la Puppyluvz a utile mots avec 3 syllables
eg Puppyluvz
eg mybrainhurt
eg dickshoneairie
eg tentacles
C’est plus tragique que apparentement cet Aigle en ne fait pas plus de sense in Norman=Francais que in Anglais
Au revoir et bonnes Vacances
G E
est wai beyawnd mee.
Those “wings” are leves people! Leaves! You have been tricked! Fake!!!!
Of course they look like leaves – it’s a natural form of camouflage to protect themselves from nasty young boys like you who would rather pull the wings off flys than believe in something beautiful.
Of course they are leves; that is how they leve-itate! Like, DUH!
Leaves my ***. Your a fake and when the fairy army takes over the world and welcomes us I hope they do something horrible to you and you apologize for being mean.
:P
Sometimes faith in hard to believe things, like fairys, brings hope that the unbelievable can and does exist. Absolutley Wonderful. I am a believer.
That is terrific Gypsybarbi!!!
You know how scientists are supposed to make these important discoveries, I’ve noticed most of their discoveries are very unimportant. For example: if barbie were life size she would be 7’6″ tall;it is impossible to lick your elbow; there is a phobia for everything including fear of the peanut butter sticking to the top of your mouth.
Yes these answer questions people ask but they are not “important” to the way we live our lives.
That is another reason not to believe a scientist if they tell you there is no such thing as a fairy!!!!!!!!!
i dont no but i think its a fake. r u sure its not april 1 it looks real but the world would go 2 extraordinary lenghts for it 2 b true
I bet Gene Simmons can lick his own elbow. But no way would I let him lick mine.
HA HA HA
I wouldn’t want him to lick mine either(EEEWWW!!!)
HA HA HA
pup
This is all very vorrying
Wer ist Chaim Witz
und
Why would anyone vant to kNow
und
Wot hass he to do mit Fairies, ALIVE OR MUMMIFIED (ERRR I mean alive or mummified)
Und
Vot or Who is it that the sagacious GypsieBarb believe in
You cheated G and put spaces inbetween your lines. Other than that that is officially your shortest message ever.
pup
DaMMmmm…..w3l ! l0v3 f@!r!3s….. bUt !s d@t 3v3n p0ss!bl3?…. d3y f!nd w0rthl3ss dinas0ur f0sS!Ls wh!ch R sUpOsSed 2 b sTr0nGeR d@N d0s3 0f @ “fairie’s”…. n d3y f!nd d!s “fairie still intact….right…. fairies can decompose like dat n big ass dinasours cant?…
1 don’t do that again to much work to read
2 fairies are way kooler than dinosaurs
3 fairies are magic and they can decompose slower and are way stronger because of the advanced burial techniques they are stronger
DUUHHHH!!!!!!!
Pup
I think that’s right. After all, this fairy was supposed to be in a magical barrow, but construction turned it up if I’m not mistaken. NATURALLY you’d decompose slower than a dinosaur in a magic barrow.
cool thats funnny+fake
i believe in fairies, personally, and im really sad if it is fake, and really happy if it isnt, no matter what anyone says, but its also kinda scary knowing that them and sprites have a little temper on them.
ITS NOT FAKE!!!!!!!
If you don’t believe in fairies why were you researching them in the first place? My answer: Your a self-centered jerk who believes in fairies and if anyone found out it would be the end of you.
Pup
Pup, just ignore the h8erz. They make completely unsubstantiated claims. Anyone could have purchased the body on eBay and performed a scientific investigation. These people did not. Why? Because they’re afraid of what they might have found!
It is a Truth Universally acknowledged that the intellectually perceptive Pup shews a wisdom in advance of her youthful years in favOUring FaEries over Dinosaurs
Faeries (especially the Mummified Dead) pose no health risk to People
Dinosaurs (especially the Meat-Munchers, when rampaging over the Planet in the Good Old Days when this Eagle was young) would have relished varying their diet with the occasional Homo pseudo Sapiens, if only they had then been around before the Myth of Evolution had been invented
…. but the Spelling :
….. cenTREd … perlease
G E
ay de verdad qe no lo puedo creer.. no se cuando fue este suceso.. no es que no crea en hadas y esas cosas, solo que me parece increible, me gustaria que me informaran mas sobre este suceso…!
Dios que caso tan extranho..!
I don’t know what that means, but it sure sounds dirty.
awsome..!!!
Are you serious? You guys actually believe this without an autopsy report from LEGITIMATE sources?!!!! A forensic FBI evidence bag and latex gloves hunh, is that all it takes to convince the likes of you people?!!! Aw man, its time to make some money on the internet!!! Hey Bobby, get the Santa, Easter Bunny, and sasquatch suits out! We are gonna makes some believers today! All we need is latex gloves and zip lock bags and we “are in like Flint”! And people actually went to school for forensics, “Ha” I say! Yeah, more like ha ha ha ha ha ha ha ha ha ha ha ha…..
Oh please, Pretentious-1, go back to where you came from. Obviously you’re not actually scientific, because science involves reading for comprehension; that is NOT an FBI evidence bag, it is a Derbyshire police evidence bag. Derbyshire is not even in FBI jurisdiction. Honestly, you people are so transparent!
bonie, what is awesome, the fairy or that we believe?
wow is that real…its kinda hhard to belive i mean where did u even “find” it
On Fark, of course!
Your Grace
Nothing Spanish escapes the understanding of the RegenCoaster Abwehr – Spanisch Section
Alejandra May 21
“ay de verdad qe no lo puedo creer.. no se cuando fue este suceso.. no es que no crea en hadas y esas cosas, solo que me parece increible, me gustaria que me informaran mas sobre este suceso…!
Dios que caso tan extranho..!”
Wow, I really can’t believe it… I don’t know when
this happened… it’s not that one doesn’t believe in fairies and that type of thing… it’s just .. that it seems incredible, I’d like to know more about this. God, what a strange case.
We remain Your Grace’s Spanisch-Translating Servants
etc
I did not know that Eagles were quadrilingual (English, Afrikiinda, Latin and Spanish).
I’m learning french and I know a little german so I have 2 more.
:)
And I’m fluent in Profanity. Excellent!
I am very reluctant to believe any story of this nature, and as per usual with these stories, I have found several holes in this case:
It says at the very top of the page that the “fairy” was 2 inches long, however, in the picture of the hands holding the “fairy” it is clear to see that the “fairy” is indeed alot larger than this.
Also, as someone earler pointed out, the investigative evidence bag is from Derbyshire, not the FBI and Derbyshire is not a part of the FBI in any way.
There have been lots of claims like this saying that “fairies” have been found.
What makes your claim any different from any of them??
Please reply as I am dying to know what argument you are prepared to put up
alice
Excusez-Moi, Mlle xx-Alice-xx
Are you suggesting that the Bright Intellects of the Derbyshire Constabulary are in any way inferior too the plodding FBI
What Ever
hey i bk agen, omg raincoaster i cnt believe this still goin on!! it fab, how many blogs u up to now?? hae to admit i a bit confused by the last few bloggs what goin on?
i went to derbyshire over easter jst gone and the atmosphere is so magical there it is quite possible for fairies to exist and be happy there also there is plenty of animals and plant life to keep them thriving. gotta love it. x x x
Ahhh
Whatever
Derbyshire – per Jane Austen : the Best of Counties
i cant believe there real it looks awsome
i do believe in fairys i do i do
the wings look like really really really old leaves when you really look at it. by the way…how DO they reproduce? and if they lack repruductive organs, why might they have belly buttons?
I believe in faires … it puts magic into your life … maybe these bodies arn’t really but there must be something … don’t you think … ? S’laters :) x x
ITS A SIGN OF THE APOCOLYPSE!!
EAGLE MADE A 2 LINE COMMENT AND THATS IT!!!
I’M SHOCKED!
GASP!
Pup
Moi aussi!
Who said anything about the FBI? I believe that’s a Derbyshire police evidence bag, and approved Derbyshire police latex fairy-autopsy gloves.
Yet again the enemies of The Little People make spurious and irrelevant remarks, claiming them conclusive proof. Nothing could show the weakness of the naysayers’ case more clearly.
I agree, though I’m still in some shock from G Eagles short comment(which is still unbelievable).
Spelling !!!
Ladies Children & other Animals visit this Blogge Excellentissimum
APOCaLYPSE !!!
What do they teach in these Colonial Schools these days
Vote Quimby
Sorry my fault. I don’t go to a colonial school so how was I supposed to know. Geez.
this thing loks real. but its fake as and april fools prank. idk y som1 would do somthing like that. that joke wasnt even funnyy. i think fairys should stay in ourminds
If it looks real how do you know it’s not real?
Huh?
HUH?
@G Eagle:
I believe the word mis-spelt as “apocolypse” should actually be “a pocolypso”
A pocolypso is a festive Caribbean dance done by natives of Port Coquitlam, near Vancouver. Once tree octopus and transplanted-French-Canadian habitat, it is now the pre-eminent home of Swedish furniture in the region.
“Coquitlam”, by the by, is the usual mistransliterated Native word meaning, in this case, “reeking of fish guts.” Never ask the upstream tribe about the neighbours.
I wasn’t talking about some Carribean dance. I was stating a word we use in America that means the end of the world.
:P
Ah, I see. Out here we use three words: “Spice Girls Reunion.”
‘Ah, I see. Out here we use three words: “Spice Girls Reunion.”’
Har har
‘I was stating a word we use in America that means the end of the world.’
Two words. George Bush (three if you could the W)
you probably never had a cryptozooligist come to this sit yet well here you go.and i am talking about me.it looks ligit but people have faked things like that before.people sometimes make fake mermaids but thats not the case.i say its real i have been studying nessie,fairies,and etc. and this looks exactly like one.
wow – a professor who can’t spell! :)
Mr Obama wins the D. Nomination
Doomed
We’re all doomed
All we can now do is :
Vote Quimby
1) Hey, we’re almost at 1100 comments!
2) We’ve certainly never had comments from a cryptozoologist who cannot spell “cryptozoologist” before.
Brilliant!
I’m gonna make the 1100th comment!
Ready?
READY?
Wow the 1100th comment, don’t I feel special.
What to say?
What to say?
I KNOW!!!
YAY FOR FAIRIES!!!!!!!!!!!!!!
:)
pup
The highly-esteemed Puppyluvz rules, OK
Vote Quimby
WhooHoo! Thread party!
Thank you G, I know I rule.
:)
Pup
I don’t care what you people say, but the fairy looks pretty real to me. I beleived in them ever since I was a little girl living in the country, and when there were fireflies outside at night, I believed that the fairies would go dance with them in the moonlit night.
Except that I never really imagined them to look like that. It’s kind of creepy, like maybe nightmare creepy.
you know i think the fairy debate has gone on for to long i mean its obivously fake >.>
honestly i believe that the fairy has gone on long enough i mean its obviously fake
i rather believe in something like the poopy monster or the boogy man or maybe even chuck noris
Shut your stupid pie hole artemist! of cousre fairies are real! I spit when i say your name! P-toui!!!
i dont have a pie sooooooo what exactly do you want me to do??
Her Grace La Marchionesse de W etc
Your Grace
Salve & Merhaba
Doomed
We’re all doomed
Sauron the Brown has just won the 42-days’ detention vote in the House of Commons … with the Help of the Irish
Das geDammen und das geBlasten … the Republicans are taking over the Mother-Country
Next he’ll be ordering a 3rd & a 4th Miniature Aircraft Carrier to share avec les Frogges
AND all to win the votes of single-parent mothers and to impress die Amerikaner that the Britisch are still a reliable World Power
Before he can be arrested for yet more anti-Soviet Agitation and held by der Polizei for 42-days, this Eagle is off to the Prancing Pony for one last Drink
- but (with his usual luck) the Barmaid will ignore him in favour of dashing Heroes, even with the £20 (Canuckistani $100) Note held thirstily und anxiously in his talon
Your Grace’s Freond, that irritating Aragorn son of Arathorn – he continueth to queer mine Eagle’s Pitch, along with those diminutive Hobbits and that Obama-Supporting Legolas (an elf of otherwise impeccable taste und discrimination)
People with Pointed Ears should NOT be allowed to vote in Florida
BUT at least this Eagle can SPELL
“cryptozooligist” …. @£$%^ …. “to long i mean its obivously”
Wot do they teach in these Colonial & ex-Colonial Schools ???
ScHocking
No wonder the Faeies (those that still live) are emigrating in pods to the witty Monsieur Metro’s Vancouver – that Vancouver near St Louis on the Caribbean – in happier times, the former home of Tree OktoPodia und French-Canadians and later Empire Loyalists, fleeing from the Tyranny of that Tree-Murderer & his rebels
Harrumphus, Harrumpha, Harrumphissimum
Vale atque selamin aleykum
L’Aigle Gris
Eleven hundred comments? You realise this thread is now out of warranty, right? So’s that fairy, if I’m any judge.
However, the flatness of this specimen can be easily explained:
Just like many other people, when I was a child I believed that every time a child clapped its hands, a fairy fell to earth. I also believed that you had to be careful to wipe the guts off on your jeans.
That’s pretty sick, guts on your hands, then wiping them on your jeans. And how cruel are you to think that a child so innocent could kill a fairy just like that. Your twisted.
Hey Raincoaster where are you? I want to talk to you.
Oh sure, when “I” want to talk to you, Raincoaster, your not there to listen. You stupid Punk boy!! You are a boy, right?
HELLO!!!! IM GETTING REALLY BORED!!!!!!!!! YOU KNOW WHAT, RAINCOASTER? YOUR A JERK!!!!!!!!! EVEN IF YOU ARE NOT A BOY, YOU SISSIE!!!!!!!!!!!!!!!!
i acually do believe it is real but the leaves for the wings look a bit fake ! but if this website gets more info then maby ill rethink my comment! but i dont think its a prank!whoever said that is just plain rude!!!!! bye!
@aero & jessica
“Your twisted.”
“Whoever said that is just plain rude!(x4)”
If I may venture into your lexicon:
“You’re words wound me. I didnt mean no harm”
It is not so: I got a hea-a-a-a-a-a-art full of soul, as the song says. Let me prove it by composing a spontaneous poem:
When I was a childe, I spake as a childe
I wrote as a childe, and I thunk as a childe.
I believéd in faerie(s) as a childe
I didst spell as a childe
Use multiple exclamation marks as a childe
And didst write indignantly in ALL CAPS as a childe.
And didst post multiple and unnecessary commentes as a childe.
But when I became a man (as Raincoaster never shall)
I learnt to put away childe-ish things.
And bought me a dictionary and yea, a thesaurus also.
And didst snark oft in the comments section
Ande this be also my wisshe for you.
Kisses, old darlings
that fairy is cool i thought fairies dont exist!!!
Ok,listen up stupid people who know nothing about fairies and are reading the wrong blogs!!Yes,there was an April fools day prank but this isn’t it Retards from planet STUPID!Yea,sure I might sound like a weirdo Fairy lover and guess what?I AM!!!So,stuff your STUPID ASSES up your mouth!Yea,I get affended by non-Fairy believers!And yea I’m pissed right now 4 you and your stupid comments!BTW-buy a book on Fairies maybe,just maybe,You’ll understand fairies!(maybe,if you’re not all F***** up S*** heads like I know you are!)
there are many things in life that i am very unsure of but the thing i am very sure of is that fairys are real im a girl and 11 years yes i know to old to belive in fairys but this one is real how could some one pull of such a real thing of a fairy i mean it even has 8 rib cages xoxoxoxox corey.
@Haille:
You sound like a weirdo fairy lover.
BTW, buy a book on spelling and grammar and maybe, just maybe, you’ll understand why no-one takes you seriously.
There’s probably a sale on dictionaries and grammar texts somewhere nearby. And they’ll be cheap, as it’s obvious supply is outstripping demand.
Don’t despair though, you clearly have a career ahead of you with the Discovery Institute.
@Corrie: You sound like a very nice person. Cling to that innocence until you’re at least 11-and-a-half.
@RC:
I know, I know … Can I excuse myself by saying “Look, it followed me home?”
Hey Metro, sweet little poem you put up, where did you find it? J/K. Any ways, I i smell like pee
Hey Metro, Nice poem, Where did you find it? J/K. Anyways, Methinks thou art not worthy enough to speak thy language of Mimbrate Knights. Take my advice and stop thy stupidity, doth understand me?
Who ever posted me as a retard will pay!!! AND I DO NOT SMELL LIKE PEE! I KNOW IT WAS YOU ARTEMIST, DONT HIDE IT!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Your right, i’m sorry. You dont smell like pee, you smell like petunias, and i smell like moose piss.
love me truly.
NEVER!!!!
Stupid Raincoaster deserted us!!!!!!!!!!!!
This is charming. “Smeagol & Gollum: Together again for the very first time.” Now if only we could work out which is who.
@Aero (Can I call you Aero?) & Artie: (Can I call you Artie)
“I would the gods had made thee more poetical.”
~Touchstone to Audrey
“As You Like It” Act III, Scene 3
That poem? Well I ripped the bulk of it off from some old book all about a Great Sky Faerie. Good poetry, interesting stories, outmoded worldview.
Sure ye can call me what ever pleases thee. Have you ever read the Belgarion series Metro? If not methinks you should. It tis a really good book. Thats where I get all this theeing and thouing stuff. If you read it, Mandorallen, 2 or 3 book, cant remember, will get you started.
AeroG “Hey Metro, Nice poem … Mimbrate Knights …. doth understand me? ….. Raincoaster deserted us!!!!!!!!!!!! …. what ever pleases thee”
err … ummmm
Embarrrassed shuffling from left to right talon… and back ….
I hope the Witty Monsieur de Metro will forgive an Eagle’s attempts to render the interesting AeroG into the Englisch as she is spoke by God, before the Amerikans & those Rooineks “improved” her, without agreeing with AeroG’s sentiments :
Methinks the Welcome Aerogarthia meaneth :
“…. dost thou understand”
“… Her Grace hath deserted us”
“… whatever pleaseth thee”
AeroG might enjoy the unSpoiled Language of the 1662 Book of Common Prayer or the Authorized [King James'] Version of the Bible
… but Beware … such Words are dangerous … Readers have been kNown to become Christians and (in Inglaterra) LABOUR-Voters, horribile dictu ['orrible to say]
I thank thee, G Eagle Esq, for thy reference. So Raincoaster is a girl? Fine. Her Majesty hath deserted me.
errr
…. an understandable mis-direction in an (ex)Colony with its strange republican & democratic ideas
Oi tink the correct English usage for writing about a Marchionesse is :
Her Grace
Not many people know that
True, and not many people have read all the comments. If they had, they’d know why I don’t comment here often anymore. Scroll up; they’re all still there.
EWWW gross picture!! I AM SCARED!
The guy who found it has already admitted that he is addicted to april fools… Besides, I’ve seen more like this kind of “proof”, often just some cutting-and-pasting with dead monkies, feathers and dead leaves. Sorry guys, but this and the fact that it was sold (instead of taken and investigated by the government) to some collector for a pretty low price (I believe it was about 250 pounds)… I would really like to see real proof of fairy’s… But this is just crappy fake stuff. Sorry.
You people come, you naysay, you offer no proof of your claims (not so much as one link? Nothing? Pix or it didn’t happen) and then you HOTLINK MY IMAGES on your forum!
Well! I never! Or at least I wouldn’t with you! That just goes to show you what kind of people you unbelievers are.
“Dead monkies”?
Well it’s not a Franciscan. I suppose it could be a Dominican …
Oh–wait! Silly me, I’ve completely misunderstood. Now I see–Jill’s right. It looks a great deal like Michael Naismith. And now that I think of it, has anyone seen him around lately?
Ah–ha!
UnBeliever, the veracious Jill may be, but she must be rich, if she thinks £250 is a pretty low price
Indeed, even though the fairies are quite cheap around certain sections of my neighborhood, at least near closing time.
Metro: I don’t know where Mike Naismith is. Who is he? Was he named after that guy in the Monkees, Mike Nesmith?
Sorry, I’m confusing my boy bands with my Barrayar.
Hey this is all so stupid. tha picture is of a reall fairy. the human world has destroyed the beliefe of them. they make our plants grow and they help us. we have just erased everything of them. but if we all can believe then there might be hope of them to come out of hiding and they can really help us. all of your guys’s talk is just stupid that is a reall fairy and you all know it. so stop denying it and start believing!
Are you saying you use fairies as COMPOST? DEAR GOD THAT IS HORRIBLE!!!
I’ll have to try that. Alternating brown and green layers, occasionally interspersed with spangly glittery layers …
What a great idea. Compost! Yippee!
How funny! I posted a link to a compost pumpkin and I got a message that read Discarded! Somebody’s got a sense of humor out there….
i think fairys r relly cool i love fairys
Wow!!!
I missed a lot while I was on vacation. Nearly 50 comments since my lovely 1100th comment. My only question is why do the naysayers look up fairies when they don’t even believe in them?? It makes no sense.
I think faries are people with wings but smaller than us don’t you think
i think it is real but how? if its real were do they get it from? were do they saw that fairy died were?
i think its real yah but santa no thootfairy no becousi one thime i put my tooth but it was fake.so when people still think that santa is real they are kid so sorry to saying your kid but i whant you to know
That was difficult to read but I think I got the just of it. What you were trying to say is that Santa and the toothfairy weren’t real. I have to majorly disagree with that though. I have seen Santa(and it wasn’t at the mall it was at our house on Christmas). So how can he be fake when we have seen him(and it wasn’t our dad in a costume or something stupid like that).
Pup
Yeah…I belive in this image…I belive in fairies….!!!
I want to see their !!
Matthew:
You know spreading disinformation and lies like that gets you a one-way ticket to the Hot Place (I think that’s a fairy bar downtown, can’t say as I’ve never been, myself).
Of course they want us to believe this is a fake. The Illuminati want us to underestimate the threat from their allies, the fairies. But be warned, the threat is very real.
Have you ever seen an empty eggshell on the ground? Those are the remains of fairie hatchlings–clear proof of their existence. However if you see something that appears to be a whole egg on the ground, leave it at once and don’t touch it–those are faerie technology land mines, and could take your arms clean off. Call your local bomb disposal experts or police, and the poison control people. Oh, and any local Exferinigators you can find (an exferenigator specializes in removing the chemical traces left by faeries in order to lead their brethren [faeries are exclusively male] to a food or nesting site).
The Illuminati, together with the Freemasons, Osama Bin Laden and Kelogg-Brown-Root (a faerie company masquerading as human, I mean, the name just screams faerie), are grooming an army of wee folk, including faeries, trolls, gnolls, orcs and mini-sasquatch, in order to force their Newer World Order upon us.
As I understand it’s for a large hawaiian with mayo. An abomination that must be fought to the death!
OH NOOO
NOT A FAERIE ARMY WITH MINISASQUATCHES(why can’t they have big ones, too)!!!!!!!!!
I don’t want a new world order.
HOW DO WE STOP THEM?!?!?!?!?!?!?!
:o
Pup
this is SOOO cool!! i told my mom fairy tales exist but she said no! but when she saw the picture she said sorry i didnt beleve you before.
Yay!!!
More people need to be like her mom and stop disbelieving, they should just face the facts.
Pup
Just remember, it’s not the facts you face, it’s the face you fax. And the butt you photocopy.
Whatever Metro. Whatever.
:)
Pup
that is so alsome i hope i v\find something like that one
DAY!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Don’t we all!?!?!
Pup
I never !?!?, though I sometimes !?, and occasionally ?!
Interrobang forever?!
I’d link to interrobang, but I’m not sure which of the thirty-nine blogs by that name is the original.
????????????????
What????????????
Pup
This could be made from polymer clay showing ribs, teeth etc. I think all x-rays sould be posted. Until then I will keep believeing in Angels only.
I would love to believe in fairies, mermaids, trolls etc. but I would like proof first. I would like to ehco Jill:
The guy who found it has already admitted that he is addicted to april fools… Besides, I’ve seen more like this kind of “proof”, often just some cutting-and-pasting with dead monkies, feathers and dead leaves. Sorry guys, but this and the fact that it was sold (instead of taken and investigated by the government) to some collector for a pretty low price (I believe it was about 250 pounds)… I would really like to see real proof of fairy’s… But this is just crappy fake stuff. Sorry.
Where is raincoaster?
Pup
I told you: I can hardly even open this thread anymore, it’s gotten so big. Carry on without me, you’re doing fine!
Its not that big if my horrible internet can open it. Geez.
Oh well.
Pup
posting comments at 3:30 in the morning, huh? interesting…so, i heard that there is over a 1000 comments on here….have we hit 2000 yet?
btw, that faerie looks so real, it kinda freaks me out because of the wrinkles….i soooooooo believe in faeries, but i dont believe that Mr. Ollie Winkle (an old faerie) killed a man because the man was handsomer than he was….(strange book i read :P)
umm BTW, how do you people get the little pictures?
I have no idea how they get the little pictures up there but they do(its probably the fairies or some really smart computer person).
Yea you believe in fairies and what was the title of the book you read, I would like to read it?!?!
Pup
i believe in harvey dent…
ups sorry,.. i mean i do believe in fairy..
also alien,monster’s sea. they do exist! u better
believe it bro, the truth is out there..!
The truth is not only OUT THERE, it’s creeping up your ass!
Yes!!!
I think that weather or not other people believe this I do. I don’t give a you-know-what about what other people think. Anyone who doesn’t believe this is just to narrow minded.
Fairies are so real.I love fairies.And this is proof that fairies are real.C’mon, they got the cops on this thing.That should be enough 4 u.If fairies ar’nt real, then who came up with the idea.Just to make up something so awesome and tell people its not real?That person doesn’t exist because fairies are so real.
i belive in faires i know they can exsist no they DO exsist their magical their beautiful their wild they have their own language the keep to themselves they know were destructive they know if scientist find any of them they will murder them kill their race off make them vanish off the face of the earth theyll mercicelly slaughter them . theyll throw them on the table and cut them open theyll rip out there guts and cut them open. theyll cut open there wombs and take out there unborn young and cut them up 2 the government will make them vanish to keep democracy in order theyll do anything to keep democracy together theyll say its 4 scientific descoveries well dont fall for it theyll kill any one who dare try stop them. fairies r in danger when they enter our world if u dont belive in fairies u dont belive in god. if god can create us why cant he create them? do u not belive in gods work?
that is all i have 2 say……..
the rest is up 2 u……..
ok..this seems interesting..but i stop believing in this things long time ago, i know it’s sad and more because i’m just fifteen years old. i used to believed alot in these kind of stuff, really, but this cruel and soulless world made me lost all my fantasies and dreams. somewhere inside me i know i still believe in this.
well if you know someway i can, i don’t know get back all those beautiful beliefs tell me.
have a nice day
Hello boys and girls, can you say “Fiji Mermaid”? I bet you can.
It’s a beautiful day in the neighborhood.
Well, EVERYONE knows the Fiji Mermaid is real: It’s in the SMITHSONIAN for god’s sake!
please….
je ne parle pas englais est il possible que quelqu un me traduise le texte s il vous plaits …
Merci d avance a ceux ou celles qui me traduiront ceci
So sad Fairys are AWSOME and I totally believe in them!
yay more believers!!!!!!!!!!!
i totaly believe in fairies but i dunno about this…wouldnt they just like, evaporate or sumthin when they died? and the only reason officials are calling this a fake is because they dont want people knowing about the super-natural around us! 0_o
All you people are focusing on the fairy instead of the real issue here.
The caption below the picture claims the remains are only 2 inches long, yet the remains are larger than the two hands holding it?
It is sad when someone tries to pull off a hoax and completely screws it up with such blatant ignorance. LMAO
Kari darling. We must remember that fairies are magical and can seem larger than they really are. They are trying to prove this to you in the picture. Don’t you understand?
And if you don’t believe me you can read further up the page and see there was already and arguement on this topic.
wow raincoaster i aint been on this site for like a year, glad to see it’s still going, how many comments have you got now? (i would count them but i kinda have better things to do with my time)i still believe in fairies =D
dude any one know where i can find more info about this….well looks interesting and if this where real where are this animals
Glad to see that hannah has come back. Rain doesn’t get on very often anymore but I do weekly.
Mario: I have know idea where to find more info on this topic but if you listen to the comments on this site you can probably find someone who can help you find some info.
Absolutly dreadful. Hmmm… no I can deffinatly say that if I were to pass away (which concidering the cercumstances is a very very low possibility) I would not wish for my rotted body to be photographed and placed all over the web. Kindest regards to the family of this por Fae may it not hinder your lives to much.
Truly,
The Vampirate Mysterie
[any questions as to what a Vampirate is or to what I am may be answered Via E-mail at VampirateMysterie@gmail.com]
I think the fairy was found for a reason and it was to prove to all the non-believers that they really do exist.
Yes it would kind of suck to have your photo all over the web if it was a bad thing they were saying about you but this is for the good of the world.
FOR ALL YOU PEOPLE OUT THERE WHO DENY THAT THIS OBJECT ISNT REAL THEN YOU ARE SADLY MISTAKEN!! FAIRIES ARE INDEED REAL. JUST ASK AN EXPERT!!! JEEZE!
Wow! Come on guys!
Blimey, this is still going? Raincoaster is the blogmeister. We are not worthy and I expect the fairies are grateful too. Good thing to have; a grateful fairy, so I’m told.
“Come on guys!” what???
I think this is real. Its so different from other depictions of fairies, where they’re all perfect in flowing petal gowns and so on, so all you non-believers out there, I’d like to see you explain this one!
Much Love x
Very good examples. The first we’ve ever heard of those as examples.
um…i know u would like to think that this is real fairy but it is not look at the wings thay r soo fake they look exactly like leaves and you can even see the stem coming through the middle and out and he is holding it from the back so the leaves dont fall off hey guess what if u want to proove to us that this is a real fairy then why dont u take a side veiw of the photo without u touching the back or without gluing the leves on HUH SEE WHAT HAPPENS THEN and also give us a photo from its back
um i used to belive in “fairys” but now i have grown up and i belive u should to but i think its pretty cool and there is no way it can be a barbie but u might be able to make it useing small animal bones and paper mashae, also for the hair, could be from a animal or human it looks far to real to be wig hair and i belive that the wings was made by leaves in a way to where they look like that please write back telling me where the origanl picture was takein and who took it please and if someone tells me “oh its real” or “why are you asking that”? ect. i will give a reasonable answer, Thank you that is all
what the hell that looks like someone stuck leaves to some dead road kill and called it a fariy
i found what i believe to be part of a fairy in my front yard it was very small and looked like it had been attacked. the parts that remaind were the legs torso and wings. the legs were still slightly moving and one of the arms was a little ways from it. when i went later that day to look at it it had disapierd
1201 Well done Lulu
YAY! Congratulations to scientific investigator Lulu, who has added the last piece of corroboration to the puzzle and, in the process, put us over the 1200 comment mark!
Amazing Lulu!!
I only wish I had the honor of seeing a fairy.
vorrei troare anzi avere 1 di quelle fate mi piacerebbe
HUH?!?!
SchPelling !!!
? troare = troVare
I would like to catch, indeed to have one of these made would please me
me i use 2 bleve in puntuation n speling
I’M SO CONFUSED!!!
:(
Blimey isn’t that fairy dead yet? It’s had more come-backs than Micheal Jackson.
FAIRIES SHOULD BE IMMORTAL DAMMIT!
…. but Fairies are imMortal … apart from those that get mummified or emigrate to MetroLandia and drink the anti-freeze laced milk left out for the local Cats ……
This is still going on? It’s like it’ll never die and there’ll still be comments in ten years time.
This thread will NEVER die!
whaow……… cool
what a great things……..
Well if they make a film of it I’m happy for Arnold Vosloo to feature, and Oded Fehr, but spare me Brendan Fraser and Robin Williams. I think Raincoaster would look good in a tutu though and kick ass like Carrie-ann Moss just dreams about, with fairy dust. What value the blog after the award ceremony huh?
Raincoaster in a tutu?
Now I have to bleach my mind’s eye …
baby mothman? Great! Now I have gephyrophobia… The severe fear of crossing the Sturgeon Bay Bridge.
Wow this is soo cool wow if thats a real fairy then is there more ?
Wait so thisis a Dead fairy then shouldn’t we all try and find one that alive how awsome would that be!
Hind “…. how awEsome would that be!”
However, not for the Fairy …. but at least it would stop him (or her, in these “enLightened” times) vting for that kindly lady, Mrs Palin
@Hind:
Come up our way. We get them in swarms every spring and fall as they migrate to their breeding grounds on the coast … or tanning beds, perhaps. Fairies don’t breed, generally. Anyway, it’s good fun shooting the slow ones with slingshots.
Unfortunately it usually damages them beyond the abilities of modern taxidermy. Which is why I think this example’s fake. Besides, you can’t see any fangs in that picture, can you? Real fairies are vicious little buggers. Once they’re on the ground you really have to make sure they’re dead before you touch them, otherwise you’re risking rabies, fleas, and possibly worse.
Metro – are you honestly telling us you’ve never seen a fairy that’s been stuffed?
I’ve never cared to look closely enough to tell. Although my local MP might qualify–he gives the impression of having been embalmed.
No tell-tale signs of fairyhood, though … but on the other hand he’s a Conservative MP and a lay preacher in some born-again outfit, which are believed to be two of the three initial indicators.
Metro – does he drink Red Bull?
In Indonesia it called jenglot. Do you know about it? It is a mystic creature. But I don’t believe it exist.
i think it is real but what do i know. all i know is it looks pretty awsome
-bobbie
I think it is real also. I hope it is ‘cuz that’d be really cool!!!
-Stephanie
@Philipa:
No, but he spouts bull. Is that close enough?
im in my teens but im not thick!!
those wings for one thing look alot like leaves to me!!!
seee girls arnt as easely fooled as boys so there!!!!
Metro – close enough ;-)
Steph – well of course it’s real!
Pusscat – sadly I’ve found that’s not the case :-/
and just when you think fairies aren’ real,,,,one just pops up outta nowhere.at the same time, we have to be thinking that corps could be faked,or it might not be,unless i can exsamen the corps for myself;i will allways ask myself this question:how will we ever know what is to believe or what is to be ignored as stupidity?
we may never know.
And I want to know what they’re teaching children in school nowadays, and why? To quote Micheal: “how will we ever know what is to believe or what is to be ignored as stupidity?” Quite. Good point.
PussCat “.. im not thick …”
Michael “.. how will we ever know what is to believe or what is to be ignored as stupidity ? ..”
Your Grace
I flatter myself that I agree with the encouragingly-perceptive young PussCat & the sagaciously-bemused young Michael on so many things
…. apart perhaps on whether the White House would be elegantly adorned by a Young Lady so expensively attired as Mrs Palin (under the Shrub Doctrine the terror to local Moose & Monsieur Metro’s Tree Oktopodia)
BUT
It is NOT a Question of Stupidity or Thickness but a Question of Truth
Galileo Galilei’s ABSURD suggestion that the Earth goes round the Sun may seem pretty stupid & tick (Oirish for “Thick”) to Flat-Earthers & Geo-Centrists
BUT it is a Matter of Fact whether Signor G was (or was not) Korrekt
und FACTS have to be ascertained on the basis of Evidence …. and Evidence has to be carefully scrutinized
MAIS
Living in Derbyshire (per Miss Jane Austen : “the best of Counties”), how can one openly express doubt over what could become a much-needed Tourist-Attraction in these times of Oeconomic Stress
J’ai l’Honneur de rester le Servant obedient de la vestre Grace
G Eagle
Mr Eagle, Sir, I concur.
And it is the best of counties, for what can compete with the feel of gritstone under the fingers or the soft heartening viw of the Peaks?
Sir, perhpas you missed my message on Aerchies blog, so I hope Raincoaster will permit me to invite you to email me? I would like to invite you to my blog – it is now permission only. (again)
that totally looks like a wax figure with add on and leaf wings would never believe it for a sec
Niki<3
ok all you punks that say you dont believe in fairies. remember when you were growing up and your mom or dad or some one in your family told you all those nice little FAIRIE TALES. did you ever stop to think that they HAD to be based on SOMETHING. and you had to have looked on google or ask jeeves or something about fairies to find this page in the first place….SOOOOOOOOOOOOOO if you didnt (dont) believe,
ok all you nonbelievers. if you do in fact DO NOT believe in fairies than why were you searching for FAIRIE things and happened upon this page. “oh look its a fairie. ill go check it out” you had to have thought something like that you idiots. ever wonder where the basis and title A FAIRIE TALE came from???? FAIRIES x_X
cool.
I can do those fairy wings too (they’re made of bleached leaves)
but still I do believe in fairies ^^
when i first seen this pic i though it was real, but no i know other wise lol very gd tho. its a shame its not real but there is still hope :)
tutte cazzate nn è vero niente!!!!!!!!1
hi! I thinck thath fairy’s existe because they are special
tings but i thinck it’s true bot be carfullthey mith be dangeuros
Come-on !!! Stop poluting every on !!! They nid to survive!
Im sur that there is maini mor to se!
Maini? Or do you mean Miami? Which sounds nice and warm and sunny.
Although I could do with a Martini roundabout now as well..
Ooh yes, shaken, not shtirred for me, please.
“Shtirred”? Seems to me you’ve already had one or two, eh?
wow that fairy looks dead if i was that thing i whould kill myself one minute im the im dead already hahahahahah
well people please just stop huffin and puffin about it stop talkin trash if you dont believe and go on with your life and leave us who do alone and one day when we get full proof to rub in your face then lets see you all big shot then talking trash a am 17 years old and i do believe its hard to but like a few comments up about god well i never seen him either but how did i get to step on earth if it was not for him in my case i say keep up with your work RC 8) your amazing off and out peace
oh my god!!!!!!!! what is in your head people!!! even the owner has already published the fakeness of this thing!!! is NOT real at all!!! c’mon!!! he even apologized!!! what is next? the lake ness monster remains??????? i think barney is a real dyno too!!!!and i have an unicorn in my backyard!!!
tha bag’s evidence? how dificult is to print POLICE EVIDENCE… i have some million dollar bills i bought at 99 cents! i think they are real too!!!
my god!! grow up people!!! the creator has apologized for the shock his creation made!!! IS NOT REAL
C’mon, folks, have you never seen a cicada before? They are absolutely real.
Oh come on, folks–Err on the side of the evidence.
The person who found this has obviously presented it in good faith to the world, and for that reason alone it deserves at least a little credit.
Just because you haven’t seen something doesn’t mean it doesn’t exist.
I wasn’t saying that–I meant that no matter how crazy the poor guy who found this thing is, you have to factor in that he really believes this thing is a real “fairy.”
I mean, anyone with half a brain knows fairies don’t exist, but common sense never was all that common.
But anyone with both brain halves know that fairies DO exist, and no, I’m not gonna make a joke about Proposition 8.
If they didn’t exist, why would we have a name for ‘em?
We-ell we have a name for penis envy, Jordan and Micheal Jackson but none of those exist – the’re just human constructs.
However, Metro – it is against all the laws of physics, is it not, that bees can fly? Yet they do.
Everyone, QUICK! Clap your hands and say:
I do believe in fairies,
I do believe in fairies..
OMG!!!!!
It has been a while!!!
So much I’ve had to read since September 20.
Hmm…. Still looks like we have a bunch of naysayers and the same people educating them just like always. Mothing really new except for the fact that I found out Philipia doesn’t believe in Micheal Jackson who I know is a very real and VERY VERY VERY SCARY person. But other than that nothing new. Oh well I’ll get over the fact that I didn’t learn anything new today.(3:50 my time)
Michael Jackson is a cicada, too.
No, he’s a chimera.
And for pete’s sake use the other half of your brain. This is a cute model, passed off by someone as the real thing. But it isn’t real and won’t be, no matter how much wishful thinking you apply.
We have names for phoenix, don’t we? Also cyclops. But how many have you ever seen, eh?
Her Grace the Marchionesse de WitchHampton under Buzzard etc
Your Grace
1257 ScHocking – what do they teach in Canadian Schools these days
A Young Man (however able and entertaining) who asserts the existence and indeed give the Korrekt SchPelling of a Chimera is hardly in a position to denounce l’existence d’un Cyclops
….. and we have all seen ein Phoenix …. or at least those of us who have had le taste et discrimination pur voir that ‘Arry Potter film
… and if one is to err, one should never so to do in favour of the Facts
Yr Grace’s servant obedient
L’Aigle Gris
Metro–
Using only the third half of my brain(the half that I leave behind the couch, and the one that you apparently don’t have) “Chimera” is a synonym for “cicada” if you’d take the time to peruse teh latin. Please define your version/re-definition of “real.” I stand by my statement, and it stands by me.
Phoenix is a city. Cyclops is/was a one-eyed cat borne last year whose image was spread all over the internest. Both exist, or existed. Do you still sleep on a futon?
Whoa. Eagle’s here, too. The man who can look at a grape and not comprehend the raisin owns the name of Metro.
Her Grace Scarlette, La Marchionesse de W under B etc
Your Grace
It is a Truth universally acknowledged that more is there to Life than le Raison
Le Raison is merely the deSiccated remainders left after the removal of the life-inspiring Grape-Juice that is presequent to that Fermentation, to which Port is the consequence
Yr Grace’s obedient servant etc
L’Aigle Gris
… errr … embarrrasssed shufffling from left talon … and back to right talon … shouldn’t it be CHIMaERA (Greek)
Yep. Aye, mate, any port in a storm.
Surely you’ll never need any port while there’s still Sterno available?
You assert the existence of fairies because we have names for them … Are you now saying that the flaming bird of legend exists because there’s a city named after it? Or that a birth-deformed kitten gives credence to a one-eyed giant?
Your statements don’t so much stand by you as prop you up, and they’re not doing a very good job.
I suggest you go sift through your couch cushions and find that missing chunk of brain, because operating without it has clearly impaired your ability to distinguish fact from fiction, tell $#17 from shinola, and do fractions.
I haven’t slept on a futon in years. I dumped it in an alley. Check the tag on yours and see if it says “Metro”.
@G Eagle:
Metaphorically, the raisin is what is left when Bunk has finished dessicating the grape of knowledge. It’s shrivelled and twisted and vaguely resembles the original, but it’s nothing like.
I didn’t want you to get mad I’m just saying he does exist, and he is very scary and very gay. we have a saying over here that goes:
“I plegde alligence to the flag.
Micheal Jackson is a fag.
He used to play with little toys,
Now he plays with little boys.”
Pup
Metro–
It’s getting hard to hear you through the pingback list static of SheWhoShiftsToNeutralDuringPrecipitation, and I’m sorry to hear about your extra chromosome. It kinda explains why your logic skips occasionally. My DVD player does the same thing, so you’re not alone.
Let’s take a different tack. Assuming that Faeries do NOT exist, then how do you explain the transformation of your own baby teeth (individually left under your futon within a couple of years after you were whelped) into coins? Physics, whether General, Nuclear or Meta, cannot explain it, but the existence of Faeries does.
Following the same argument, if faeries don’t exist, then trolls don’t either. You cannot deny that you exist.
Now go pull out that last tooth that you’ve been twiddling with your tongue and put it under your pillow tonight. In the morning: Instant Faerie PWND.
Holy faerie crap! Do you know how freakin’ long this page takes to load?!?!
Lori– Click [Control][End] and you jump to the good stuff.
Well it’s making me laugh and that’s a good thing. Crying with laughter.
‘cept the Micheal Jackson bits, obviously. That IS scary.
Hitting control-end only took me to a page containing two Bunk comments. Hardly “the good stuff.”
Bunk, if anything around here shifts to neutral during precipitation, it’s your mind. Shame you live in an area that gets 200 days of it per year.
Your DVD player skips because you keep shoving coasters in it. If you’d lay off the sauce a little you might be able to tell the difference.
It’s not actually my extra chromosome. We keep one of your warts in the secure lab up here. Your profile is in the “what not to do” section of the Mad Scientist’s Handbook.
Which of course would explain why you’d think a healthy specimen such as myself might be running out of teeth. But us normal human types normally keep them for most of our lives. Did you have an accident? Is it due to the nourishing diet of Twinkies and Cheetos on which you subside? Or did you lose all your teeth chasing fairies?
None of my teeth has ever transformed by any sort of magic. Presumably, this being the time of year it is, you’ll shortly be referring to a certain “right jolly old elf” and claiming that if HE doesn’t exist, who brings the pressies, right?
Dear Bunk
Salve
This is very vorrying
The normally sensible Monsieur Ortem seems to be asserting the desideratum of being a “normal human type”
… surely he cannot have been sampling that Stuff that he has been putting out at night for the puir Faeries migrating in quest for a safer habitat, little realizing the perils in his Neighbourhood from (eg) Tree Oktopodia
It is a Truth Universally acknowledged that no-one would want to be Human if he/she had the better offer of being a Racoon or (better) an Aquilan
Your obedient servant etc
and
Vale
L’Aigle Gris
That’s certainly not like Metro. Recommending normalcy? What would HE know about it? He hangs out with me!
Senor Eagle Gris–
The Metro-gnome is out on a limb here (no offense GE) and he’s been backed into a corner. It’s very typical for someone in that situation, when one’s fallacious arguments have run their course, that one resorts to personal attacks having nothing to do with the discussion.
I would never stoop to such blatant character assassination, although I wonder why he seems to be an authority about drinking Sterno.
That in itself might explain why he missed my pun about the omnipresent and Honorable Ms. R’s blogging name, and jumped instead to the bizarre conclusion that I live somewhere that gets rain 200 days a year.
RC– We get rain 365 days a year, thanks to you! =)
Metro–
I shove Coasters into my CD player, not my DVD, but only rarely. Honestly, how many times in one’s lifetime can you listen to “Charley Brown,” “Smokey Joe’s Cafe,” “Along Came Jones,” and “Young Blood?” (Okay I’ll give “Poison Ivy” a pass, just for the one-note guitar solo.)
How’s your “Cowsills Revisited” retro band going? Keep us posted.
Metro–
BTW, I gotta thank you for that virus-laden email you sent me yesterday. V-COM vaporized it on arrival. I also note that since you haven’t posted your usual smarmy response to my comments as quickly as usual that you must have received my “package” as well.
Go to Trend Micro’s website and get a free online scan and pray… assuming you can access the internet at all.
You’ve gone skooters, bro. Do it again and I’ll turn you in to the Feds. Serious.
[...] the disgustion. Dessicated Fairies, [...]
@G Eagle:
I drink antifreeze only when I am attempting to attain the worldview of M. Strutts, or when I’m hanging out with Raincoaster.
@Raincoaster:
You might, in a bad light and by a good-natured, drug-addled, pathalogical liar, be called “normal”. Want proof? Send Bunk a picture. Of course he probably thinks Micheal Jackson’s normal, so maybe we need a better guinea pig.
@Bunk:
Your remarks about failing to stoop to character assassination confirm my view that your mind is going.
My apologies for mistaking your geographical origins–I thought you were a Seattlelite. However, California is also a reasonable explanation: You’ve clearly been smoking something, in any case.
Now as to the question of virus-laden emails: It sure as hell didn’t come from me. However, it can’t be conincidence that my hard drive crashed mere moments after I opened what I assumed to be simply another deranged screed from you.
No need to get the feds involved–they already know. I understand sending viruses with intent to cripple a computer may be a federal offence. The Federal Trade Commission and the ISCC may want a word, as well. Assuming the RCMP can’t find a reason to charge you with terrorism.
Oh, and by the way, I got your “pun,” but ignored the sense of it out of pity. One has to consider the source, and if that’s the best you can do then we should all applaud your little effort. Not everyone is cut out for the literary life.
Oh, and your humourous remark was closer than you realize. I have actually fronted two bands. How are you getting on marketing your CD–What’s it called again? Ah, right: “Bunk Sings Stockhausen’s Greatest”.
I understand that you’re having some trouble finding a new reviewer since the last one’s suicide attempt.
I’d volunteer, but I suffer from some primary defects that keep me from enjoying it as intended. One, I’m not a masochist; Two, my hearing is quite good; Three, I have taste.
Never mind, though. Perservere. It will at least keep you from violating the panhandling laws, technically.
Metro–
My comments have been very civil, but your anonymous phone call to the police wasn’t. Way to go, scaring my wife and kids like that. Your false 911 calls have been logged in as blatant harassment since you’ve done it twice before. That you live in Kanuckistan doesn’t let you off the hook for internet malfeasance under U.S. law. You are dangerous and deranged, my friend, aka Klaus.
Hey–I never made any anonymous phone calls. All my reports to the police have been signed. I had no idea they were already watching you, and they wouldn’t say why. But if I gave them the excuse they needed to execute the search warrant, then I am happy to have performed a public service.
I’m really sorry if your wife and kids were frightened, but at least you’re not having to explain to your boss why the company intranet shut down, and why the RCMP have forensic IT inspectors looking at the servers.
One of us needs therapy alright, and it would be you. That video link was clear proof. You remind me of someone … Ah yes: this fellow.
You’re getting on my nerves, amigo. I’m a nice enough guy to let this drop here, but I wouldn’t push it if I were you. Just friendly advice.
Metrogue–
Keep ranting away, boy-chile. Everyone sees through your unfounded accusations. Comparing me to Oingo Boingo’s Danny Elfman is an insult? He’s one of the most successful composers in the business, you dork.
Suggest you hunker down a bit, bro, so the RCMP doesn’t find the teen skirt porn on your company server that you described to me in detail last June.
You know what I’m talking about: mirrors on your shoes, up the dress… You’re a sick person, sMutro. Why don’t you off yourself and give us all a break.
WooHoo! Just got a call from Dudley DoRight. I allowed the RCMP to access my computer remotely and scan for nastiness. Ain’t nothin’ here, Metro. Loser.
00:19AM ALL CLEAN. Heh.
That’s because I took the most incriminating stuff off. Mwahahahaha. So now you initiate flamewars whenever my hits drop too low OR I tell Dick Cheney what you said about him!
So yeah… Pretty fearies..
And this page now takes forever to load. I can see why ICHC restrict their comments now!
Oh come on! This is just a Winnipeg mosquito!
Those wings are amazingly intact for having come out of a police evidence bag.
Metro– She’s onto us. And we didn’t even get to the all-caps screaming phase.
I think that faeries exist in remote locations, but are only present in our own minds. I’m not agreeing with Bunk nor Metro.
Indigo sums it up very nicely and I completely agree although he is absolutely incorrect.
While Indigo’s statement is incorrect, I agree with it.
That was fun. We should do it again sometime, in the spirit of bipartisan co-operation and all that.
WOW YOU GUY TALK A LOT!!!!!!! =P
WOW YOU GUYS TALK A LOT AND JUST OVER A fairy. that may be
the last fairy on Earth. if someone killed it i will find
them and make them eat poop! =p
ok i think now from all of that talking you 102!!!!!! but i
have one that to say or maybe two. i like pie and la la la!
destiny– Love your comments. You’ve summed it up very succinctly, with emphasis on the first syllable. But there is still some confusion. Care to elaborate?
[...] nisan şakası mummified fairy remains found!!! raincoaster BBC NEWS | UK | England | Derbyshire | Fairy fool sparks huge response __________________ [...]
[...] bir 1 nisan bamls sitesinde bir sonraki sene neler yapmay planladn da anlatyormu… mummified fairy remains found!!! raincoaster BBC NEWS | UK | England | Derbyshire | Fairy fool sparks huge response __________________ [...]
HI
1293 Hi
Her Grace la Marchionesse for G-G
now she has a Lap=Top
Yay! I humbly accept the nomination, now that I have a computer capable of actually reading my own blog!
Bites fingers in order to avoid typing something about finding a lap … and amazingly succeeds.
Your own fingers, Metro?
Come on, people! 1300 for Christmas???? Please??????
I don’t think I’ve ever seen someone whore a post out this much. I am impressed!
rain– How ’bout an update on the stats for this whored out post? Maybe a screenshot of the graph? I’m willing to interpret it for Metro.
I was going to put that as a comment here, but A) can’t put images in comments and B) if I make a new post I can whore it out even more!
[...] and Bunk, over in the popular Mummified Fairy Remains thread, were [...]
You’re just whoring this post out to try and get more comments. I refuse to be drawn.
Oh, wait…
GOTTTA DO IT!
1300!!
They exist. Like whatever.
Heh. What say we go for two k by the end of 2009?
Shouldn’t be too tough, especially when I get to call Metro a penisoid without serious repercussions.
=)
So far, so good eh?
Her Grace La Marchionesse Scarlett de WitchHampton etc
Your Grace
Je ne desire pas sounder troppo specie-ist
BUT
After 1301 Comments, how can even a Racoon add ONE Comment and then total the Comments up as 1,300
It’s si triste that these Racoons seem not to have had the benefit of the UK’s National Curriculum at School, where arithmetics are encouraged
OR perhaps what they lack in Mathemagical calculation,they more than make up in artistic & entertaining talent
AND as your Grace commands :
The Ha! you say. Well, this is certainly unusual to say the least. I think you might be on to something here. So, I say Ha!
It’s the New Math!
I help to you! Comment No. 1310 for the dead fairy!
The real amazing thing about this post is the number of comments.
Ahh…Raincoaster…you make me chuckle.
I am going to blogwhore this post tomorrow…hahaha…
Hope you get your comments…
Is that paper mache?
Marina
Shocking
What kind of suggestion is that, to make about something brought to the attention of the Public by a Derbyshire man
What would Mr Darcy say !!
Is that the Real Estate Fairy? That would explain what has happened to housing prices in Vancouver! Those bastards need to put her back to rest in peace!
There may not be a tooth mouse, but there IS totally rad and aweseom Mouse Woman! Book by Christie Harris. http://tinyurl.com/6l2e4w
Awesome and fun book! And didn’t first nations have some sort of little people lore? I can’t remember their name though! Starts with an “m” or “w” I think and is long and complicated. Raincoaster, you should know the answer with that logo, and since you are an expert on paleofaerie species and all… (this may have been discussed but I must confess I skipped some posts!)
Ok, that’s my 2 bits!
GE esq– I was only congratulating the ONE on achieving her goal of 1,300, not claiming a point for myself as I had no way of keeping count. Tambien, es muy triste que la palabra “raccoons” tiene dos letras “c”… Ahora tengo talons que vayan izquierda y derecho, como sus.
86 to go!
And there are lots of little people myths among First Nations people; as many as there are different nations! But since this was found in Derbyshire, I’m assuming it’s ye olde Englyshhe kind of fairy, with which we are all familiar through our colonial educations.
Kye, they obviously took her out of her barrow. She’s homeless! That’s what’s causing all of this…mortgage market collapse, bank bailouts, the whole thing…it’s so obvious, in retrospect!
Maxwell Smart. To go.
Or is that for here? If we put him in a porcelain mug he has a smaller carbon footprint.
But you know what they say…small carbon footprint…
Speaking of Faeries, aren’t they related to the Menehunes of Hawai’i? They’re a pain over there. What about the ones who are attacking El Coyote in West Hollywood because the lady who owns the place is a Mormon and donated $100 to preserve the definition of marriage as that between a man and a woman?
wow !a real fairy!
Quick Henry! The Flit!
i believe in fairies and I have sen one.
One time I yawned and one flew into my mouth. Tasted like dust and MilkBones.
Oh, bunk, Bunk! lol
Bunk…can you fly now?
No, but my farts smelled like pixie dust for a few days.
i believe in fairy but I have never seen a fairy before but they might be living in some where else..;)
When fairies stop believing in people, people will cease to exist. Or not.
Fake…
Doubter! Proof?
I don’t think Stella exists.
Stanley disagrees.
Stella exists, but tastes far inferior to other Belgian beers. What say you all?
I’ve had my share of Belchin beers and taste had nothing to do with it.
Belgian beers pale in comparison to Dutch brews. Grölsch pulls an Australian Toaster Biscut (makes my mouth waaw-tah!). Heinie can just go ahead and cover its face in shame as it gets beat out by Olympia Gold.
Stella is and always has been no good, but the other Belgian beers are pretty damn good. I think the quality of the beer varies inversely with the amount spent on marketing it.
In Stella’s case the quality varies proportionately to the amount consumed.
Yes, at least until the next morning.
When Artois comes knocking…
I always forget him. There’s Artois, Portos, Sleepy, Doc, Marcia, Jan, Peter, John Boy…who else?
Metro.
Geez, you disappear for a month and people are all over the place taking your name in vain.
I can’t load this page at work anymore. My computer is too slow. I almost named it “Bunk,” but I have way too much class.
Metro, we didn’t disappear for a month, we are not all over the place, and nobody took your name in vain. Seems to me your load is your problem. Welcome back.
Aside from grade school, where did you get the bizarre idea that you had class?
http://www.hoax-slayer.com/derbyshire-fairy-hoax.shtml
Ah, you’re going to take the word of some uncorroborated site whose business model it is to prove things don’t exist? That’s a vested interest if ever I saw one. And they freely admit that they didn’t examine the object in question themselves, although they had the chance to purchase it for a very reasonable price. That? That is the sound of fear. The fear that their cosy little “debunking” world would come crashing down around them if they dared to actually investigate.
I could probably find some nutter to claim he invented zebras, and there were really no such things. Would that prove zebras to be a myth? I don’t think so.
DEMAND PROOF!!! MAINTAIN THE SCIENTIFIC METHOD!!!
Ja, ja, bestimmt
Concisely put
WOW YOU GUYS TALK A LOT AND JUST FOR A FAIRY! I DON’T THINK IT’S REAL. AND IF YOU GUYS DO I THINK YOUR STUPID TO BELIVE THAT. IF YOU SEEN IT IN REAL LIFE AND YOU KNOW WHERE TO SEE IT THEN TELL ME PLEASE, BY THE WAY… YOUR YOU GUYS GROWN UPS, TEENS OR KIDZ?
hey every one hi! your nice and some are poop poop heads ha!i was just kidding!
thanks!oh and if you say the fairy is fake your stupid or your mom droped you on your head a lot!i think its both!
ok i’m going to say one more thing
But sadly ‘destiny’ did not. Probably went to bed early. Dear child. Listen closely in english lessons, dear. Especially the difference between your and you’re.
I want to know what Droped is! It sounds exotic. Is it a Druidic ritual or something?
Destiny gave rebirth to an old thread. Do not mock him/her. Leave that up to the professionals.
Interesting thread, to say the least ;)
Glad you enjoyed it. Did you see the part where we were tossing dirty puns around in Latin? That was a high point. I need either more caffeine or better gin to reach those heights again.
You were tossing dirty puns around in Latin? Drat, I missed that.
I didn’t know you studied Latin. Do you have the skirt and everything? Is there a vid?
ha ha ha hue hue hue is that true?
The fairies exist. They are responsible for the Miracle on the Hudson, which shows how nice they really are, since several hundred were found mangled in the engines.
My god! I didn’t hear a thing about that; there must be a coverup!
Trojan geese.
This!
Is!
Canada!
Faeries totally do exist!
Does Sami have totally additional Proof? Gotta trash the naysayers.
Hmmm, although I feel this is not a real fairy, I believe. And although this is a blog about who believes, and who does not, is the name calling found in the early section of this blog really necessary? If you don’t believe in Faefolk, just say so and move on with your life. There’s no need in bringing male and female genitalia into this, because this is not a blog for that. Oh, and btw, anyone who misspells ‘vagina,’ and then goes back to try to correct themselves, only to misspell the word again: you’ve lost your typing privileges until you can find a dictionary or receive a passing grade in Spelling & Grammar. Got back to the 3rd grade, sweetie. [PS: Today is my birthday, the Faefolk and I are going to celebrate in a Fairy circle dancing the night away.]
Oh, there’s obviously been a terrible misunderstanding. We are ALL ABOUT the namecalling around these parts, particularly where Albanians are involved, or at certain times of the month. This is a blog for the most remarkable trash-talking, I can assure you. I know the owner.
Is that so? Well, my apologizes for my ignorance. I guess I missed where the discussion went from ‘Is this real?’ to ‘You cocksucking sonofabitch!’ I’ll be sure to keep that in mind for the length of my visit here on this blog. C=
it is realy? no i’m sure…
Julia, darling, if you wander around the internet telling people what their blogs are about you must expect to get smacked upside the head now and again. Consider it a learning experience.
And yes, you’ve obviously managed to skip the great Metro/Bunk debates.
Rain– Last night I realized that I’d never read all the way through this thread. (Mr. Smuggles obviously was off his meds.) Hope that Julia understands that he was a bizarre aberration to an otherwise thoughtful debate.
Metro & I were having fun, but then you called us on it. How big a traffic spike did you get during “The Faerie Wars of 2008?”
Unfortunately, not enough. Not nearly enough. My friend Arieanna has over 1500 comments on her post about the Victoria’s Secret fashion show. It’s just not fair! They have wings, fairies have wings, I thought Victoria’s Secret was really popular with Fairies and vice versa!
So, like, um, you’re giving up? Screw Arieanna. He’s going down like Dracula’s boyfriend. Down for the Count.
Okay. “She’s.” Same difference.
Giving up? Oh, hardly! I’m resolved to pimp this thing out on Twitter at least once a day until we pass her. She hasn’t had any comments in months, and obviously we’ve got momentum on our side.
Lemme know if I can help with your pimpage. No charge. Think of me as your benevolent slut.
1376
Your Grace
I flatter myself that I agree with that Young Lady on so many things (eg the more amiable spelling Julia, in preference to another aberrant, anti-soviet spelling)
BUT
I don’t think that Mlle Julia has quite got it
Yea Verily, Name-calling … but only in a pleasant & erudite way …. saving and excepting ONLY denounciations of Evolutionistas & Tree-Oktopodia unBelievers and Harrumphers (especially in Latin)
and one can end this phase of the Long-March to 3000 Komments only with the Langweilig Senator Cato’s memorable Saying :
Carthago est Delenda
Your Grace’s obedient servant etc
G Eagle
i think fairies really do exist wether seen or not. and that mummified pic does look real but who knows wether or not it is. things we can do with technology these days.
I would like to believe in the fairies. But nowadays already everything solvable with the technology… you do not know it we you are the true one false.
I think we should look around and see if we can’t get a fairy to make a comment. That’d settle the doubters!
Carthago est Delenda FTW!
Hey stop fighting! Don’t you know that the fairy was my cousin! Yes we are true stop non-believing or you shall kill me next!
OMG TINK!!! I thought you were dead!!!
Well I’m not dead. But my cousin is!
R.I.P Lucindia
Tink you little slut. There you go spreading rumors again. You’ve been a pain to me for 112 years now, just because I’m big boned. Get off my ass.
Fairies are always so bloody dramatic!
i believe in fairies thier fab so there stiletto !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! eat that !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! poopoo
I wouldn’t dare Stiletto. You just don’t know WHAT that girl might do!
1385! Only 115 more to hit 1500, only about 150 to pass Arieanna. ONWARD, my friends! For Friendship! For Glory! For Spartaaaaaaaaaaaaaaaaaaaaaaaaaaa!
I totalyyyyyyyyyyyyyyyy belive in fairies!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Seems to me that Alexia is suffering from a bout of plagiarism. Look at the similarities between her comment and that of Roxie’s, i.e., “!!!!!!!!!!!!!!!!!!!!” and “!!!!!!!!!!!!!!!!!!!!!!!! poopoo.”
Am I missing something?
Well on BBC it says that it was just a prank but it looks like it could be real.
Bunk, good catch! Someone should report that!
Ariel, it ill behooves one of your illustrious name to sow seeds of doubt, however tentative. After all, who are you going to believe: The BBC, or some blogger you found on Google?
Reported as requested. As for the BeeB, I’m guessing they’re covering up for their own 25% by denying it.
I dunno–I’d believe it more if it wasn’t the Beeb. I mean, who trusts fact-based reporting?
Now if it was on FOX, or maybe the Sports Network … I’d totally believe fairies were sponsored by Coors Light.
No, I’m with Bunk…there are too many of them actually working at the Beeb. It’s a coverup job.
Now, who committed the murder? Is this a case of fairy-bashing?
I must do my part to bring the comment number up. I apologize for coming so late to the discussion. I have just read this entire thread and now my tea is cold. That is how fascinating a read it was, it made me completely forget that I had tea steeping, it also saved me from brooding about the fact that my poor darling husband announced today that he is depressed about his life and doesn’t want to talk about it and when I came back from walking the dog at 8:30 he was in bed. So the Metro/Bunk flamewars were definitely good for something! Thank you all.
I believe in fairies, also dragons. I have many dragons in my home and they are touchy things go live with. I suspect fairies might be as well. It was gratifying to finally see proof that fairies exist, even though the discoverer has reneged on his discovery, I’m sure that it was under duress.
I believe! Long live Raincoaster! Long may this thread become, and in record time.
HMH– Dragons are easy, like dogs. Dogs demand food and attention, but that’s all. Fairies are petulant, like, um, well, fairies. They abhor attention, complain about not getting any, and then get all humpy when you get the badminton set out. You can’t reason with ‘em.
Not only that, but they are prone to swap babies out for their own and only tell you years later. Also, they drink like fish. Very few people know that.
Bastards.
Cutsey little baby swappin’ moth lookin’ bastards.
Exactly! That’s the spirit! Buggers have a noted tendency to make off with decorative youths as well, return them eight hundred years later for that Rip Van Winkle cultural dislocation, just for shits and giggles.
Your Grace
This is a serious Educational Blogge, much appreciated by Ladies, Children and erudite Animals
It would be matter of Profound Obligation & Gratulation if your Grace could prevail upon the perceptive Monsieur Metro to refrain from using the “Light C….” Expression
ScHocking – inexcusable when he could have given Guinness a favourable mention
No wonder there are not more Live Faeries in the Tree-Octopus Forests of Canuckistan, if this is the kind of Beer that they’re expected to imbibe as a Palliative to the Recession
Yr Grace’s obedient servant etc
G E
He has been known to consume Pilsner. No word of a lie: Pilsner. And he doesn’t even pretend it’s not voluntary.
1401! Yay!
Isn’t that a first: you read the label of something before drinking it! Good for you.
Though I wish you’d started doing it earlier–Windshield washer fluid is expensive.
I submit that light C, nay any “light beer” is not actually beer but diluted piss, most possibly piss from draft horses, and should not be mentioned in the same breath (or blog?) as the hallowed brews such as Guinness.
Perhaps I am living with a petulant fairy child sneakily snuck into the large brood of children produced by the parents of the person I am presently co-occupying with. That would explain a lot.
Dragons, being magical on their own account are not averse to peeves and petulance themselves, and considering their fire breathing properties and general largeness can be quite appalling when petlized.
Not that I would ever doubt a tiny fairy’s ability to make life miserable and create destruction in their wake.
HMH– Are you talking about Darryl (The Captain and Toenail) Dragon? I didn’t think he was magical. I thought he was a schwantz.
Maybe HMH was referring to Ricky “The Dragon” Steamboat?
He was WWF, and displayed a certain amount of peeve and petulance during that time. But I think that was in his contract, so I’m not sure it counts.
WWF? Wide Wharf Fairy? Maybe http://www.carmendragon.com/ instead. I dunno, Babs. I’m just shooting in the dark at a moving targoid.
What if HMH is really talking about Dragoons?
ewwwwwww. that is sooooooo gross but kind of cool and the close up! yoi can see its bones oh and i have a question IS IT REAL???????? it looks awesome
i love faries but not dead ones!!!!!!!!!!!!!!!!
That’s good. It would make you a gay necrophiliac, and that could seriously damage your chances of getting into a good school
Okay, no doubt I love fairies, but this is overboard. I don’t know if it’s real or not but like somone else said, let it stay in the imagination.
Ah, another who claims ambiguity. Can you people not SEE the Police Evidence Bag? And latex gloves? What kind of two bit hoaxer would wear genuine latex gloves? I ask yez.
poxa eu não sabia que fadas existiam, achei muito interesante, é incrivel estou sem palavras, é inacreditavel, achei muito legal.
Se ou acredita, ou um não faz. A opinião não muda a verdade.
Babelfish sucks.
[...] if you want to see a genuine dead fairy, click here, and be sure to check out the comments… over 1,400 of them, and counting. Join the Great [...]
What’s Portugese for “Babelfish sucks?”
hey this is so cool!!!!!!!!!!!!!!!!!!!!!!i am the bestest fairy fan in the world!!!i practiclly screamed when i saw this!!!!!!!!!!i hope that u like this as much as i did!
Babelfish suga, according to Babelfish.
i do think fairys exist but how do you know that it could be something else and with four leaves stuck on to it .
but i could be wrong you will never know in a million years
I think fairies are real but that one is fake they don’t really look like that they are smaller and live all around us they also make things go missing sometimes. And they love shinny things ,thier favorite to do is take your keys and hide them cuz they jingle and they;re shinny
Bye Bye now
Did the gnomes put you up to this?
DID THEY?!?
wat ever
A GNOMISH SPY!
What kind of shinny things do fairies like? Would those be tibial shinny things or fibular ones? I was unaware that fairies had an obsession with hockey goalie and baseball catcher protective gear. . .
you guys im a girl and bunk strutts i like the way you think! oh ya rhilipa i don’t care how you spell it it sounds right to me!and i go to bed at nine i am told i have to and i do!you guys don’t talk about the fairy a lot.and im only on on the week ends and raincoaster you act a little like your very smart. how old are you guys?but i have one more thing to say you guys rock! how you guys act like if some one do not think the fairy thing is not real you say some thing to make them think its real!
I LIKE THAT! IF YOU KNOW WHAT I MEAN!? AND ITS WAS DESTINY
destiny was here
i mean if the faiy thing is real! NEVER MIND!!!!!!!!!!!=P
=] ;] -.- ^.^
OMG I SAID AND ITS WAS DESTINY I MEAN THIS WAS DESTINY! GIVE ME A BREAK YOU GUYS! please?! AND I SAI IF THEY DO
NOT THINK THE FAIRY IS NOT REAL!!! OMG I MEAN IF THEY THINK THE FAIRY IS REAL! or i think that is what i mean to say i don’t know you tell me!!!!!!!!!!!!!!!!!!!!!!!
TY DSTNY UR D 1LY 1.
BNK
Zac Efron is SO banned! Stupid little gnome!
plz wright back and plz wright a little more facts about the fairy i would love to hear more oh and just olny post it to me….:-)
No.
Next time, bother to use old goose feathers, or raven feathers, heck, any feathers, but not decomposed oak leaves. Hey, anyone ever actually seen a bird?
Feathers? FEATHERS? What kind of demented pervert are you? Fairies don’t have feathers! You’re some kind of avian necrophiliac, aren’t you?
I might have had my doubts if it hadn’t been for the presence of the Police Evidence baggie in the photography. Suddenly my skepticism vanished. Good work uncovering this, raincoaster.
I live to serve.
So all a scientist would have to do to test if your fairy is real or fake would be to take a strand of hair from the head and test it for DNA. If it comes back human than its probably a prank. If it comes back something else, well then I would image that you might have yourselves a real fairy.
Faeries don’t have DNA. They have WTF instead.
Alas, we’ll never know. The corpse was purchased by an unnamed cartel and hidden away, never to be examined by Science.
GNOMES!
OH MY GOD YES! OF COURSE! how could I have been so blind?
The BASTARDS.
Cutsey little lawn sittin’ Santa lookin’ bastards.
Fuckers! Why, there’s one out on my patio right this minute! The raccoons turned his head to the wall, but that means nothing to the metaphysical beings.
I see I need an exorcist!
ii wanna say iis thiis real because i dont no if there real but i do belive in them
Well, we have more photographic evidence coming soon, don’t you worry.
You guy’s need a life i beleave in aliens sum what but FAIRY’S please only on my wall they are real.hahahahahaha…..GET A LIFE……..
You have a wall of fairies? What is that, taxidermy? OH MY GOD YOU ARE THE KILLER!!!
I think he’s referring to decoupage.
thats made of clay
And THAT is what you call a completely unsubstantiated claim.
Jack meant clam, and vice versa. It’s made of clam. Completely unsubstantiated clam.
1452 – wasn’t that the year before Constantinople was liberated and 40 years before the Mexicans discovered Columbus
If the perceptive Senor Strutts is right, how can we be sure that no clam was hurt in the making of this Post
But DO clams transubstantiate? I thought that was just bread.
And wine, don’t neglect the vino.
I NEVER neglect the vino.
wow I THOUGHT THIS WAS 4 REAL!! no way its fake i say they did a good job!! but its kinda creepy!!! :, really sigh!:(
god you guys are idiots aye fairies are NOT true ok. believe in something else like ghosts and all that. i’ve been in a fairy ring at night time and i DIDN’T SEE ANY FAIRIES
You guys have to grow up and get a life aye. i’ve seen ghosts and other freaky things ok. fairy’s were probably alive many many years ago when the gods were first introduced you know hercules yeah but it is best that you only imagine them and don’t say nefin 2 anyone because people might think you are loopy and shit so yeah just listen to my advice and believe in something else. N hey you know that there are more than one god kos the black hole leads into many other galaxies so why just beieve in one god when there are many more.
You don’t believe in fairies because you were in a fairy circle once and you didn’t see them? But you didn’t see me either, did you? And I’m right here. Explain that one.
Beer goggles.
Obviously. How people can be so incredibly dense…on the other hand, there’s no proof I’m NOT a god, right?
More beer goggles.
ooohhhhhhhhhhhhhhh my gold…ùù
ma è fintooooooooooooooo
moi je m appelle thirtsa pis chut certaine que les fée existe
Fairies are real damn it!! Look at the damn proof right here !!! wtf!!!
made ya look didn’t it!!!
Now we’ve got an international coalition of Fairy Rights Activists! There will be no stopping us now!
Funny, she’s in the same position as Ötzi was found. :)
Congrats to the creators! Good job! I wish I was such a good miniature maker…
L.
Ötzi? Wasn’t he found in a foetus position?
Well obviously; fairies were never fetal in the first place, therefore they do not assume the fetal position, while humans do. Duh.
So if fairies are not ever fetal, do they spring fully formed from the brow of their parent, like Athena being born from Zeus?
Blaspheming magic hand healing skeptic.
I think they come from mushrooms. They crawl out from between the folds on the underside like baby kangaroos.
Now I gotta clean the snot off the monitor again.
Only bogeys come from snot! You could have a bogey outbreak in your computer now!
[...] Recent Comments raincoaster on mummified fairy remains f…raincoaster on quiz: which aphrodisiac are…Bunk Strutts on mummified fairy remains f…Bunk Strutts on quiz: which aphrodisiac are…raincoaster on mummified fairy remains f… [...]
this is amazing are these actuly real?! do you have any other photos of these amazing creaturs?
While the pictures are fascinating and the story an honest wish come true (apart from the fairy being dead of course) the best part of this blog has got to be the comments.
Such witty debate/combacks.
And I do believe in fairies. I do, I do~
We are glad to welcome another True Believer into our happy coterie.
(Psst. Sarah. Rain ignored you. Don’t get sucked in… Stand up to the Vortex.)
Not at all. We must all sooner or later face the truth. Allow me to present THE TRUTH:
http://raincoaster.com/category/fairies/
Wow, this is a REALLY long debate! Ha ha ha! It’s a really authentic looking picture! I hope it isn’t a fake: It would be SO cool if fairies exist! i believe in fairies. When i was a little girl, me and my freinds used to play games and pretend we were faries! I still believe in them. Well, i was actually looking for pictures of Nessie and for some random reason i found this! Ha ha ha! Well, i hope faries are discovered and protected some day! XXX
Protected??? WHAT A FABULOUS IDEA! Yes, we should contact teh World Wildlife Federation and get Sting to do a telethon or Saint Bob Geldof to do a concert. Yeah, that’s a brilliant idea!
Dear Mr. Raincoaster,
We understand you have questions for the World Wildlife Federation (WWF) regarding our work with species preservation. Please be assured that a donation is not required at this time.
Cordially,
Dr. Robert “Bobbie” Bieber, FFS
Gladstone, MD
[Automated response generated by TorpalSearch, Inc.]
Super! When can we expect fairies to become a protected species? They’ve been in danger of dying out for over a century, as the great playwright Barry made clear in his magnum opus, “Peter Pan.”
Dear Mr. Raincoaster,
Thank you for contacting the World Wildlife Federation (WWF) regarding our work with species preservation. We appreciate your kind offer to volunteer, and hope that you continue to support our efforts to assist endangered species and to preserve the environment for future generations.
Please fill out the attached form so that we may better assess your strengths and desires for species preservation worldwide.
Cordially,
Dr. Robert “Bobbie” Bieber, FFS
Gladstone, MD
[Automated response generated by TorpalSearch, Inc.]
We’re making progress, people!
Mr. Raincoaster???
I definitely believe in fairies and I strongly support your endeavours to have the Little People protected. I look forward to reading a policy statement intended to provide a guide for stakeholders in determining whether any proposed action is likely to have a significant impact on the FF in temperate and semi-arid areas across the current and historic range.
Hmm, the impact of global warming on fairy populations. It’s been mentioned in this thread before. A conspiracy, perhaps? There is so much to think about.
Az: what can you expect from a bureaucrat?
HAHAHA!!! This is so fake, it’s not even funny!
Why do people waste their time tyring to trick people into this crap??! It’s utterly absurd.
Again, an usubstantiated, poorly-spelled attempt to put down the truth. You make me laugh.
Personally, I spell it “færie”, but then I’m ancient. HUZZAH for the news, howsoever.
Re: FairiesRFake’s comment: Could it be? After reading his/her/its clear logic, I’m beginning to have doubts. What if this really IS a hoax/hosejob and we’ve been defending it all this time? Oh man…
I became uncontrollably excited when I saw my comment count on this post was at 1505, but sadly that was a fakeout; no doubt the faeries/fairies up to their old tricks! Leprechaun gold…faierie comments…same old same old!
A married couple in their sixties are visited by a fairy, who grants them both a wish.
“I want to travel around the world with my husband”, said the wife, and two plane tickets magically appear in her hand.
The husband says: “sorry love, but my wish is to have a wife thirty years younger than me”, so the fairy waves her wand and the husband turns ninety.
The moral of the story: men who are ungrateful bastards should remember fairies are female, as this one clearly is.
A married couple are visited by a fairy, who grants them each a wish. The husband wishes his wife had bigger boobs, and the wife wishes her husband had a bigger swantz.
The fairy grants them their wishes.
That night, at the stroke of twelve, Nancy Pelosi, Harry Reid and Barney Frank all materialize in the couple’s bedroom and discuss prosecuting them for imaginary transgressions against THE PARTY.
Her Grace Scarlett RegenCoaster La Marchionesse de WitchHampton under Buzzard de La Zouche
Your Grace
Buona Giornata
In these ever=gloomier ErgoNomic Times, this Serious Erudite Educational Blogge still attracts such Earnest Debate, Humour (err …. humOr, for visitors from the Middle Colonies) und 1497 Komments
Even the entertaining Guido Fawkes scored only 1294 Komments on 19 April, despite its Tragique Human-Interest Tale of the ScHocking Spillage of Holy Liquid (err … for non-Oirish visitors – Guinness), in what was surely not a malicious politically-motivated incident
Truly did Cato say :
Carthago est Delenda
[Lower Beer Taxes]
AND indeed
Scipio Africanus has been vindicated, when observing with such economy of language & directness of perception :
Nil ReiPublicae Romanae Desperandum est
[God Save America from the Republicans]
J’ai l’Honneur de rester le Vestre Grace’s servant obedient and
Ciao
Der Graue Adler
G. Eagle, as always a pleasure to welcome you back to the blog and this thread. Even if I must do so with a dictionary in one hand.
Bunk: I don’t know, that sounds like QUITE a party to me!
Karl, thank you. Yes, something to keep in mind, definitely.
Ha! they finally killed off Tink XD hehe
Is that fairy rill or what cuz i want to now!!!
Wow…briliant!:)
Yay, 1502!
Miriam: perhaps you are on to something. This could be the remains of a Rill Fairy. One of the most elusive variants. It isn’t very common that a rill is large enough for a ring of mushrooms to grow in (that would usually require a gully or an even a streambed), but it IS possible that is where this fairy came from. I would like to look into your hypothesis further, but I would need to know what from the picture first brought you to this notion? It’d really help as a starting point for the research.
I am so, so very proud to be presenting the foremost resource for the proper classification of the wild Devonshire fairy. Truly, the scholarship in these comments is remarkable and inspiring. Surely the same collegial, intellectual atmosphere pervaded Los Alamos in the early days.
Actually I understand that Los Alamos is the very place that a lampshade was first worn on a head during the weekly “brainstorming” sessions. I won’t go into the nitty-gritty, but it is no coincidence that removing one’s trousers while wearing a lampshade is known as “Oppenheimer’s Folly.”
In retrospect, that explains a great deal of the history of the mid-Twentieth Century.
…or at least everything after the Trinity tests.
Zing!
1509 comments. That’s rather impressive! Most one of my posts has is something in the 60s.
This post on my friends’ blog has 1524. Will I beat their record???? ONLY TIME WILL TELL!!!
http://www.blogaholics.ca/archives/2005/11/victorias_secre.html
Good to know you’re not competitive!
I’m the LEAST competitive person you’ll ever find. Nobody is less competitive than me, NO ONE!!!
You’re totally Capt. Apathy of the RCN Indifference when it comes to being competative.
Good God. Tink’s remains were scraped off teh undercarriage of a Toro Mower and the discussion has devolved into a discussion of competivityness. I’m gonna get a haircut tomorrow.
Was it a Toro Push-Pull?
What kind of haircut? A Pixie?
rain…
You know, I just realized there is no scale on the picture, nor anything to judge by in it. This could be a female gelfling!
A reverse mullet.
Well, you can see the size of the body bag, although you can’t really judge what kind of hands those are; it could be a giant!
Bunk, you’re getting a Dorothy Hamill? Awesome. Pix or it didn’t happen (you KNOW we’re all about the evidence here).
I guess I’m out of the loop… didn’t realize that there was such a thing as a reverse mullet. Let’s go back to Dorothy. Is that the witch’s Dorothy? I don’t think she had a mullet, regular, reverse or inverse. What’s the one that Grampa Munster had? I want that.
I think that was a tonsure. Not sure.
You could always get a Prince Valiant (aka the “Anton Chigurh”).
Did the Sluggo thing in elementary school, Prince Valiant in HaSkoo. It morphed into a Joey Ramone/Frank Zappa in college; later it receded into a mashup of Moe Howard/Flock of Seagulls/Mark Trail. Ever since then I’ve left it up to the local Viet Namese barbers.
That’s what I did…ten months ago. Perhaps it is time again.
It’s been nearly a year since I had a haircut (the last was rather traumatic, and the post about that horror show is still doing well on Google) except one done by me at three in the morning over the bathroom sink. Those don’t count unless they’re so drastic people assume you were drunk, right?
I’ve always thought those were the ones that didn’t count. The “so-bad-it’s-good haircuts” are kinda like shooting the moon.
As it happens, I have a post on one of those as well:
http://raincoaster.com/2008/02/02/black-and-white-and-banned-all-over/
That was more of a blog about tattoos that had a hair filling.
Dear Mr. Raincoaster,
Thank you for contacting the Federal Faerie Preservation Society (FFPS)regarding our work with species preservation. We appreciate your kind offer to volunteer, and hope that you continue to support our efforts to assist endangered species and to preserve the environment for future generations.
However, we must inform you that your contribution was not received in a timely manner. This has resulted in the well-publicized demise of a significant number of chimaera, including wood faeries. Faeries do not have a voice: please give them one by contributing today.
Cordially,
Dr. Robert “Bobbie” Bieber, FFPS
Gladstone, MD
[Automated response generated by TorpalSearch, Inc.]
I hate it when government agencies change their names.
That’s obviously why they didn’t get my application in time!
Well you would have known had you gone down to their office and seen the notice posted on the break-room cork-board that the agency name was changing. I mean it’s been posted there for six months, just under the ad for the Gibson guitar somebody has been trying to sell for the last four months.
Dear Mr. Raincoaster,
Thank you for your generous donation of $10.00 per month.
Please forward your contribution promptly such that we may continue to preserve the Faerie Species for all the worlds’ children’s children to enjoy for generations to come.
It would be a shame to see such magnificent creatures wither away, to suffer for days, months, only to die out, when we have the solution for their preservation so cose at hand.
Please consider increasing the amount of your monthly contribution. We may be able to avert this modern ecological holocaust, but only with your kind and generous help.
Cordially,
Dr. Robert “Bobbie” Bieber, FFPS
Gladstone, MD
[Automated response generated by TorpalSearch, Inc.]
The cheque is in the mail. Posties are even less dependable than fairies, however. Not to mention the Posties who ARE fairies.
Small humanoids with wings that deliver messages?
Mini-Mercuries?
Those wings look so fake but the body does look somewhat real, I give 8.4/10 for trying.
Fairies eat cotton candy these days because it’s so sweet and full of sugar!
But if that’s true, how do they maintain their trim figures?
it says its a two inch body…. so the mans hands are two inches long?
Holy Crap, proof of dwarves too! Good catch!
“Body” refers to the torso only. Two inches looks about right.
these pic is cool i think that they r real!!!!!
haha
We Believers must stick together; look how far all those vampire fetishists have come since Interview with a Vampire!
Well, that’s it. I’m convinced.
@Wandering Coyote– Sometimes one must doubt before one believes. Help yourself to the beer in the fridge.
No shit, those damn Nosferatu-Nuts have had several TV shows too!
wait…we have beer?
They do exist!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!1111
@valarmo– Yeah, it’s in the natural ice pit in the back, but now you gotta hack a path since varvara planted the exclamapointweeds. Warning, though: don’t take the Molson’s and replace it with Bud Lite. People will get all humpy and stuff.
rain– The ice pit’s still open, right?
Well, the Mammoth is taking up most of the space in there. But i think there’s room for one or two more.
I want to believe in this but its hard to but this evidence is strong
Honestly, WHAT MORE DO YOU PEOPLE WANT??? DNA SAMPLES????
this is not legit at all. the creator even said it was a work he had created to see if people still believed in faeries. It was sold on Ebay for 280 pounds and is now in the art collection of a man in the United States.
No way do fairies weight 280 pounds. The magical kind, I mean.
*weigh*
LMAO!!! Stiletto you crazy SOB. Great comment on your hair being done by a fairy!
Bunk – They do when they wear their battle armor constructed entirely of unobtainium. Those wings are stronger than they look!
I’ll make my way to the icepit, my bush-whacking skills could use some boning up on. …and replace the Molson’s with WHAT?!?! I take offense at such accusations.
I’d replace it with Oly Gold.
Rain – “AAATTGCCCTTGGACTTGAT” First twenty base pairs of fairy genome discovered by me, cheif researcher into Fairy And unKnown’s Eugenics. It’d help if I could get an actual tissue sample though as that run closely resembles the BPs I came up with for aboreal octopii genome.
If you could obtain a fairy DNA sample from Perez Hilton’s vital organs, I think the gay community of LA would make you a very, very wealthy man. Provided the wound was large enough to be fatal.
And come to think of it, doesn’t he weigh about 280 pounds? Ah, it’s all coming together.
little thing sure is cute!
No doubt about it, those are fairies, not unlike the souther coastal fairies that continue to plague us here.. I have a spray for them
I personally know many fairies. They are a gentle and loving species with excellent taste.
AND it’s such shame that apparently they are so highly valued by Tree Octopodia as a culinary delicacy which is free of Coors Lite Beer, as an alternative to over-blubbered American Tourists
FAKE – everyone knows fairies are only the size of dragon flies – what is this? a mutant giant fairy?
Wow, I didn’t think about that. A giant mutant fairy? That would explain why it doesn’t quite match up with any existing fairy morphology.
@michelle– Your assertion that “everyone knows fairies are only the size of dragon flies” is false, therefore the rest of your comment cannot be trusted for accuracy.
that thing doesn’t even look real! the wings look like leaves, and the body’s proportions do not look real at all. just look at those legs! looks like something i made out of playdoh last week…
I just noticed something else. the 2nd picture features the “fairy” in an alleged forensic scientist’s hands. but the truth is, forensic scientists doing an autopsy in a lab would never pick up and hold the body/evidence like that. I’m sure everyone knows that, so I don’t have to explain anything more.
Ha, the ridiculous claim of someone who’s bluffing. How many forensic scientists have you actually seen at work on a dead fairy? EH? Answer me that! And no, CSI:Palm Springs doesn’t count!
@Principessa– Your assertion that “forensic scientists doing an autopsy in a lab would never pick up and hold the body/evidence like that” is false, as they might pick it up if they absolutely had to. Therefore the rest of your opinion is specious as well.
Not only that, but I’d like to know her qualifications for critical analysis of forensic scientists. I am of the opinion she’s pulling it out her ass and, as you know, we are far too skeptical to fall for that around these parts.
this shit is soo retareded get a fucking real job u pricks!!!
Your comments will be given all the careful consideration which is their due.
Rain– I noticed that the androgynous Ashley Beagle’s insightful comment anagrams to:
“So, A Short Shittier Deed: Is Genuflect a Jug Cab? I Risk Pork.”
Extrapolation requested.
“So, A Short Shittier Deed: Is Genuflect a Jug Cab? I Risk Pork.”
Good catch, Bunk. Here’s the scoop (although various international security agencies will not be happy I’ve revealed this):
After an extensive analysis of this thread sometime last Fall, I and my advisors came to the conclusion that it was being used to transmit coded messages among the Transnational Repressionary Occidental Littlepeoples Legion Society, or TROLLS. It took weeks to break their code, but we isolated ourselves under a mountain in Connemara and, after a long struggle, succeeded in cracking it.
We have been watching these comments closely ever since.
The selection you so cleverly isolated, “So, A Short Shittier Deed: Is Genuflect a Jug Cab? I Risk Pork” means nothing more nor less than “Stir the pot in Iran and make sure to stamp out everyone on Twitter with green avatars; they are in solidarity with the Iranian Fairies.”
Note: Ahmadinejad has repeatedly said there are no fairies in Iran. You and I? We know better.
I believe in Fairy’s..
alsow this is fake..
Fairy? Hmmm … :)
I’m beginning to wonder: the celebrities are dropping like flies. Could they be innocent victims caught in the crossfire of the fairy/meerkat conflict?
What are the meercats doing now? Is Zsa Zsa next?
In point of fact, Zsa Zsa Gabor just got released from the hospital, where she’d been confined for some time, fighting off a mysterious illness.
http://news.yahoo.com/s/ap/20090630/ap_en_ce/us_people_zsa_zsa_gabor
What do you think? Were the meerkats just practicing on her, or do Eastern Europeans have built-in resistance to their engineered death squads?
If you think I’m gonna disparage the MoMos, you’re wrong. We’re disparaging meerkats.
Cutsey little standy-uppy weasle-lookin’ meercats.
Cutsey little standy-uppy weasel-lookin’ Michael Jackson and Zsa Zsa Gabor-poisoning meercats, that’s who.
BUT WHY DID THEY HAVE TO KILL KARL MALDEN TOO???
He knew too much.
valar– *Snort* So what about Ed McMahon?
Ed McMahon was involved in the Jerry Lewis telethons for decades…and have you ever looked at the young Jerry Lewis very closely? Doesn’t he resemble a certain cutesy, weaselly creature with which we’re all familiar. Sometimes their alien leaders don’t give them very good disguises.
I’m not saying Ed McMahon was a meerkat. I’m saying Ed McMahon was a Fifth Columnist, working on their side. They took him back just as their Operation Celebrity Rapture began.
“Meeeeeers Johnny!” It all fits now.
Bruce – how dare you question my assumption that ” everyone knows that fairies are the size of dragon flies”. It is indeed factually my assumption – I am assuming it and as a matter of fact it is my assumption
I finally had time to look up morphology om wikipedia – and can now comment –
raincoater you make a good point if the pictute does not match current fairy MORPHOLOGY than the theory of it being a mutant giant fairy is valid
@Michelle– [to Bruce?]“How dare you question my assumption that everyone knows that fairies are the size of dragon flies.”
My point was that you can’t possibly know everyone, let alone know what every single person in the GlowBall Com-Unity knows about fairies; therefore your argument (and your innocent assumption) is null and void from the start.
There is potential for your theory, though, but you need to provide proof of fairy mutation/acromegaly. That’s gonna be a tough nut to crap.
*crack*
You’re all on crack if you think the world is being invaded by Giant Mutant Fairies. There is no need to just make shit up, please. We are having a rational discussion here, an evidence-based examination of the possibility of the existence of fairies and the rising global meerkat conspiracy. Let’s just stick to the FACTS.
Facts, facts, facts, it is always about the facts
Now I have to look up acromegaly
it’s not real ..
Do you think it’s imaginary??? Look, there are pictures of it; are you saying that’s a Photoshop? Of course it’s real. It was even offered for sale on eBay.
How much$$
For the remains of perhaps the last fairy in Derbyshire? How much would be too much? How much could POSSIBLY be enough?
It is from Derbyshire?
Why didn’t you tell me that changes everything….
Your Grace
When told “This is totally legit”, why do I find myself anxiously checking my Wallet
Your Grace’s obedient Servant etc
G E
Nando says he’s seen them on the outskirts of Jakarta.
G E- because it’s already in your hands as you have no pockets within which to keep it?
rere4444 – Claiming that people suffering from acromegaly actuall have a psychosomatic issue is insensative. A lot of the time it is brought about by a tumor of some sort.
Um, I’m not sure what to say to that, but thank you guys for my 1600th and 1601st comments!!!
wow people u need to get a grip cant u just think that maybe fairy’s roamed the earth a one point in time and there most likely still out there alive and u might think i need to get a grip on life but people don’t believe in spirits but we no there out there our kids could be talking to there imaginary friends and u might think aw that’s cute but they could be talking to a ghost because children have more of a mind that believes in any thing some one tells them
Im n ur post eatin ur punctuation
Buon Giorno, Signor Ashley
As Trinity should have said to Neo :
It’ not the Punctuation nor the Grammar that drives us
It’s the need for all of us to get a Grippe on Life …. and on our Wallets
Wah, Aah doo declay-are, Miss Scarlett
Even her Britannic Majesty’s Government has begun to realize that it’s running out of our Money to spend on Worthwhile Projects like Moats, Duck-Houses, taxi-fares for the (now former) Speaker’s Wife and her Cleaner when they go shopping
Fairies used to thrive in those duck houses. Dozens of fairies will now be homeless (how many fairies can dance on the head of a duck? More than you’d think, without him noticing in the slightest). What is Gordo’s plan to house these wandering Little People (and presumable constituents).
OMG….I can belive.but,it`s 2 fricky to.
Your Grace
Heil Blair
Euro-Präsident-Elect
Bringer of Peace to the Middle-East
etc, etc
Your Grace & those Fellow Colonials & ex-Colonials should appreciate the benefits of Britisch Rule in the 21st Century
For the last 12 years, Herr Gordo le Grand & Mellifluent has managed the British Economy with SAGE wResponsibility & Great pSuccess
… and he is now pressing that kindly Mr Obama und the frightening Frau Merkel to be sensible about flooding the World with bogus Dollar & Euro Banknotes
Just think how high UK unEmployment statistics would be if Gordo (Saviour of the Universe) had not been so brilliant at multiplying ways of concealing JOBlessNess
Why, his unGrateful Ministers have so massively improved British Education with enHanced SchPelling Tests to efficaciously increase SchPelling Scores which would reassure Ashley & Angel about their challenging letters
We can be confident how deeply Gordo the Sensitive Communicator feels for the fates of British Fairies who, if driven from the shores of what was in Shakespeare’s time, “the envy of many less happier lands” would be exposed to Monsieur Metro’s “milk” saucers & the predations of Tree Oktopodia in British Columbia’s Rain Forests
BUT he is generously willing to give credit to his kindly policy of caring for Fairies & the Aged & the Poor & Infirm and improving their Life-Chances to another dashing American (or was he a Canadian) who so sagaciously opined :
“Frankly, my Dear
I don’t give a Damn”
I remain your Grace’s obedient servant etc
Heil Braun
G E
I thought he was Australian? I get all those famous anthropologists and comparative pholklorists mixed up.
This going to be The Ever Ending Stories of Denying Fairy…
it is if I have anything to say about it!
They have teeth mice here in Spain. It sorta freaks me out, to be honest. I have no idea why a tooth-hoarding faerie is OK with me but a mouse doing the same thing is somehow perverse. I think it’s because he doesn’t leave money.
You know, looking at the way that fairy has her hair seemingly tied around her neck, she may have been “hangin” (pardon the pun) with David Carradine just before she expired.
wow questa è una prova in più per credere alle fate !! io ci credevo anche non vedendo questa fata ritrovata !! ma ora ci credo il doppio !! viva le fate !!
Yea! Un altro credente da Italia! Yea!
wow questa è una prova in più per credere alle fate !! io ci credevo anche non vedendo questa fata ritrovata !! ma ora ci credo il doppio !! viva le fate !!
Fata, fate = fairy, fairies
Wow this is a test in more than believing in fairies!! I believed even without also having seen this re=found fairy !! But now I believe doubly !! Long live, the fairies!!
Sylvia, are you sure he’s not SCOTTISH then?
Look at the lies spreaded on mashable! http://mashable.com/2009/07/15/internet-hoaxes/
Well, what can you expect: not ONE direct link to this post. I hardly think the story can be covered adequately without a link to this post, do you?
Totally not. You’ve got to complain to mashable. Right now.
You’re covered. Posted twice with linkoids in case the first one was diseased.
Brilliant, thank you. It’s hardly fair to let them wallow in unsubstantiated repudiations; how do we know that recantation was not obtained under torture? And how can you take the word of an admitted fraudster? Honestly, does no-one CARE about the SCIENTIFIC METHOD anymore?
rain– Your first two questions appear to be rhetorical, and I although I can’t answer the S/M question, I’ll betcha Nurse M. can.
She knows scientific methods that would curl the pubes of a dead fairy!
Dead fairy pubes are straight? Dang. Learn something new every coupla months or so.
omg, these can’t be real, gosh, quit tryin to trick everyone, and I’m NOT a Godless heathen! I’d like to see the person that calls me that! God is my Lord! hmph
I do believe in fairies, but don’t you think it is rather odd that the press and he pres. hasn’t gotten to this yet? Very strange, hmm, that’s the only reason why I think this is just a trick
If the tooth mouse were Scottish, he wouldn’t wait for the tooth to come out on its own before taking it, would he?
There IS that, I suppose.
this “finding” would under no reasonable circumstances be considered police evidence…so maybe not so official huh? This is interestingly faked, but u guys are full of shit.
Ur full of shit, interesting, but still full of shit.
Two words, big talker: Prove it!
Ur full of shit. Non sequitur.
Are you telling us this naysayer is actually giving us the secret location of the Meerkat Conspiracy HQ?
Cutesy little standy-uppy weasel lookin’ bastards.
Excusez Moi, Senor Bunk
This may be an entirely understandable opinion for a persecuted Scorpion or a tasty Kalahari Worm to express
BUT
With their voracious appetites, RacCcoons are scarcely in a position to utter pejorative observations about Meerkats, just because they favour (err …. favOr) the Republican Approach to Life
Ah, but who ever heard of a raccoon conspiring against a fairy? Nobody. Any such allegations are, at this point, completely unsubstantiated, whereas we’ve seen in this very thread the subtle workings of the Great Meerkat Conspiracy.
“I am not a Raccoon! I am not an animal! I am a human being! I am a man!” –paraphrasing John Merrick
“You are Number 6.” –quoting Number 2.
Which brings us back to the unfounded accusations tossed out by Mr. Noway U. Getname, aka, the New Number 2.
Take it.
I’ve seen one before.. and he doesn’t look like the mummified one shown here aside from the size though…
It happened around 7 – 8 in the morning of December, I can still remember how he looks like… orange hair, he’s wearing a striped shirt (alternate blue and black), he’s holding a sword like thing and its black and its shape is like a closed umbrella… And its easy to tell that he’s a guy… They look very much the same like us humans except from the size of course…
the reason why I saw him is because I felt something weird on my hand… I thought it was a mosquito but when I try to move my hand away from my face I saw him, he’s pinching me using his small black sword. Then he stepped back cuz he notice that I caught him in the act and after an instance he’s gone… and even until now I always ask my self why is that thing pinching me… for what reason I still don’t know but I’ll try to find out… And the thing is it doesn’t end there… I can hear them all the time, they always comment on my thoughts and ideas… it seems like they are playing with my mind or maybe they are afraid that I will tell people about this and that is what I am doing now… they’re trying to make me go insane day by day but the God given free will that I have is so strong that’s why I’m still here and able to tell the tale…
I’m looking for someone who can help me surpass this situation that I have… I’m a very strong person but they are more powerful than I and I’m so helpless and vulnerable to them…
I’m looking for ways on how to defend myself at least and somehow…
Here’s my email([edited out by raincoaster because you shouldn't post your email on a blog unless you love getting spam])you can contact me if you experience the same thing or what not or if you have solutions… I’m willing to pay any amount…
Regards,
Jeembo
@Jeembo:
Dude–that wasn’t a fairy. You were clearly attacked by a Nac Mac Feegle!
Understandably, you mistook the dirty blue hide for a black-and-blue jersey. But you vividly recall the red hair. Congratulations on surviving the encounter!
Slightly OT, but we’re discussing a handmade aboriginal novelty fake turd over here. If anyone would like to use the phrase, click on the linky, scroll down a tad and join the comments.
[Now back to your previously scheduled program.]
Oh, I think I’m going to save that for blogathon. See you all in ten hours. Send gin.
[...] on the Riviera, yet humans persist in thinking them harmless. Now, finally, we have proof that the meerkat anti-fairy forces are no myth, but instead a strong and active military force boasting snipers of cruel and [...]
[...] know we’ve discussed this before, mostly on Twitter and in the Anti-Fairy Conspiracy comments, but NEVER turn your back on a meerkat. They’ll rip your throat out as soon as look at you, [...]
is like in HELL BOY…:)) ;) :P
How do fairies live, and ware can you find them specifically because that would seem like a good hobby to do for fun, and if I am lucky 1 day actually see one. A take its picture.
I was reading on one of the comments you left I that the fairy died because it wasn’t loved?
-paige
Well, that’s what nearly happened to Tinkerbell. I’m figuring if indifference is deadly to fairies, we’ve saved many, MANY lives with this comment thread.
Obviously, you can find them in Derbyshire, where they are not loved. Wonder how many are left?
Rain– I found out what ticks off the Meerkats so much: it’s THIS FRAUDULENCE. Honestly, I can’t blame them.
Flitty little moth-smellin’ Fairy-lookin’ bastards.
“Made in China” Oh yeah, I bet she WAS, every Saturday night.
It’s appalling that in this day and age true fairies have to hide while these tinsel-bedecked golems are worshipped in lower middle class, tchochke-bedecked homes around the world.
omg
yo mr smuggles shut up
lol you people are really funny but most fairys are in england but there is one or two in the states
Yes, Perez Hilton is one of them.
well i strongly beleive in faires just because there is proof i understand dosent mean its real but r u serious?
look at that.blah blah ” That bears no resemblance whatsoever to Quentin Crisp! Fraud” r u serious dont get all serious r u kidding its right in front of your face if your gonna leave a commet leave one that makes sense dude.
“Just because there’s proof doesn’t mean it’s real”
Are YOU for real? Because we have no patience on this blog for nonsensical people who are just out to waste our time. None at all. Nosir.
butfair ies r trust true y dont u thn k thm falz mean wot.Huh
I’m amazed.
[...] with them! She’s not doing too bad with comments either; her most commented on post ‘mummified fairy remains found!!!‘ has, at the time of writing this, 1651 comments of which about 20 or 30 are from [...]
ALL Fairy Supporters know who Quentin Crisp is. You can’t fool me!
i really believe in fairies
but i really want to believe it
but i just can’t!!!!!
SORRY!!!!
i love fairies i can’t really tell that it’s fake
and how could you make something so small and delicate
and it looks fake cause it’s old
THAT’S MY OPINION!!!!!!
WE CAN TELL IT’S YOUR OPINION!!!
To say something is fake because it is old is to betray a deplorable faith in our elders.
The creator of this model admitted it, later on the day of original publishing, that it was an April Fool’s joke. He does say that he believes in fairies, and was pleasantly surprised at the response from believers, but this particular “fossil” is simply a trick of some fabric and doll parts.
You can find the article by searching “fairy” in Google images and the first hit that comes up tells the story.
Oh no; once again we have someone who simply takes the word of an admitted liar. When will the world see the point of the Scientific Method? When will the world bow to logic, to proof? Must we wander in a morass of superstition and supposition forever more?
I beleive in fairies and i always have. this may have said it was a hoax, but i believe in this. it’s hardcore proof.
Oh Wow!
I Freaking Love Fairy’s!
I Wish I could buy one!
I DO BELIVE IN FAIRYS!
=P
just throwing this out there…if it waz a “fairy” the wings would not be there, for the wings are not made of bone but a
fethery like material or like what a bugs wings are made of. But what im getting at is that the outline of the wings would not be there the bone; maybe, but not the wings outline.
~FAKE~
I’m not entirely convinced: do you have an existing post-mortem of a fairy with which to substantiate your claim that the wings are either feathery or bug-like? As always, we require proof of assertions.
wowwww u r a complete idiot to think this was real hahahaha
it is a fake! read and weep u dumb blondes: http://news.bbc.co.uk/2/hi/uk_news/england/derbyshire/6514283.stm
Did you read the comments before you posted? Puh-leeze, we dealt with that YEARS ago. Wasn’t it the BBC who said there were WMD’s in Iraq? I rest my case.
ALL OF YOU SHUT UP ITS REAL / FAKE OKAY THERE 1/2 is real the other is fake :)
MEOWMEOwILUHDUHPUSSY what are you talking about? What 1/2 and what other? The bag and gloves are real for sure!
John Russo, just how do you know what fairies wings are made of? Who says that they go by the natural law of decomposition anyway! They are mythical creatures. Unless you can prove what the wings are made of, then don’t comment just to make yourself sound smart.
this is fake just so u know it waz proven fake
u all are fucking fags if u think this is real and u all like to suck huge dicks
grace, you have no PROOF of that. You never met my ex.
Hey Grace, do you know of any inbreeding in your family? Your a bit on the slow side huh!!!
Oh yeah Grace, why don’t you stay on AOL Chat or something where talking like that will make all the 10 year olds think your cool!!!
That fairy’s family doesn’t believe in you either Grace. They demanded that you pass a Turning test.
Awesome name valarmorghulis! But all men, nor fairy shall not die!
For everyone saying it’s fake because the wings look like leaves, DUH it’s a Flower Fairy(spinosissima orioles). What should the wings be made of, rocks or something! Do some research!!!
Aha, a scientific name. We welcome you to our fellowship of scholarly inquiry.
you should never start ur article with “This is totally legit.”
Wai nat?
What should you start an article with, this is really, truly, and completely fake? Let’s take a vote. Which one would be more likely to be read: A fake moon rock was found in Washington D.C. or A totally legit live gummi bear was found on the outskirts of Poland? You probably weren’t too good at term papers huh datsun?
do you believe in majic cause i do!!!!!!! this just proves that there is more out there than just us. god mad us all with his majic!! how can you question what we know in our hearts is real! with out majic life wouldnt exist so believe in majic cause god is majic and these are his children too!!!!!!!!!
Yeah, Becuz Sumwhere iiN Dha Bible He Sayz How He Made All FaiiRies Equal..LMAO
KiiD ii Bet There iiZ Sum type Of supernatural Powerz Out there But Letz BE Real About ThiiZ…!
Yes, G-Smartz could hardly SchPell more unmemorably
- the wholesome outcome of US Primary Schools, whose achievements include Mr Armstrong’s First Visit to the Moon (with its US Flag blowing in the Wind) and Master Shrub Jnr’s Democratic Triumph in 2000, where he had 55% of the Vote to Mr Gore’s miserable 44%
Indeed, in the earliest Old-World reference to Racoons, the Latin Poet Vergil rose thus to similar heights of eloquence in line 81, book 8, Aeneid :
Ecce autem monstrum subitum et oculis mirabile
[Lo however a racoon sudden and to the eyes marvellous]
Even at the Greatest Extent of their Puissance, the Romans worried about their Empire and the Menace threatened to themselves and endangered Species like Tree Oktopodia & Derbyshire Faeries, if the Racoons were recruited to the Great Meerkat Conspiracy
Virgil hated raccoons. It’s a little-known fact.
maybe its the fairy from zelda lmao jk
Whear have you got the fairy?
why does it say “2 inch remains” and then in the pic it shows someone holding it in both of their hands, clearly bigger than 2 inches…? dont contradict yourself. lol cool pics though :)
Readin about this off another site those fairy remains are fake and not legit
AAAAAAAAAAAAAAAAAAAAAAAAAAHHHH…. FAIRIES….. aye dey found tink….. maybe theyll find peter pan…. and never land…. and oooh….. ooooooooooh…… i wonder if they will ever find unicorn remains…. or better yet…. a live unicorn….
Re: Ludeawakening89
“A totally legit live gummi bear was found on the outskirts of Poland?”
Dang! I missed that story. Gummi bears, hmm. I shoulda known they were tied up in all this. Cutesy little sticky/squeezy-lookin’ bastards.
And regarding Virgil, he hated raccoons because they kicked his ass up and down the parish, not once but numerous times. Virgil backed off after that, became a hermit and started inventing poetry. The raccoons let him off easy IMO.
Since you did beg for comments….. ;)
The history of literature owes those overgrown bandito-rodents more than I could have imagined. Wow.
Riiiiiiiiight…..
Ah, another skeptic. Without proof, your disbelief is nothing more than superstitious negation of something obviously proven beyond the shadow of a doubt. You could have purchased the body yourself and done an autopsy. Nothing could be more open, or more obvious, than the reality of this poor, shriveled corpse.
trent, thanks! I’ll get there! I’ll get there!
Someone needs to meet The Pieman.
Pieman? Do explain; is he another conspirator with the meerkats, attempting to keep the truth about fairies and unicorns away from the public?
It was a simple reference to Simon. He might meet the pieman at the fair.
Noticed that this thread is not appearing in my comments feed anymore, so I figgered it was a dead thread. But NoOOoo…
Alrite..Ive read a lot of dumb things on the internet, but this takes the cake! You guys honestly beleive that faries are real?!? Wow. I have a Suggestion. GET A LIFE! And stop trying to convince other people that faries are real! If you think its soooooooooo important, you must think it will change the world! What’s it gonna do? end world hunger? stop the war? find a cure for cancer? NO!! So get a job, Get some friends, and remember! FARIES.ARENT.REAL.(:
See:
“FARIES.ARENT.REAL.(:”
That’s the giveaway. Meerkats cannot spell, use punctuation, or do smilies correctly to save their lives. If you can draw them out long enough, they ALWAYS make that mistake.
Could be that Josie is referring to FarIs in the Rasta vernacular, but it’s hard to tell since she(?) has obviously spent hours combing through this thread to come up with such an unfounded conclusion.
Reading through the proofs on this thread could compel any sentient being to resort to head banging on any convenient hard surface nearby, and I know this via first hand experience.
Her Grace Mlle La Marchionesse la Regen=Küstner
Your Grace
Heil Braun
I flatter myself that I agree with le Sagacious Monsieur Bunk on so many things
…. apart of course on whether the Governator of California should be asked to swop jobs with the Kindly Gordon Brown, Saviour of the Universe’s Financial System
… or Gordon would be the Saviour if only those brainy anti-soviet German, French, American, Japanese, Chinese, Botswanans, Tongans etc had the wisdom to follow Mr Clunking-Fisted Brown’s advice on QE
BUT surely enLightenment can be soughtnover the mystery of the erudite, perceptive and most welcome Josie’s Suggestions by applying Occam’s Razor — seeking the simplest solution
Namely —- the Meerkat & Unicorn Alliance’s influence continues to spread even into this erudite Space
Es macht man denken, nee
Das ist es, doch
[It makes yer fink, ughh]
[this is it, i'n'it]
Your Grace’s obedient servant etc
G E
Explanatory gNote for Economic Illiterated Visitors, incapable of perceiving Mr Brown’s obvious Wisdoms
QE = Quantitive Easing – flooding the World with Government-Forged Electronic Cash
Negitory, good buddy. Looks like you’ve been drinking meerkat-tainted kool-aid: the Unicorns and the Fairies are united against the Meerkats. Cthulhu’s position in this is, as always, uncertain. The Great Meerkat Conspiracy attempts to repress knowledge of Unicorns and Fairies and thus to deprive them of fundamental freedoms. A popular writer of the last century did an allegorical novel on the conflict, set in a farm in the English countryside. Wish I could remember what it was called…
I think it was called “The Return of the Wilderbeest to Tunbridge Wells” by Sir Pithcairn Vapors-Smythe.
OMG! This is thing has gone on for sometime. And I actually read it. Amazing… I know!
But for the whole fairies and what not.
I mean why not believe they are real?
Everyone needs a little bit of faith in your life.
It would be like slapping a small child and telling it not to have dreams. Come on people.
Believe.
And it shall become.
And congrades on reaching over 500. x]
it’s fake. the guy that snapped those photos admitted to it.
Again, yet again, an unsubstantiated claim with nothing whatsoever to back it up. We didn’t just fall off the turnip truck, you know. You’ve got to have PROOF, scientific PROOF before we believe you around these parts.
Whoa. But I fell off the turnip truck. Twice, and that negates the first time by a factor of two. Just because you didn’t doesn’t make you an authority by default.
But Joe obviously hasn’t experienced the zen of the turnip vehicle disembarkment yet, so cut the ignoramus some slack.
perileri çok severim ama böyle peri görmedim ,ona zarar veren herhangibir kişi ise çok kötü olduğu belli.bence bu periyi biri korkutmuş onun için peri de bayılmış ve açlıktan da bu hale gelmiş olabilir.
bu peri yüz yıl öncede ölmüş olabilir ve bilim adamları veya insanlar bulmuş ve bilim adamlarına göstermiş olabilir,bu nedenle bilim adamları iğice araştırıp resimlerini çekip yolamışlardır.bence bu periyi kim buldu?sorusuna cevap vermek çok kolay ama bu peri kaç yaşında olabilir?bu sorunun cevabını bilim adamlarından bekliyorum
rain– Are they talking dirty, or just having some serious problems with spellcheck?
AHA! The Turks are here!
Hoş geldiniz! Biz peri Kartoum eteklerinde bulundu inanıyoruz. Muhtemelen Meerkats tarafından öldürüldü. Soruşturma devam ediyor Nisan 2007 beri.
—————–
Elifsu said:
I love fairies, but we did not see the fairies, any person who hurt him so bad is that for him belli.bence this peri peri also love to have one scare, and starvation, this might have become.
Sila responds:
this fairy in a hundred years ago may have died, and scientists or people have found and scientists may be displayed, so scientists investigate the affairs of the device take pictures, and this fairy yolamışlardır.bence find who was that? answer to the question is very simple, but this fairy may be how old? the answer to the Waiting for scientists.
Merhaba [G'day], your Grace
As usual, these Sagacious Raccoons are so multi=lingually well-informed
BUT how can one gently suggest to the honest & worthy Joe, that (like Jeeves) perhaps he could profitably engage in some study of Spinosa
This would afford an illustration that even Anglo-Saxon Empiricists and Evolutionists from the Middle-Colonies should not believe everything they read
Allahismarladik [Ciao]und tot siens
L’Aigle Gris
Bunk, I don’t know what’s up with our two Turkish friends other than they’re obviously having problems formatting links to their porn sites properly.
And I’m not sure, but I THINK they recommended sawing the scientists in half and counting their rings. Can’t hurt is what I say!
Oh how wonderful would it be… little fairies among us just like in those fairy tales that take us to far away lands!
I would grow a garden just for them to visit. But… reality bites, this world is one very much far from a place far far away… isn’t it
i consider that “fake”mumifided fairy as some great Art work. i bet it took months for all the details.
O: I belive in fairies and you better say you do or Tink will die D:< you evil people
Ya, where do the peaople with the porly drawn monster charaters come from?
yeah whatevs i would like to believe it… but i need some real facts first. cold hard evidence you know? something we could actually have public access to?
by the way raincoaster… you sound like a pretty cool person… and i just want to say I do believe in fairies, I am just having a really hard time tellig whether or not that picture is real or not… you know?
SPONGE BOB SQUARE PANTS! okay that was random lol anyway i think they do exist but there just hiding u really need to look
My neighbor told me he’s a fairy, that’s how I know they’re real. ‘Cause I actually met one.
That fellow way…… up top there looks like something from the 80′s. Just sayin’.
WOW.i want to see it.
WELL i think its real i mean…ALL the stories and fairytails HAD to come from somewhere right????????
Quite so. Oral history is one of the major tools recognized by historians, sociologists, and archaeologists.
uhm bringing science into this if fairy was to have hallow bones where it’s marrow is making white blood cells it is this thing would not live past it’s first day out of the womb 0.o
So, explain BIRDS, then, Oh Robbie Nye the Science Guy!
So hows this fairy shit work on getting the girls i bet you got your degree online and have never had a girl friend because no one that matters in this world cares a god dam shit in fairies or any other thing that we have don’t have prof on. I mean common a kid could forge that fairy photo you get a police evidence bad somewhere on eabay or something and latex gloves are sold everywhere you dumb ass. I hope you shrivel up and die you fairy believing peace of shit. Oh oh no all the fairies are dead because i don’t believe that much, they should be because if god kills them off because we don’t believe in them there not that very fucking important in the first place. Jesus sorry for the language.
Seriously guys? It’s a baby primate with plaster and leaves glued to it’s back. If it were real this would be all over the news. I have studied cryptozoology for years and this is amazingly fake.
E-mail me : moonshinefountain@yahoo.com
that is fake like the other one
“A baby primate” oh yes? And your proof for this assertion is what, exactly? That you’ve studied something for years obviously doesn’t mean you’ve picked up logical thinking or a demand that statements be backed up with proof!
Why, the assertion that there are primates in Devonshire is itself alarming and unproven!
So hows this fairy shit work on getting the girls i bet you got your degree online and have never had a girl friend because no one that matters in this world cares a god dam shit in fairies or any other thing that we have don’t have prof on. I mean common a kid could forge that fairy photo you get a police evidence bad somewhere on eabay or something and latex gloves are sold everywhere you dumb ass. I hope you shrivel up and die you fairy believing peace of shit. Oh oh no all the fairies are dead because i don’t believe that much, they should be because if god kills them off because we don’t believe in them there not that very fucking important in the first place. Jesus sorry for the language.
this is a proven hoax guys not a gov cover up and ya there are probably still some unidentfied species but this was a prank by a master artist :/ sorry guys dont believe everything you read on the internet the “remains” are in a master art museum the guy loves to do april fool jokes sorry guys ya some of you will still deny the truth but open your eyes the wings are off <3 sorry
NonBeliever: your comment will be given all the consideration which is its due, of that you may be assured.
Bella, how’s Edward? And again, AGAIN with the unsubstantiated claims. You say you have proof it’s fake. Okay, fine; prove it. Where’s this proof of which you speak? Who is this shadowy “Master Forger?”
We have, as you can see, zero tolerance for unsubstantiated, random claims by internet personalities.
this is bs not real one u can get gloves anywhere an a police evident bag you would be surprised how easy it is to get one of those this is photo shopped
Well, make up your mind: is it faked, or photoshopped. Also, just exactly where do YOU get your Police “evidents” bags?
thats amazing
What ‘ s amazing, Ashley
Gosh…Why do so many of you doubt that fairies are real?I, for one,believe.After seeing two pictures of faries my best friend took,seeing almost ten real pictures from books, three on the internet[including these]I TOTALLY BELIEVE!Who wouldn’t want to believe in these amazing creatures?They help the envirment,and bring joy to us.My best friend,Evie[the one who took the pictures]has seen them and has had actual REAL conversations with them!She once wrote a letter to her tooth fairy and she got a letter back!It was written in the tinyest cursive!And for those of you who don’t know,everybody’s got their own tooth fairy.Evie’s is Marigold.
Do you suppose you can get us a scan of that letter, Giana?
Uhm…ok whole the HELL-o is Quentin Crisp??? CRUNCHATIZE ME CAPPN
Come on, you KNOW how this works. Look it up!
Sorry,I think Evie lost it.But I do know that if you buy the book Farypolis,Return to Fairypolis,or The Secret World of Faries,you can see all kinds of stuff.They have pictures
diary entries,letters,pages from stories,it’s like their big scraptbook just waiting to be opened to reveal the truth to our curiousity.Sometimes I think Evie might be lying,but I believe in faries,and I know Evie would never lie to me.
Raincoaster,I’ve got a question that I just can’t answer myself,even with the research I’ve done:Are faries related to angels?
Fairies and angels are both supernatural beings, which means they were both created before the world existed and are independent, not related to one another.
I started with the news from Yahoo! about some rich guys including Steve Jobs with big paychecks and ended up with this magical post. Laughing aggressively out loud.
Well, anyways, about my opinion about the magical world… Haven’t you ride a donkey before? It holds the key to all your questions.
Extra: I think Cthulhu is related with Steve Jobs and Steve Jobs is related with fairies.
um… looks bigger than “2 inch remains”
Size isn’t everything!
yeah. no. unless those hands are superass tiny, like 2 inches tiny, that fairy is fake. it was funny though.
Proof, Johnelle? Where is your proof?
“…unless those hands are superass tiny.”
There’s a bizarre description. Huge weakness. Jumbo shrimp. A small catastrophe. A little atrocity. A quiet cacophony. Artificial global warming. A huge dessicated fairy. And the beat goes on, according to the late Sonny Bono.
I believe in fairies, in magic, and that there are things in this world that exist without our noticing. My name isn’t really Rima Mashiro, she’s a character from the anime Shugo Chara.
Truth to suffice, it could be a fake, or it could be real, but if you truly believed, that would be insignificant information. Little kids have the best faith, in my opinion, because they aren’t ruined with responsiblity, and what is ‘scientifically possible’. It’s like they believe in the tooth fairy/mouse, santa, the easter bunny and in anything else they choose to.
Dragons actually did exist, and if dragons exist, maybe a whole communtity of other creatures exist. Maybe you have to truly believe to see them, and be pure of heart.
I’ve seen a fairy portal before, they’re quite common to see at sunset, along with lights going in and out. I also have the ability to talk to guardian angels, and predict small things in the future (useful with coin flips).
Why can I see and communicate with fairies? Because I’m gifted and I believe. I can see auras, and see into the future. It is also common to find fairies trapped in sea shells, and if you release them, they will bestow good luck on you.
I don’t abuse the fairies, but I find it amusing how they can tell me things, that you otherwise wouldn’t know, if you weren’t a fairy.
HOLY FREAKING CRAP PEOPLE!!! Did ALMOST everyone just TOTALLY ignore the whole “POSTED ON APRIL FUCKING FIRST”?? (April FOOLS day if it still hasn’t quite registered with ya) Plus the FIRST clue should have been “THIS IS TOTALLY LEGIT” NEVER trust ANYTHING that starts off that way.
BRAVO TO THE CREATOR! There was ALOT of effort put into this scheme! I admit I was being sucked in as read the article, started running theories as to why I hadn’t heard about it sooner. BUT I READ THE WHOLE ARTICLE!
They may not be real, but I still like to leave thimbles of honey and milk on my doorstep, just like I leave out a plate of milk and cookies at Christmas. What do you think superstitions are? EVERYBODY believes in at least one: salt over the shoulder, broken mirrors, umbrellas opened indoors, black cats, sidewalk cracks, walking under ladders, etc etc etc. Why the hell to we live life if we don’t believe in a little magick every once and a while! It will make you smile which will put ten years on your life!
Some need to smarten up, others need to pull that giant stick out of there asses!! CLAP YOUR HANDS!
Indeed. I hope you saw the part of this thread where the commenters were trading dirty jokes in Latin. This comments thread has been called one of the most beautiful things on the entire internet, but you have to read it like a book, not just skip to the end.
i wesh to see it wen its not did
Yes I did! I must say that I found myself thinking the same thing! I sat here and nearly peed myself I was laughing so hard!! You got a good one going here raincoaster! Keep it up! This is the only thread I have ever even bothered to read fully or comment on! Thoroughly entertaining!!
jojo, you shoulda been here two years ago, obviously. Poor thing.
DaNu, welcome to participatory performance art.
If it is a hoax it looks really good, something to make you smile and bring back some faith in fantasy and dreams :)
But…
…. did they have to call scientists “Godless Heathens” as if they have no moral codes? A true scientist would never cover this up if it was real, true Scientists would embrace it and be very excited about this (again, if it is/was real).
Well, that’s exactly what we’re doing!
Ah yes, I remember back two years ago, when the fairy was still fresh and hadn’t yet shrivelled up and dried out.
Clearly Raincoaster wasn’t keeping it in her apartment.
No, it’d need a zodiac to stay dry in there.
as in???
Well, have you SEEN my apartment?
Nice to see the debate still raging. I overheard a woman on her bluetooth yesterday. She was arguing with someone, and I think she said that all fairies are named “Marsha.” I suspect that she fell for the old urban legend, but snopes has nothing on it yet.
i do think it’s reall add me on myspace i have a reall fairy i found in the woods at fox island
Ugh… that is the most horrible thing i have ever seen, i acctually believe in fairies and that supposed “fairy’s” wings are made of dead leaves…… Everyone knows fairies are 5 inches long. Its a mean thing to do. :(
Most of the fairies I know are named “Fifi” or at least they are on Fridays and Saturdays after 6pm.
And who ever claimed that fairies are five inches long? For one thing, you’re a horrible sizeist. And for another, it’s NOT the size, it’s how you use it.
Fifi would be the français version. Sascha is the Русский equivalent. I’m gonna sidestep the length x circumference argument; I’ll leave it to you experts.
Yeah its been confirmed that it was an april fools joke. Someone made it and planted it to be found on april first. The guy came forward and admitted it was a hoax, even saying how he made it. Not saying there aren’t things out there that havent been discovered, but the particular “creature” in the picture is a fake.
I love fairies i see them all the time!!!
and i love what they do to their hair.
lol :P
is this Fairies is truelly reall ….
how did they found !! …
and why they Already … Dead !!
is there the rest of them are life already … and hidding …
I’d be hiding too! Around these parts, we have our suspicions, though not enough proof to charge anyone. Let’s just say a certain Eastern European mammal knows more than he’s saying about this mysterious death.
http://www.facebook.com/Comparethemeerkat
My name is Flower.
For years I was teased becuase of the fairy believing thing. I decided to stop blieving until one night I heard something in my bathroom. I’m not the brave type so i made my brother go in and look. When he came out he was really scared adn threatended to go get my Dad, but when I asked him what had happened te only words he said to me, were:
“It glows. It really, REALLY glows.” I put on my big girl pants ;) and went into the bathroom. Nothing happened but all I saw was a fat firefly in my Chia (cha cha cha chia)I thought is was just a joke so my bro took a jar and decided to keep the bug. But when he stuck his finger for the bug to crawl onto it, the bug began to uncurl from this ball shape, and than a small- Polly Pocket like figure jumped back and got up in the Chia.
By this time we were both screaming and my parents were coming into the bathroom.
Well, just like those cheesy Peter Pan movies, parents cant see fairies, and even though I practically touched the tiny person with wings, my parents didn’t see her.
The tiny person would keep coming to my room and she liked to eat the insides of jelly beans (from my candy stash) I didn’t touch, i would only watch her flutter and dance around my room. The closet i came to knowing some information was when she played with my tinkerbell pen and began writing something on a post it.
The tiny person was a girl an her her name was like Maidor or something. She knew how to talk becuase when she went inside my kitty’s play pen, she would sing tinkle little star to my cat. My cat is reeally mean and Maidor somehow controled him.
I still see Maidor sometimes. I see her mostly on Tuesday nights, sicne I am homeschooled. she enjoys candy and likes growing things. Somehow she became my best friend.. raincoaster is right. And i dont know if thats a real fairy, but Maidor does…
Mit Apologien an Herr Hughes Mearns :
“Yesterday upon the stair
I met a man who wasn’t there
He wasn’t there again today
Oh, how I wish he’d go away”
Your Grace
The Regen-Küstner=Abwehr are troubled by so multitudinous & divers qvestions :
eg can a Sqvare ever be circular
eg are Gorillas really a more intelligent species evolved from Homo pSeudo Sapiens
eg Why did the British invade Iraq in 1915 (where Grandfather Eagle contrived to catch Malaria) and then again in 2003, with their US Friends
UND
eg Why is the wretched Government of her Britannic Majesty [God Bless her] claiming that the UK has ended its Recession
AND like the erudite RIAM, it is also wondered pourquoi et how do Fairies die, while struggling to escape to Vancouver away from the excessive UK Tax-Regime in Derbyshire, formerly recognized (by Miss Jane Austen in 1813) as “the Best of Countries”
Surely it cannot be from being gunned down by polite but heavily-armed Racccoons, while flying over Orange Groves in California
Surely not from drinking anti-freeze so thoughtfully put out be Monsieur Ortem for any thirsty & exhausted Fairies who make it over the Canadian Rockies
Alles Gute
G E
0.0 what the hell? FREAKS >.< GET A LIFE!!
@ANONYMOUS– Are you on a stair?
a bit of paper mashay then ur sorted lol
wow that is bull crap as much as i would like to believe that fairies and many other mythical creatures are real, because i think that would be absolutely awesome, this is in no way real. first of all there is no way that this so called fairies delicate wings could be preserved in such a climate. The body alone would be impressive there is no way they would last. then if by some miracle the wings were in some way preserved the way whoever it is that is handling the body would have broken the wings the way they are carrying it. Third how did the police get a hold of this, it should be in the hands of someone who knows how to preserve and care for such remains, instead of some idiot bobby who only knows how to eat donuts, drink coffee, and through his weight around. I would say this is the result of a photo shop expert.
@Loki– You are mistaken. THIS is bullcrap. Note that bullcrap has no wings, and there’s a big difference between bullcrap and fairies.
uumn you say how can i prove this wrong? well i cant prve it 100% wrong (other than the fact that i believe it has been discouverd to be a prank already) but i can find many holes and lacking evidence e.g how could the fairy have been found so easily in the first place specially if it had been mumified, if it was preservd in some way theres no way it was just laying on the sidewalk the whole time, the man found it walking his dog, i wonder how many other people walk their dog in the same place. second you say bones are similar to birds i wonder how many bones are the same shape and how much of it could have been made out of other material, what type of wings are those? how could they ahve been preserved so well? the mummy looks about as old as real mummies so it must have been spreserved very well, why in that position a difficult position to make air tight and perserve particulary when it cmes to those wings. yeah my heads over folowing with more things wrong withthis article i cant organaise it enough to write anymore down but yeeah yeeeeeeeah
Well, if birds are shaped like that it’s big news anyway. As to how it got there, I offer no hypothesis except the (frankly speculative) possibility that it was disinterred by hostile Meerkat grave-robbers who were interrupted in their dastardly work by the dog-walker before they could make off with their grisly prize.
I think that’s a fake pikture hahahaha!!! sorry but i just don’t believe that’s real… but when i personally think you’re all on shrooms to be seeing faries .. especially you Flower! you have one quit big imagination… but that’s ok kuz i saw faries when i was on shrooms too xD
I personally think all you people are on shrooms if you say you’ve seen fairies hahaha!!!
I think they’re real though! i love mythical kreatures! i wish i was one too!!!
but i think Flower is on something wayyyy different to be seeing a fairy kome into her room every tuesday!! ha sorry Flower!!
But i’ve seen plenty of fairies when took shrooms the first time xD
I wish i had a doll like that though ;D
I’d post that shit up on my wall an fool everyone i know hahahahahahahahahahahahahaha pinchi amber!!!
Wow. This is really quit insane. Highly entertaining but truely insane. Fascinating. I cant believe i sat and read the entire thing! Well done!
Her Grace “…. hostile Meerkat grave-robbers …. ”
The erudite Pixieheart may pretend to a Perseverance and Perspicaciousness beyond her Youthful Years
BUT Are Unicorns and their Tree Oktopodia friends innocent in all this !?!!
BUT what was the involvement of those sagacious RaCoons ???
Im curious as to hold you think i am G Eagle Esq? im thinking maybe not quite as young as what you might beleive. :) dont let the silly name fool you.
I believe that unicorns are not quit as innocent as they would have you believe
Herr Eagle persists in his belief that schools used to teach proper punctuation and grammar, hence his assumption that you must be of a more youthful cast.
As for the involvement of Tree Octopi, I cannot say except to remind everyone that a species pushed to the brink of extinction will do anything it can to survive!
Ahh well in that case he needs to consider the growing laziness of anyone (no matter their age) when typing. I actually rarely ever type out all of my words because it is just easier and I do not like to send an overly long time typing whatever it is im trying to say. I am admittedly a lazy typist. i do see the pion, however, and understand.
that is so photo doctored
it so unusually!!! means on Earth fairies lived once!
miracle!
those are actually pretty cool. i like them. I don’t know why, but they look cool.
Raincoaster! why do you believe this?
is there any proof other than that pikture an that police evidence bag in the back?
kuz honestly in my opinion, I personally don’t think that is real.
I believe in things like this but i think people are tryin to mess with us an pretty much kallin fairy believers IDIOTS!!!!
don’t you think?
yay i have my doubts buti hope its real!!!!
not rather think it is REAL it is like a animal
not rather lie it is FAKE
Your Grace
Ich weiss nicnt was soll es bedeuten,
das ich so traurig bin
Ein Märchen aus urAlten Zeiten,
das gent mir nicht aus dem Sinn
Not only does the Learned Idaly seem to make no Sense
This is very trubblink
…. rather like our Glorious Leader, Monsignor von Braun, explaining to the Long-Suffering Bristisch Electorate -
HOW having got us into such a Mess, we should trust him to get us out of it
all the people who dont believe are,to put it in juvenile terms,demented. The evedience is overwhelming. every civillisation has its own description of a fairy.
Indeed; and you can even buy the body on eBay if you’re still skeptical, and do your own autopsy. What could be more eloquent of confidence than that?
Herr Eagle…does Brown have an alibi for this murder?
I totally believe in fairies, although I know this one is fake. I’ve seen some incredible pictures, and read plenty of stories from my friends claiming they’ve seen one. Raincoaster, please send me all evidence/pictures you have of fairies. That would be greatly appreciated. Flower, Christian, it would be great if you could somehow email me some pictures of Maidor, or that fairy you found at Fox Island.
Anyone else, please send me some info! I love showing my friends this stuff!
Kbocker1@gmail.com
You can no longer buy the body. It was bought for (250?) dollars.
More evidence came to my attention recently. AxeCop knows about fairies and enlisted one for his team. She’s completely awesome.
axecop.com/index.php/acask/read/ask_axe_cop_14
Oh, it’s about time they got their own comics (other than Elfquest). Ask any of my friends: you just do not mess with a fairy!
Of kourse you kant mess with fairies! they might put some evil spell on you xD
That’s right!
Hello everybody,
I have been trying to read this entire posssssst for the passssssst week in-between essssssay writing etc. I almost died from laughter in the processsssss. In fact I am sure that one of my lungsssss sssssssprung a leak from it (you ssssssee I have been hearing a sssssstrange hisssssssing noissssssse whenever I move: the hole in my lung, I’m asssssuming) Well, this is the first comment that I have ever mede on anything… ever. Weird. Never the lesssssss though I must inquire assss to the whereabouts of archie, kssstaff, and philipa. Why have they dessssserted usssss?
Now say that with a lisp.
1812
Your Grace
Once again, I find myself driven by sheer power of rational argumentation to be speculating in similarity to that sagacious Racoom
BUT as the Erudite Turnip most Demented enquires :
Wo ist der AerChie und die kindliche Philippa ???
Ah, my dearessssst Eaglelikeobject
In ansssssswer:
Ich glaube, dasssss ssssie auf dem Blog über Quentin Crisssssp ging!
perhapsssss we sssshould join them?
yourssss mossst ssssssincssssèrement la Turnip
Dear st. turtsS knuB,
how do you know that that wasssn’t ssaid with a lissp and I jussst cannot sspell?
jussst a guessss perhapsss….
:)
ssmiley facsse ri i ight there^
frowzily face right here>:(
ssorry
By the by it isss not my fault, the hissssing, you know, it’sss the hole in my lungsss….
Perhapsss I’m inadvertently dictating for my lungssss?
I’m not sure you’re not transforming into a boa constrictor. You should get that looked at right away. Boa skins are worth a lot of money, you know.
@pinrurT de’mrofeD–
“how do you know that that wasssn’t ssaid with a lissp and I jussst cannot sspell?”
I thuthpected thomething and thimpley guethed.
@Herr Eagle– An Overture is called for.
@rain– Ask any drummer.
sorry raincoaster – just checking comment upload time. Please feel free to delete this.
No worries; I was just thinking about you with this thread: have you noticed, it seems to load a LOT faster.
Dear liquid-precipitationcoassster, Perhapssss you have a point but where would you sssssuggessst that I would go to, asssss you ssssay, get it looked at? Unlesssss of courssssse you are a ssssspecialissst on this sssort of anomaly, in that casssse we could do it right now…
st. turtsS knuB, yesssss just assss I thought. Do you own a cat? If not, would you like one?
If I were you I’d avoid Milan, but otherwise you should be safe. Perhaps the Amazon?
Ahhh, I ssssee, do they have ssswpecialissstsss on thisss sssort of thing there? Perhapsss it some sssort of microbe that doessss it… Oh, dang be back later!
Anyway, before I wasss ssso rudely interupted!
Why ssshould I not go to Milan?
What horrid dissseaessse do you think that I might have!?
How did you get your little photo iconsss?
yourssss ˈtər-nəp’
DT: Milan is the global headquarters for the manufacture of snakeskin pants. If you are morphing into a boa constrictor, it is the LAST place you should consider going.
One has to be practical about these things.
Oh dear, I sssee. Why are you on the internet at four in the morning?
Because that’s when I’m awake, sssssilly.
good god, what are you doing awake at that time?
Blogging, OBVIOUSLY!
Hmm, yeah, fair enough.
Where do you live that it’sss 10:00 right now?
Ha! Lol, this made me crack up at the unreality of “red hair” found. Hair would fall out, you dummy
Well, if it’s dead it ain’t moving around, so where do you think the hair would end up? Eh?
Raincoasssster, why are you ignoring me? Alsso why are there ssssuch long periodssss of time where there issss no one to talk to on here?
Hannah dear, hair doesss not fall out when you die. Mange isss not a ssssymptom of death. Have you never ssseen a real mummy.
My mummy hasss lotsss of hair.
your mummy?
wha kind of mummy? ^-^
an hair does stay on you! they’re dead cells… they kant dissolve or anything like that silly goose xD
“an hair does stay on you! they’re dead cells…”
Unless they’re wild hairs. They can actually get UP IN YOU and make you do all sorts of uncharacteristically impulsive things, and all it takes is one. Be careful with them.
oh my jesus!! really?
wow! never knew that!
…wha kind of uncharacteristic impulsive things would it make you do?
please explain??..
and wha sor of wild hair?
You really didn’t know that? Huh, interessssting, what do they teach in sssschools thessse dayss? Here isss an example of a wild hair and itsss effectssss http://www.proxima13.com/avakassss/pic5.jpg. Note how pssssychotic it looksss. (There isss only one “Sss” in the above web sssite by the way, sssorry!)
Wow, it ssseemsss like I haven’t been here in decadesss.
Where do you people live?
1839
Impulsive behaviour (err .. behaviOr, in the Middle-Colonies Argôt)
…. aMbEr would sympathize with the Camelopards on Senor Bunk’s entertaining Space – they seem rather upset about something
Surely it cannot be the sight of Mr Cameron evicting that pleasant Mr Brown from his Home …..
this is sooo cool where did you find it because in belfast ulster museme there is a mummified person real it is all wrinkly and black
Miz AmBer– To clarify by example, I just got one that compelled me to post a comment here. I suggest googling “1839 camelopard” just to be safe. Herr Eagle is to be complimented for his rare knowledge of [fill in the blank.]
I have no idea what you people are talking about. Everyone knows mummies are terribly hirsute.
cool sooo superly cool
i totally agree wih raincoaster!!!
i don’t know wha you people are talking bout now haha!!!
i’m from tx deform’ed turnip
wha bout you?
thank you bunk strutts…i’ll be sure to check it out
i am beliver real fairies but i am know why god have created with fairies and why i beliver god did created about fairies tales people real world like humanlity,.yeah but i have psyhics vision but i beliver fairies and eleves people have a hide the world but people cant saw at fairies people ,.please leave fairies people alone but do not get hurt body with fairies tales.if god will mad at people but thou shalt not killed fairies people but god have love fairies tales people in the world ..god say people need leave fairies tales people alone. please ….please i saw god finished
co.
So much photoshop, it’s not even funny… ok it’s so funny!!!
Oh, AGAIN with the “Photoshop” cries. Easy to say, not so easy to prove, eh? Or you losers would stick around and offer some concrete proof, which I note you have not.
ok i don’t know wha the hell rebecca just said xD
an that fairy is not photoshopped!
i think it’s fake …but don’t get me wrong i still think fairies are real ^-^
it’s a fucking fetus!!
??? fetus?
Do you know, I think that J.R.R. Tolkien is under appreciated. Does anybody know someone who speaks fluent Elvish… I’d like to learn. I mean I of course can write it but I can speak it.
I think someone is a fetus and nobody has hijacked my lettuce.
I meant “can’t” speak it, of course, my mistake.
@Deform’ed Turnip
Who is J.R.R. Tolkien? Is he in Parliament? Did you vote for him?
that’s definitely not photo-shopped… @}`~,~
Bunk, no he isn’t and yes I did, you shame me.
Well I AM a Dick Licker but also as a Botonist I also recognize those are just last year’s leaves on the back.
Good job on making her look like an alien.
@Deform’ed Turnip– So this Tolkien guy was an important British Earl or Baron or something? Honest question.
@yah right– Hahaha! Another joker in our midst who declares fraud yet correctly identifies the sex of the fairy. Pure awesome, and more proof. Great sleuthing.
Ah hem, not at all, he was creator of the great LotR.
Bunk went to American schools, it’s not his fault he doesn’t know book writers.
@ Deform’ed Turnip — OH! I got it. Is LotR like WoW? I don’t bother with online role-playing games, but knew a kid who played D&D a lot. He was fascinated with sorcerers, fairies, druids, trolls, etc. I guess that’s where the fairy connection comes in.
@raincoaster– Huh? You’re sniping at me? I thought that was Metro’s job. After all, he’s the one who caused the leak in your gin bottle, not me.
I’m not sniping at you, I’m just taking a broad stab at Yankistan, because when have I ever resisted the urge to do that?
Besides, I don’t think Metro can handle his gin. He must have passed out.
There’s a reason why 90% of the Canucks live within 100 miles of the U.S. border: pizza delivery and Molson’s Golden exports. Fact.
Ha! Is that so? Great, I’ll have a large capicollo, feta, olive and mushroom pizza with double mozzarella. How fast can you get it here?
Once I scan it in you’ll have it in seconds. Do you want Meerkat dipping sticks with that?
Absolutely! I LIKE the idea that someone is killing those damn rats.
I love fairies! btw…you guys talk alot. :P
…. and some of us occasionally have a space between separate words
Thanks for that Rain, however I’m not sure his country of schooling is the problem: I went to American schools too… Where do you live? Please tell me. Please. By the way, you don’t happen to speak Elvish do you?
What do you dip the Meerkats in?
Have a pleasant day
No, I don’t speak Elvish. Well, only “menu Elvish” enough to get me through lunch at a pretentious restaurant.
My name is “raincoaster.” Where do you THINK I live?
I dip the meerkats in vats of Goo! Didn’t you see Roger Rabbit?
Rain– Gotta check with Herr Eagle on this one, but Goo was someone very important in ancient hibernia, as the surnames McGoo and MacGoo are very common. That esteemed ancient was very possibly renowned for his excellent meerkat-dipping vats.
Ah, I see. I always thought that Goo might be some Jewish approximation for “God” the way they use G-d. Which, when they do that, makes me think that all the old dead people who wrote those Victorian novels that say things like “G-d d–n his eyes!” were all Jewish. Gee, they really DID control the media back then, didn’t they?
The ancient tribes of Britain were jewish? Oy.
Funny. They don’t look it.
Goo is also a Chinese surname, but they would have likely avoided the place back then, even if they had known about it.
Maybe. But what if they didn’t KNOW they were Chinese?
Did you happen to notice? My birthday’s coming up and this thread needs only 122 more comments to hit an even 2,000. I’m just sayin’!
I can’t believe how many comments you have on this post. Who knew mummified fairy remains would generate this buzz.
Oh, the meerkats knew. But they cannot stop us: free the fairies!
Be careful with that thing! It’s a freeze dried fairy. Add EVO, a bit of rosemary, parsley, thyme, and sage (in that order, the song is wrong) a splash of Balsamic vinegar and a nice Viognier and you have reconstituted fairy. They are mean when brought back.
Maybe the Chinese in question were from Norwegia? They’ve got a nice cruise line, but they’ve got funny names, too, like Úlfr, Auðr and Guðmundr.
Those wings don’t look like leaves at all. No sir, not one bit!
Happy fourth! (It’s the July 5th now where I live, but still the 4th out west I believe …)
Jenny, do you have to reconstitute it in a pentagram, or will a quadrigram do?
Happy 4th/5th/whatever, Mr Hippity.
Bunk, do you mean Icelanders? They have enough on their hands dealing with the resurgent Godzilla, I don’t think they’re behind this.
Here’s a haiku I just wrote …
Two thousand comments:
Raincoaster’s birthday present.
We can do it, folks!
There are Icelanders named Goo? Dang.
You’ll notice that I used punctuation in my haiku. That’s because I strongly believe that haikus should be properly punctuated. In fact, I’ve written more than a few letters to the editor on the topic over the years …
some punctuation
in haikus to editors
gets their attention
Hey, Raincoaster, been a while, how ya doing?
Doing better and better all the time. If I can’t get cash or presents for my birthday, famousnosity is the next best thing!
Goodang is a well-known Icelandic surname, Bunk. I’m surprised you did not know this.
Mr Hippity, I do not involve myself in haiku wars. They can turn ugly in an instant, and those people will never stop until they’ve parsed every syllable of your blog. Fisk has nothing on them, especially the Scandinavian haiku snobs. I am not joking, for once.
It still doesn’t look like Quentin Crisp . . .
This is the most bizarre thing I have ever witnessed on the internet.
images of dead fairies, yeah know you have my attention
Bizarre and gay: the only way it could be more “raincoaster” was if it also had tentacles.
I thought all night Rain and I still don’t know… show me where because I want one, do they have them there? They don’t have them here. Please Rain. Please. Then, maybe I could send you a real Birthday present… Please.
I’m sorry if I am being hysterical, but I spent all night in the rain.
Haha I’m not sure if I should get a sense of sarcasm here or not, but definitely interesting nonetheless, good pictures too, gotta say
1898
Yes, qvite so
Those living to the South of Nootka Sound in the World’s 4th-largest Economy have their own infelicitous animadversion in respect of those poor Millipede=munching Meerkats
BUT
In Polite Society, a GentleEagle does not openly admit to agreeing with your earliest Kommenter’s Observation :
“The Ha! you say. Well, this is certainly unusual to say the least. I think you might be on to something here. So, I say Ha!”
Rather one echoes Virgil’s observation most erudite :
Arma virumque cano
Je reste le vestre Grace’s obedient servant etc
L’Aigle Gris
Turnip, what are you doing in the rain? Don’t you know you’ll turn into soup if you do that?
Loki, welcome. Sarcasm? HERE? NEVAH! And no hyperbole either, never, ever in a million years.
G Eagle you can quite CLEARLY see that the arms on that fairy are natural and dessicated in a quite authentic fashion, for a mummified fairy. Was that some sort of doubter’s crack?
I agree!
Absolutely! There is no room for doubt in the face of such a preponderance of scientific proof!
It would appear that fairie passed away while doing the hokey-cokey or some Neverland-inspired version of the Lindy hop.
It could well be so. They are known to be quite strenuous, and just look at her: she’s no spring chicken!
[...] Comment on this post. [...]
I thought the post with 2000 comments might be some slander about Michael Jackson….is that fairy moonwalking BTW?
One comment closer to 2000 and Happy Birthday Lorraine
I am sorry Rain but I was looking for your house, no luck of course, however- wait… what! Why did you not tell before! I could’ve used some nice hot soup. Fluch meiner unvorbereitetness.
Please Rain.
Maybe we are all the mutant offspring of an alien fairy race.
1907! The comment counter has reached the early 20th century!
1908! The first Model T has now rolled off the assembly line!
1910!
The titanic disaster is just two years away. World War I will start in 4 years.
Raincoaster’s 2000th comment is 90 years away. That seems like a long time …
WordPress just told me: “You are posting comments too quickly! Slow down!”
WordPress is such a nag.
Nag, nag, nag!
I’m headed back to Tumblr ….
Noooooo, don’t goooooooooo!!!
WordPress IS a nag, but at least you can comment on it, unlike Tumblr.
And yes, we are all descendants of a mutant fairy race. There are occasional throwbacks like Katy Perry and Liberace, but for the most part we’ve moved very far away from our roots.
Given that on December 8, 2008 you said “What say we go for two k by the end of 2009?”… it appears we’re falling behind on our duties.
Consider this a birthday nudge towards your goal. We can make it!
I can comment on Tumblr: It sucks. And I’m not even interested in a discussion of Fairy tubers.
VANCOUVER
Rain when is your birthday exactly, I will make sure your get your 2000.
looks like 1 2 many r’s…
Well, bye, 111 minutes past the witching hour so I’m off. Bye.
Finally got this page to load, but what an ordeal.
Tinkerbell is alive and well and living in a hollow Ohia tree here on the Big Island of Hawaii.
But, is she/he an earth fairy — or a galactic fairy? Because, truly, you can’t make any assumptions about the true dimensional origins of anybody/one/thing. Trust me; I have relevant knowledge and experience in matters such as this. All the fairies love RAIN!
Jon: yes, the world owes me. Haven’t I ever mentioned this before?
DT: Well, I do have blogging to do and alas cannot be here 24/7. My birthday is Saturday, so you’ve got till midnight then to push it past 2k.
Richard: your perseverance is appreciated. I believe there is a fairy in your tree. And a gremlin in my WordPress!
Bunk: you must be magical yourself if you can comment on a Tumblr; you surely can’t comment on mine!
Rachel, we do not know, but suspect it is an Earth fairy as it was found near some old mounds in Devonshire, and that would seem to indicate some connection with the Land Underground. Any light you could throw on the matter would be appreciated.
Yes, fairies love rain. Lots of my best friends are fairies, actually.
Totally didn’t read any of this but hope you hit 2,000 comments ;)
The post date is a dead giveaway, but I am still drawn to that dried up little sprite, April Fool or not:-)
Kerry, how could you? This thread has been studied as part of the curriculum at two universities and has been called one of the most beautiful things on the internet! Don’t miss the part where the commenters make dirty puns in Latin!
Cathy, thanks!
Amaaaaazing! I always knew they were real! If you can find the movie “Photographing Fairies” I highly recommend it (Ben Kingsley stars).
Oh, I adore Ben Kingsley. So much so that I sat through Prince of Persia twice. What abs…oh, that WASN’t Ben Kingsley’s character?
Whew, almost there! (hope you get what you want for your birthday….;-)
Thanks! We WILL get there, if I have to register an army of sock puppets!
I’m telling you every time a bell rings a fairy gets its wings, but every time it hears an obnoxious ring-tone it gets a rare fairy tumor and dies mid-flutter.
Perhaps they can extract some of her genetic material and finally get to a cure or at the very least a vaccine for the pan-demic that is Avian Bone Syndrome; then her death won’t have been in vein.
Fairies are absolutely real. I even caught a ride on a fairy last month.
Oh, wait. That was a ferry.
Does that count?
This Saturday, the 10th?
At the rate Harvey Fierstein is going, we may have an American variant of the fossil in a few years or so . . . .
I, for one, eagerly await the rise of Raincoaster’s Army of Sockpuppets. (Which, by the way, would make a great movie title.)
Quelle tragedie que this Extinct Faerie hath not lived long enough to witness that Life is not all tragedy
There are compensations
Middle Colonies 1 Ghana 2
and
Spain 1 Germania 0
Indeed.
Eagle Sir, would you join my quest to post obsessively till Rain’s Birthday?
Won’t be making to your potluck dinner… so here’s your birthday gift! I hope it does make it to 2,000 comments.
Wishing you lots of success, health and love in this new year of life!
1938. http://en.wikipedia.org/wiki/1938
Fairies found murdered in the red barn near meerkat infestation.
BTW, anyone can comment on Tumblr, just not ON Tumblr. 1939.
wow! Those are pretty cool! Reminds of me of the pressed fairy book.
Well my four and six-year-old would believe it in a heartbeat. But then they believe in fairies already. In honour of your bday…
I blame global warming.
LW, so the meerkats engineered a virus that is killing the fairies? THOSE FIENDISH CREATURES! We must spread the word that fairies should practice safe sects!
Alejna, it all counts.
DT, this Saturday, the 10th.
G Eagle, but do fairies play football? Do they even watch? It seems way too macho for them. I would expect fairies to play leapfrog, or chess perhaps.
Bunk, your erudition is, as always, astonishing. Also, thanks for the link on your other site!
FFE, speaking of Broadway, have you met LW?
Guacira, thanks! Now, to create those sock puppets.
Thanks Jessica, Annemarie, and Renee! Much appreciated.
I frikkin’ knew it! Actually, I didn’t, but I’m supporting the 2000 drive anyway. Nice one…
So many questions:
Did she leave a will?
Where did she leave all the teeth?
1942 Renee “I blame global warming”l
1947 Waily, waily
As Eeyore so sagely wailed, I don’t care whom you blame [for the ongoing success of the Great Meerkat Conspiracy], as long as you don’t blame me
Who will take over her route?
How did she get money out of the ATM with those tiny little hands?
And then how did she change the twenties for singles? Because all I ever got was a dollar? :p
Unless….unless she was moonlighting as a stripper?
I must admit I haven’t read all 2000 comments yet, so if I’m asking questions that have already been posited, I’m a stooge.
But Hairy Mo and Surly wants to know.
I blame the Meekrats!
Why must they scurry around timidly in the dark wreaking havoc on the Cheetos?
ONLY 48 COMMENTS NEEDED NOW! 47 after this goes up!
Thanks, guys, I really appreciate it.
LW, I don’t think she could have been a stripper; take a gander at her. She just doesn’t have the body for it, besides being way too old. And no way would her tits have been big enough. I also don’t think fairies use ATMs; don’t they always pay with fairy gold, that vanishes the next morning? (I knew those Comparative Folklore Studies would come in handy)
G Eagle I consider the Meerkat guilt for global warming to be firmly established. We can only await their extortion demands and stock up on snorkels and wetsuits.
Wouldn’t you like to know where her will is… well tough, I promised her not to tell you.
Oh come ON! I know she left me the teapot with Peter Rabbit on it; she told me so!
Just googled “fairy recipes.” Amazing how many people consider them food. I guess I shouldn’t be surprised, as some folks eat unicorn meat, too.
Yeah, well, I got the Peter Rabbit teacup. So, ha. And the Peter Rabbit tea too. Ha, ha.
I’m boycotting unicorn meat; it’s not dolphin safe!
Peter Rabbit tea…which reminds me of a joke. A very long, painful joke.
So this guy, he’s a gourmand. LOVES food. LIVES for food. Thinks Gordon Ramsay doesn’t take food seriously enough, okay? So, basically, guy is food crazy.
Dude comes into a pile of money; seems his whole family is food crazy, and they’re dropping left and right from celiac disease and cardiac infarctions, leaving him all their money. He decides to take a year off and go around the world, seeking out the rarest, most wonderful dining experiences there are.
It goes wonderfully. He’s just finishing up his tour in Malaysia when he bumps into an old friend, and he catches the friend up on what he’s doing.
“That’s awesome!” says the friend. “If you’re hitting all the greatest places in the foodie world, you must have been to Mercy!”
“Mercy?” says the guy, puzzled. “Never heard of it; what’s the story?”
“Oh my god, you’ve never heard of MERCY??? It’s only the greatest gourmet secret on the planet. I honestly shouldn’t have told you but I thought you’d already know. It’s this little town in the Outback in Australia. Look, as you’re such a gourmet, I’ll draw you a map, but if you are captured, you MUST eat it. Don’t worry, the paper is artisanal.”
“Okay, okay,” says Our Boy, intrigued beyond all describing. “I’ll do anything it takes! My trip will not be complete, no my LIFE will not be complete without a trip to Mercy.”
“The town is entirely populated with the greatest chefs in the world who have retired. It’s nothing but restaurants. Brutally expensive, but you look like you can afford it. Here,” says the friend, hastily stuffing a hand-drawn map into his pal’s pocket. “I can’t be seen talking to you after this.”
Well, long story short, our boy diverts to Australia immediately. After six long days at sea in one of those ferries that are always sinking on the news (you’d think they’d know better than to go on the news, it’ll never hold them!) he arrives on the coast, and immediately hires a jeep to take him into the Outback, following the directions on the map. After seven days of driving, they’ve run out of road, and he hires a camel. After three days of camel-jockeying, at dawn he spies a protrusion on the horizon: no, several. It’s Mercy!!!
He spurs the camel into a bone-jolting gallop, arriving just before the dinner hour. He chooses the most imposing-looking restaurant and saunters in, the dust of the trail clinging to his chaps. He’s greeted by the standard-issue stuffy maitre d, and escorted to his table.
Immediately, he is served a refreshing sorbet flavoured with sustainably-harvested dragonfly wings, followed by a flute of Veuve Cliquot 1820. The rest of the meal is to the same standard, course after course of the most impossibly exquisite delicacies the universe has ever seen. Finally, it’s time for the piece de resistance, the grand finale, the specialty of the house. As with each course, it’s a surprise to our protagonist, right up to the moment it arrives at the table.
Or, in this case, the moment after.
The maitre d wheels a trolley to the table. On its surface is an enormous bowl of boiling water, with a burner beneath to keep it burning. Below that are an assortment of strange, non-euclidean vegetables, and something large and lumpy underneath a napkin. The waiter tosses the veggies into the air and the maitre d expertly slices them as they come down, dropping them gently into the pot. Then he grasps the object under the napkin and flourishes it: A large, dead koala bear.
This he proceeds to chop up into bite-sized pieces, every last hair and claw, tossing it into the bowl and stirring it. After a few moments, he ladles out a large, steaming mug of the broth and hands it to Our Guy.
Who looks down into it and sees one of the koala eyes staring back at him, still in its bit of bone socket. He looks up at the maitre d and asks plaintively, “Can you please strain this or something?”
Oh. My. FUCKING. GOD!!! The maitre d draws himself up to his full height and puts a double load of contemptuous French accent on, before replying, “SIR! The koala tea of Mercy is not strained!”
I forget why I was telling you that.
So that’s what happened to the tooth fairy. My parents weren’t cheap and weren’t lying to me after-all.
I bet fairies taste like caramelized kittens.
“2-inch remains”, huh? That’s one tiny scientist, then.
(I also like how they gave it an X-Files alien head)
They are breeding the scientists very small these days, to save on housing and feeding them.
…they don’t have to make the leashes as big either.
Finally, were out of streamlined suburbia.
Your Grace
It is a Truth universally acknowledged that
Canuckistania in tres partes divisa est
1. where Faeries flourish
2. where Tree Oktopodia flourish – but Faeries seem absent
3. an intermediate zone where neither are observed – it’s called Alberta
Es macht man denken, nee
Das ist es, doch
[it maikes yer fink, ugh
This is it, i'n'it]
*GROWN*
My reaction to the PUNch-line of your fantastically told folk tale, and in honor of our Homonymph. Perhaps we should call her Portia? Would it have helped the allusion if you said the chef cut up the Koala and tossed the “pound of flesh” into the pot? All in all, it was quite enjoyable even if I did noticeably age and audibly moan. It is definitely a joke that lends itself to the written word, though I would never be able to re-tell it as well as you did. Well done. Like our Portia.
You may be on to something, could it be she is one of Shakespeare’s Fairies from “A Mid-Summer Night’s Dream?” Titania, perhaps? Could this be the queen? Or maybe it’s Peachblossom or Mustardseed? Who the Puck knows? Are we supposed to imagine old William just made these characters up out of thin air?
And to say she couldn’t have been a stripper, Rain, is really looksist of you. You’ve obviously not spent much time in the fairy porn section of the Pleasure Chest.
I am appalled by the non-believers in this thread. Of course fairies are real. I should know. I AM the Tooth Fairy, just ask my kids if you need proof. I even have a little muslin bag of baby teeth.
Hey, SBC, I remember you. I saw you fly in through my window and take make tooth. Of course, it took you quite a while because I refused to open my mouth…
I’m just so grateful fairies bury their dead in barrows instead of cremating, evidence, I think, that they want to be discovered.
True, however, you’d think that there would be easier ways of alerting the mortals to one’s existence.
Ah yes, Turnip, you were the fiesty little fart who bit me, I almost lost a leg that night. I had to pinch your nose and you turned such a lovely shade of blue before finally opening your mouth.
Rain, what time tomorrow?
SBC, do you still have a scar from that?
That is really cool! That is really, really cool!
I’m very pleased to have read this, as one who often wishes the mythological world of creatures did exist. If fairies is all there are in our world, that’s enough, but maybe they’ll make more discoveries in the future! Dinosaurs existed, didn’t they?
I bet the people in the middle ages and before are definitely not as crazy and delusional as some people think them today. Again, cool article! Good luck on 200 comments. :’D
If only we could harness that power…
Rain, what time?!
Come on people, I don’t want to have to do this alone by posting my darkest secrets! I don’t think I even have 22 dark secrets. Then I’ll have to start posting yours. Where will you be then? Wouldn’t it be easier just to help me out here? Honestly, you don’t want everyone to know about that time… with the meerkats, do you? It’s 10:56 pm. on Friday the tenth of July, what could you possibly be doing other then sitting here helping me out with this? I mean really! God, you’d think you people have lives apart from this. How sad that would be. Perhaps I really am alone. I will do what I can rain, but hey, considering my background, I don’t know how much that is. Night. It has come for m
Is that really fairy remains, or the result of GMO orchids?
Fairy, fairy quite contrary. This post makes me want to reread the Artemis Fowl stories. Hmmm…
Funny, I would have thought fairies would burn their dead on a funeral pyre.
G Eagle; there are a lot of fairies around here. When I canvassed for the census I even found someone who’d put a “fairy maze” made of moss in her front garden. She said the fairies felt comfortable dancing in it because you couldn’t see it from the street (which you could not, it being up several flights of stairs on a very hilly street).
LW, I think you’re on to something. Surely a figure as renowned as Shakespeare would not have just “made shit up.” It’s well-known that Hamlet was based on a true case (even if there ARE no cliffs in Denmark) as was Antony and Cleopatra. That he would simply fabricate fairies is a ridiculous and unsupportable notion. But this cannot be Titania: we would have seen the obit in the Guardian!
Portia is almost completely unknown to me, but I did like her hair at that Oscar party, with all the little braids and things.
SBS, thank you. That should settle the last of the unbelievers.
DT excellent, thank you for the corroboration. But if you’d rather keep your baby teeth than get money, one has to wonder about your motivation!
Lewnna, thanks and welcome. There are plenty of other fairy stories and tall tales around this blog.
Alejna, are you saying there are enough unbelievers that we could make a living at it somehow?
Looks like the meerkats got DT after all, right in the middle of a word. God rest his soul.
Angela, I hated Artemis Fowl. Great premise, badly executed. Of COURSE they made millions from it.
Jon, thanks for the comment. It’s vikings that burn their dead on funeral pyres, and as we all know Vikings were very hard on the original Britons, like fairies.
Portia is the one who first said, “The quality of mercy is never strained.” I had heard she said it to a merchant named Shylock in Venice, but it could have been to a talk-show host named Ellen in Malibu, you know how these things get distorted with each subsequent telling…
Happy birthday to you,
Happy birthday to you,
Happy birthday, dear Rain,
Happy birthday to you.
Sung to the tune of “Happy Birthday to You,” by LW and Portia the dancing Fairy.
(How many is this?)
14 more to go!
Thanks for the translation. Merchant of Venice I have neither seen nor read, for some reason. I’m all about the King Lear; it reminds me of the Orestia and of growing up with my parents.
But there, I’ve said too much.
You’ve co-ordinated this perfectly! Happy Birthday
“Co-ordinated?” or “instigated?”
Only a year behind schedule, we WILL hit 2k, and perhaps yet another university will put this thread on its New Media curriculum.
I notice there is still some activity on this thread. Is it true that the fairy will be revived with a secret recipe based on gin? On her birthday?
Only one way to tell: SEND GIN!
I notice there are commenters who don’t believe in fairies. Yet they believe in me and I don’t even exist!
To comment or not to comment, that is THE question.
*comments*
Happy birthday!!
Ha. My dad was a bit of a King Lear, in fact, King is his middle name, literally, and his last name translates to King in another language, but there, I’ve said too much too. Which daughter were you? The Rain is making more and more sense.
“Rumble thy bellyful! Spit, fire! spout, rain!
Nor rain, wind, thunder, fire, are my daughters:
I tax not you, you elements, with unkindness.”
Happy birthday!
Reminds me when I was a kid and used to roll rubber glue until it got all dirty, dark and tacky then shaped around the head of my gnome head with the bright orange hair. It was the top of my pencil. I know, what an abstract memory!
Well darn, my fairy cake photo didn’t appear in that last comment…
http://azahar.files.wordpress.com/2010/07/fairycake.jpg
I know a bank where the wild thyme blows,
Where oxlips and the nodding violet grows,
Quite over-canopied with luscious woodbine,
With sweet musk-roses and with eglantine:
There sleeps Titania sometime of the night,
Lull’d in these flowers with dances and delight;
And there the snake throws her enamell’d skin,
Weed wide enough to wrap a fairy in
And so the end is here
It’s time to face the final Eagle
God: welcome, nice to see you in the hood.
Cat: thank you! A Shakespearean reference as well, bonus points!
LW, what was your dad’s name, Raj Khan? That is one kickass name. A friend of mine, of German-Canadian extraction chose a hippie name of Shahee because it meant Prince in Urdu. Didn’t realize it meant Martyr in Arabic until the US deported him! Did you know they make you pay for your own ticket?
L Billings as a fairy abuser, you obviously have a large karmic debt, which can be repaid by helping this post get to 2000 comments.
Az, thank you! That’s probably as close to a birthday cake as I’m going to get this year. Have been on a restrictive diet, and most of my friends are more savory cooks than sweet cooks.
Archie, Thanks. Gosh that’s terrific. You’re really talented; have you thought of writing plays or something?
Oh archie-dude, “Weed wide enough to wrap a fairy in”.
Such divine imagery.
Chill out – bud soaked gin – what a birthday.
2001? Always a day late and a dollar short, but happy birthday nonetheless!
Thanks, God and FFE. Probably the only time you’ll see those two conjoined.
Yay! I can now enjoy my birthday knowing it’s started off on the right foot for sure!
Peter gave me airline bottles of JD, Johnny Walker Red, Bombay Sapphire, and Bacardi, plus a Strongbow. And since I’ve been off booze for more than 2 weeks now, and I am having a beverage-primary potluck later today, Sunday I can already see is going to be a writeoff. Yay for medically-induced days off!
M.O.V. is very good, if not the tiniest bit racist.
I misspoke before in that the Merchant is actually Antonio and Shylock is the Jewish loanshark who lends Antonio money but demands a pound of flesh if he defaults. Which he does.
Portia, the princess, dresses up as a man/lawyer to save the day when her love Antonio cannot re-pay and Shylock wants his flesh, she points out that the “quality of mercy is not strained,” and that by saying nothing about Blood in his contract, he can’t take the flesh unless he can do it without spilling a drop of blood, which of course he can’t. And then she forces him to convert to Christianity.
So it would’ve been a bit “Victor/Victoria”-ish with a boy playing a girl playing a boy back in the day, it’s all very scandalous on a lot of levels, as only Bill can be.
So there is my tale for your birthday, there is a good film version with Al Pacino & Jeremy Irons if you ever get the time away from your keyboard. There’s a lot more to it, so I haven’t ruined the whole thing.
Somehow, Fairy crossed to Mercy.
Indeed I have considered writing a play.
The plot is based on the memories of a ghost in a Scandinavian castle who dresses up in tree branches and whispers lies into the ears of the king about the behaviour of his beloved wife. Three witches tell the king his fortune but he doesn’t realise that they are his daughters.
It will be a winner!
Just because I’m an agnostic doesn’t mean I preclude the existence of a central force or entity. Have a gimlet for me.
2006
Happy Birthday
It is most gratifying that even that non-existent God can be numbered amongst your Grace’s Commenters
Yat, yoo mde itrain, hapybirthdas/y o yu congsra
sorya buot my mesedup comnent sbut m’i stil in pan frm my afor menteiond atak so it hrd tp typ.
b haPy bitdy rai n i’l sing yo a sng n a secnod
This thread has become a living monument to the internet existence of it’s myriad participants.
Belated happy birthday to Rain
(waves to “God” – hello God!)
Most terribly sorry about that, looks like those posts came out worse than I thought. Meerkats did not treat me nicely this second time. Anyhow: [sing to tune of happy birthday]
Hippo, birdie two ewes,
hippo, birdie two ewes,
hippo, birdie dear raincoaster,
HIPPPO BIRDIE TWO EEEEEEEEWWWWWWWEEEEEEEESSSS!
*insert me clapping and screaming in your direction, here*
Hey you all know that theory of apocalypse that supposed to happen in 2012, well next comment is 2012 so beware before you post it…
Crossing the Mercy is always to be recommended, if only as an excuse to listen to a great song.
Sounds like neither Shylock nor Portia knew about liposuction, though. Ah, schools back then were not what they are now.
Archie, can you work a talking donkey or vampire into it? They are all the rage.
FFE, I will have to wait till the grocery stores reopen, but shall obtain many limes the instant they do.
G Eagle, never underestimate my reach!
DT, whatever you’re drinking, I hope someone brings it to my birthday potluck!
KStaff, great to see you again. I had some JD and thought of the Derby two years ago…one day we have to go to Hastings Park. Sadly, they have no wifi!
So, we’re friends because you have the same sense of humour as my husband? I’m sure he’s told me that Quality of Mercy joke. He’s got others, you should compare notes!
(I think I’m #2013!)
Hmmm, Perhaps.
wow – looks convincing but I am no believer…
Lori, of COURSE he’s told you that joke; he stole it from me! And the Roy Rogers/Dale Evans joke? Also mine. I once got $20 NOT to tell that joke. It’s even longer than the Mercy one.
DT you haven’t met Mr. Lori.
Leeann, stick around. We shall convert you yet!
I haven’t, I’m sure it would be my pleasure.
I’ve changed my mind.
Over 2000 commenters have to be in collusion, and I’m not one to follow the slavering hordes, regardless of how popular their ideas might be.
The meerkats had it right after all — fry up the little petulant dusty bastards and eat ‘em with Dijon and scallops, especially on one’s Birthday, and you too may enjoy farting pixie dust for days to come. =)
Can somebody please tell me what my problem is?
DT
Just think
If there is an Answer,
there must be a Qvestion
@Deform’ed Turnip: Yes.
I do believe in fairies. I do! I do!
I do believe in fairies. I do! I do! I do!
However, I don’t believe in dead fairies as when fairies die they just fade away to nothing. Everyone knows that.
i beleve in fairys no matter what anyone says i will beleve in fairys for the rest of my life.
and i beleve that, that pic is real.
2024
I flatter myself that I agree with Bambi on so many things
….. apart of course of whether that Kindly Christian the Ruddmonster should have been consigned to political oblivion and the Governorship of Western AustrAAAlia by a member of the Monstrous Regiment of Women
rhaps we could compromise by appointing him to the late John Buchan’s old Job
BUT Senor Bunk seems to be maintaining a Racoon-Like Sagacity by giving us only part of the answer to that perceptive Vegetable’s Qvestion
The Roy and Dale joke about the puma? I thought you stole that from me. Doesnn’t matter, though. I stole it from someone else . . . . .
Bunk: aha, a traitor in our midst! I knew they’d get you: first the Republicans, then the meerkats. Richard Nixon and Dubya were well-known meerkat fanciers.
DT: No.
somethingsthat, that is a completely unsubstantiated claim, and we will have none of those around these parts. We are entirely scientific!
Bambi: wow, I didn’t know deer could type!
G Eagle is it really possible to “banish” someone to obscurity who’s already in…you know…Australia?
FFE: I think we stole it from the same guy.
Yeah, me!
What a shame, I was hoping… oh well.
2028
Ja, ja, bestimmt
The way of the Plant (or Republican) is commonly not felicitous with all these Herbivores (& Democrats) about
BUT
Do not despise the Snake
Who knows
…….
She may grow into a Dragon
Das ist es, doch
FFE– Don’t ever joke about pumas. They’ll kill your career, or worse. Roy and Dale are no longer with us, precisely because they joked about pumas.
rain– Au contraire. I re-perused the entire thread and realized the true nature of those little cutesy sparkly cretins. Take the tooth fairy, for example. She rewards tots with money for losing teeth. The loss of teeth is then equated with wealth. Stay with me here.
When I was a young whelp, the Tooth Fairy gave me a dime, or sometimes a quarter for each tooth, and back then, a quarter could buy a lot. Now comes inflation, and I imagine the TF is paying around ten to fifty clams in 2010 dollars for each tooth lost. Little kids are learning that they’ve got a mouthful of unearned wealth, and all they have to do is mine the gold.
That’s right. Little kids have figured out that they can cash in their teeth to purchase that Blackberry or X-Box that Daddy won’t, and they can do it with a screwdriver and a ballpeen hammer knowing that Daddy WILL pay for remedial dental work. Ever see a little boy or girl with a chipped tooth? Guess who’s behind it.
Fairies are pure evil.
TEETH are evil. Ask any old wise man; he probably got rid of his long, long ago.
Hear, hear, one of mine is getting ready to fall out right now.
Good riddance.
How much did you make????
Well, it hasn’t fallen out yet.
Hmm… Looks like a foetus, wrapped in leaves to me.
Derbyshire, by the way, despite being my favourite county by a country mile, isn’t lacking when it comes to new-age fruitcakes. Hence the “fairy” I suspect.
Ron,
England.
New age? Doesn’t she look ancient to you, Ron?
Ron, don’t make jabs at a woman’s age, every man should this.
You know, I envy your life, Rain.
DT, are you sure? Rabid Michael Jackson fans and mummified fairies: it’s not all plugins and SEO you know!
Oh come on Rain, that’s the best part, especially diced, dry-roasted, infused with gin, and served on your best china with mint sprigs. Hervorragende!
So, yes, Rain, of course I’m sure.
is that the mummified fairies, or the Michael Jackson fans? Who would be, I guess, sort of mummified fairy fans if you think about it…
or would it be rabid Michael Jackson fairies?
He didn’t seem to attract many fairies. He preferred to capture young human children and convert them.
You know, it would be quite easy to do the moon-walk if you could fly.
Maybe that was why there was such an increase during his lifetime…
*Turning up VOL. on Wanna Be Starting Something*
La la la, I’m not hearing you, (but song seems fitting).
Cordially,
Michael Jackson MUSIC fan.
I know that’s about as popular as saying you’re a Roman Polanski fan, but hey, love the art, hate the artist. And so it goes. I think Rodin was kind of a pig too. Bacon (Francis, not Kevin) married a 14 yr-old girl and cheated on her with young boys, but somehow in the 16th century that was okay. He’s grateful he pre-dated TMZ.
I would have to agree with Timethief in that this is one of the most bizarre things I have ever seen on the internet… photo-shopped exotic scenes notwithstanding. lol
With Love and Gratitude,
The Intentional Sage
Well, finally the evil thing has fallen out.
Fallen out of where? What has?
What I want to know is, what happened to my comment? I put one there day before yesterday and it’s gone!
My mouth. My tooth. I’ve no idea, but it probably would’ve given me something better to do.
If you can’t find it, you can’t get any money for it, even if the tooth fairy IS alive.
Who said I couldn’t find it?
I’
m
so
LOL so fucking stupid. i mean you look at the pic and instantly think its real just cause there is a prop bag that is labeled police evidence. (which in fact is not a real evidence bag either.i would know;) and O…M…G like totally guess what!? Anyone can by latex gloves. if you notice in top image. the left hand lower arm bones are incorrect. if it were true then teh fairy would have been like popeye with HUGE fore arms. wing span can not support the mass weight of the body and if this was legit and this thing has been dead for long enough for it to be like this and mummified then the bottom right wing would be able to be bent and reflecting light as it is. DEF a good prop! movie set worthy. though dont be stupid.
@will–
Okay. Let’s parse this a bit. Only two words in and you drop an immature and unnecessary f-bomb, and it’s not even used in a complete sentences.
You’ve penalized your argument by arbitrarily ignoring capitalization, while at the same time you demonstrate that your caps key has not been removed and swallowed by snakes.
Grammar, I’ll give you the benefit of the doubt as you are obviously typing under serious duress.
You’ve blindly stumbled into several years of careful debate and research, yet you claim to have it all figured out without reading any of the scientific analysis provided by Ms. Raincoaster and others here for your free education on the topic. I suggest you take advantage of the offer of knowledge, and I’ll even spot you three points for reading the following:
1. Popeye was not a fairy.
2. Bumblebees do not have the wing area to support their mass either.
3. Anyone unable to comprehend the simple rules of the employment of apostrophes in sentient writing has no point of view worth serious consideration and their argument is null and void upon posting.
Now please explain how you got your blog commenting license. It’s intuitively obvious to the casual observer that you didn’t pass the test.
@will– Now tell me which letter doesn’t belong in the comment above, and I’ll give you extra credit for effort.
Your Grace
2059
Will “…. Anyone can by latex gloves …..”
Yes … but not all of us can SchPell or Kapitalyse
HOWEVER
while I flatter myself that this Eagle agrees with that Sagacious Racoon [Monsieur Str] on so many things
… apart of course on whether California should be allowed to repudiate its Debts and then become a Canadian Dominion, as an alternative to sacking the whole of the State’s Fire-&-Rescue Service
What do Bumble Bees have to do with Deceased Fairies ???
AND surely the Conoscenti [pronunciated "Konn-o-Shenty] should be comparing the fate of this Poor Fairy with that of Mr Liberaci
The Ha! you say. Well, this is certainly unusual to say the least. I think you might be on to something here. So, I say Ha!
G E
Bunk, as you can see DT has established something of a tradition of misplaced single letters. Not to worry; you are culturally congruent in the thread, as is our miscellaneous, ungrammatical hater who knows (from personal experience?) what a police evidence bag looks like.
GEagle, I believe the Conn O’Sennie are the Little People of Cork, but I could be mistaken. It might be Galway.
Bunk: *Clap-Clap-Clap-Clap*
You left out one thing: In trying to kill our buzz, you, Will, have inadvertently served up a round of Jello-Shots to everyone. La Chaim! And whenever I personally entertain the notion that my mind is a stressful place to be, I will disabuse myself of the urge to reach for a Prozac and instead think of how much worse it could possibly be. Thank you for that.
Now, I’ve had a particularly horrid day, I got into a car accident with a “tourist” who SLAMMED on his brakes while cutting me off in the middle of a green light crossing Sunset blvd. I was totally set up, and it’s going to be my fault. So please, I’d love to hear your thoughts on the Easter Bunny, I really need a pick-me-up.
lost weeknight– “Totally set up” happens frequently in So. Cal., but it doesn’t mean it’s your fault. Let the insurance companies argue that. As for the Easter Bunny, when he/she/it presents his/her/it to well-meaning parents, serves primarily to propagate head lice and tooth decay in small gullible children.
Oh, and Herr Eagle, the plutocrats of our once prosperous state know that scaring the C and D students with the fear of losing police and fire protection is one tactic to help them confiscate more hard-earned money from a financially strapped population. Progress from Progressives…
PIMF… :(
I was going to say,”I’m so very alone on this forsaken blog.” but I seem to to have wrongly estimated it’s forsakeness.
Nice to see you all…
Bunk: Yes I’ve turned the matter over to my insurance company and tried to let the whole thing go, but I’m hemorrhaging money this month with my little sister getting married so it couldn’t have come at a worse time. Thank goodness no one was hurt, so maybe my guardian fairy was looking out for me after all. But if you’ve ever seen one of those exposes on rear-end set-ups, this was it, right down to the rented Hyundai.
As far as the Easter Bunny, don’t go all Glenn Close on me, who else is going to hide my eggs?
You lay eggs? Holy shit, I bet people would pay a lot of money to see that! You might even get on Oprah!
As for me, it’d take an awful lot of beer to get me on Oprah. I don’t care how wealthy she is. Just thinking about it gives me the willies…
Oh, wait, you’re talking about her show, right? Nevermind. Tell her to call me.
Hey rain, I think you put ratings on your blogs.
Bunk, what’s wrong? Don’t you like cougars?
DT I didn’t put them there, WordPress did.
Oh no! Rain, someone came and destroyed your poor blog, it’s all ugly now. How sad, maybe you should give some strong gin to cheer it up. Maybe then it will be pretty again.
Same thing happened to planetross’ blog. WorpDress strikes again.
I kind of like this theme, but it’s only temporary, till the HTML errors get straightened out.
Where the HELL are my pingbacks? I had pingbacks from UNIVERSITIES on this thread!!!!
Yes, muuuuch better, swirly deformed fish designs, much more fitting!
I myself was believing of fairies depending on some facts.anyway, better you do more reseaches and make us: fairy fans known of that fanastic reality.
this is soooooo fake!!!!!!!!!!!!
those wings would have been long time gone. it would have disintegrate, same as that little body!!
I thought I had made it CLEAR that unsubstantiated claims of that nature were not welcome here. This is a fact-based blog, and we demand proof of statements such as that. When you can offer proof, then we’ll talk.
It has been too long…
What is the white backdrop? The Kitchen counter?? Ewww, creepy :(
a sheet of crack…
Of course it’s an autopsy table, duh!
RKO Pictures presents “The Thread That Wouldn’t Die,” starring Claude Raincoaster, Vincent Price, Tinkerbell and a cast of thousands, coming to a drive-in near you.
Hey Bunk, sounds like fun. Where was Vincent Price?
He played the Theremin.
Vincent Price played the Theremin? He may indeed have been the perfect man.
so fake, everyone knows Fairies are brunettes, not redheads….
Silly person! Most of the fairies I know are blond!
Fake blond or frosted tip.
Highlights, baby! Full foil!
Woah, this discussion is giving me new ideas on how to spend time productively, thanks guys!
*And if you didn’t figure out yet, I am being sarcastic!*
No problem, dude!
You get so much love Raincoaster, so much love. I feel very jealous. I’m not sure if I actually am, but I feel like I am. Well, see you are loved but there is one crucial thing that you are missing in your life that I have, so I’m not sure how jealous I can be…
By the way, Merry Monday the 25th of October at 6:00 (that’s 225101800+)
Hope you enjoy it!
There we go again.. *rolling my eyes*
Well, since jealousy is a feeling, if you feel jealous, you are jealous. Glad I could clear up your confusion there.
If you know what’s missing in my life, why don’t you pack it into a box and mail it over?
(Pssst — Deform’ed Turnip — Think gin — at least a case.)
(Pssst — Rain — If it shows up, you owe me one.)
I’ll save you a bottle.
Since when was a tithing of 10% a bottle? Eh. I’ll take what I can get.
A case is 12%, so I’ll save you a bottle and a double. Rocks?
So I just googled ‘Gin Mummy’ and wound up here…deal me in.
Cheers!
Rain, I think that would be illegal, considering what it is.
Besides Bunk, I couldn’t give it to the poor thing anyway, I wouldn’t know where to send it… Oh well.
I’ll get a PO box.
A case is 12%, so I’ll save you a bottle and a double. Rocks?
Yeah, that definitely rocks. Email it to me straight.
Hmmmmmmuuuuuhhhhhhmmmmdadadadaddaaaaaaaaaaahhhhrrrrrrgggggghmmmmmmmmmmyeah… I spose thadl wurk jusfine… Alternatively, we could meet up in a dark alley and have a massive party.
Nah, I’ll just drink it myself.
Dang! That’s uh…Coast2CaostAm worthy. I’ll give them a call.
On a more serious note you have the most unusually interesting blog
that I’ve ever encountered. It really is a thing of beauty …
You’re awesome rain …
By all means, do. I’d love to get on radio.
And thanks. I do try.
I do believe they did exist at one point in time or another, for nothing is “really” impossible. we just like to declare it so. but we as human beings do not know everything, and I’m sure for good reason. our father has made many wonderful and beautiful creations throughout his everlasting existence. who are “we” to decide what is real and what is not…
OMG, we have a Logical Positivist Christian among us! I never thought such a thing could exist! Was sure they were entirely imaginary, just symbols for the repressed desires and fantasies of a constricted culture.
Thank you. A million times, thank you.
[...] Mummified Fairy Remains Seriously… I think… [...]
I want to know how to make one or get one for my daughter she loves fairys and while that is fake, I would like for her to have something to believe in while she is still young enough to believe..so any info you could give me would be great:-)
Color me crazy, but I don’t think is a great idea to give your child the mummified remains of a fairy to play with… [somewhere a Fairy is screaming]
Well, I think it’s something like the neo-primitive Goth appeal of Jack Skellington. Tim Burton has a lot to answer for. What ever happened to Barbie? She’s outsold by Zombie Death Metal Barbie nowadays.
Those crazy kids!
[...] Dont’ ever try this unless you can handle it as well as raincastoer does. If you click this mummified fairy remains link there are over 2,000 comments so it will take awhile to [...]
Fast fey to hear with one twinkle of my fluttering wings – tis nearly the magic day again – comment baiting indeed. I doff my little green cap to you Raincoaster – what a ride :)
One thing I’ve always wondered: what would happen if you spent the night of March 31/April 1 INSIDE a fairy ring inside a pentagram? Is that how changelings get born?
I think my mind just exploded.
[...] Rain is also author of The Longest Running Thread. Four years, and it’s not dead [...]
AAAAAUUUGH! Doesn’t anyone read the thread before commenting?
[Okay that was a non-sequitur melt-down just for the hell of it.]
Not too many people, it would appear.
Not too many people, it would appear. Including me.
rain– I’d thought you’d have the entire thread memorized by now.
Not quite. Up to the Latin bits, yes, but after that it gets a little fuzzy.
bwahahahahahaha. oh that’s funny! I JUST saw this post. wow I’m def late but … nice.
I think they’re real. You guys are so negative about things and never seem to have an open mind. Some life you guys have…
[...] engaged commenters defend you while you sleep. Commenters like that are a treasure. I use the Mummified Fairy thread as an [...]
“…. fuzzy”
Your Grace
Is this the effect of GIN ……. or its absence ?
Yr obedt servant etc
G E
Its absence, obviously. I’m going to be lamentably sober up here in the barren lands, because a bottle of decent gin is $40. I’m FAR to cheap to pay that!
FIRST!!!
doh.
Ha! You win the internet today!
Fake i call it fake it tooks like you took butterfly wings and some small bones to create it stupid -_-
Looks like Mr. Crankypants hasn’t read the thread. Krato, you only have a few weeks left to catch up before you have remedial English homework to do again. :P
Sigh. The n00bs. The st00pid. It burns!
Unarmed spambot sighted. Incoming at 23:00.
That one of juan cabanas works… He even inclued cut out from the news papers with every fairy,mermaid and monster he makes
WHERE IS YOUR PROOF????
I’ve had just about enough of these semi-literate, baseless allegations.
Fake and gay
The wings are obviously leaves…
More desperate, baseless allegations offered up by the hordes of anti-intellectual yobbery.
Evidence, or STFU!
i love the detail – like the forearm with a ‘little meat on it’ like a chicken wing – also – I loved the evidence bag and ‘official looking’ latex gloves too -
ok who believe dis one ?
Obviously, about 700 people, or didn’t you read every single comment?
raincoaster,
Why have you chosen that name? Why have you chosen the blue eye? Why have you chosen to talk about the fairies?
Life is amazing and mysterious. Most humans in this era has lost the hidden truths and little remains of the truth. Hold on to it, dont loose it!
I should do a post about why I have chosen this name/eye. And yes, live is as you say. I read a great saying earlier today “The path to success is never a straight line”. So true.
I think faries are real i have since i was two im not stoppin now :)
Raincoaster i hope people can still be nice and respect other peoples beleifs my mom always says if you don’t have any thing nice to say don’t say anything at all
If I only said nice things or nothing at all, there wouldn’t be 4200 blog posts here for you to read, would there?
no there would’nt but people should atleast be a little bit more nice
Priorities, my young friend! If there weren’t bitches like me in the world, people would take your niceness for granted, instead of treasuring it like they should!
ok thanks for calling me nice other people think im mean
Those people haven’t met ME!
Oh, dear, did someone just empty the manure spreader right on top of Chuck Darwin?
what dose that mean???????????
hi im melony and in 11 and i wanted to know if the fairys r symbole fo the earth or ellaments and if its posible we can become 1
No, you can’t become a fairy. Fairies, like angels, are magical beings and a very different species from humans. Some people think you become an angel when you die, but that’s not true: you become a ghost or you pass on. You don’t turn into an angel. Angels and fairies are immortal. If you want to learn more about fairies, read old Irish legends. The Irish know a lot about fairies, even more than the people in Devonshire.
OhH! thAt wOuLd bE TinkErbeLL haha..
OMG you really ARE dead????? I thought we saved you!
HEY!!!!!!!!!!!!!!!!!!!!!!!!! HOW ARE THE FARIES :):):):)
DEAD!
Obviously!
Well I’m from Greece and the Greeks aren’t fairy believers of that kind. I recently saw a documentary about it. We believe(d) that fairies are in the size of a human, without wings and mostly female. Well what can I say? Every nation has its folks and myths. If half of the Greek myths were for real, our nation would definately have been extinguished by all of our mythical creatures!! I do like fairies though ;)
hhhm ? why its hair is look like not mumyfied for so many years?
Look up mummy hair; it looks just like that. We here at the ol’ raincoaster blog are entirely fact-focused and have no truck with the hypothetical.
*trying desperately to think of a comment that has not already been made to show thanks for entertainment*
You should write a post listing the top 10 comments from this post. You could then pingback each, create a vortex, and take down the internet.
I especially liked the 30 referrences to the validity of the evidence bag :-) Thank you for making my day.
This is a brilliant plan, and I will implement it ASAP! I will even write you a nice thank-you note from the yacht I’m going to buy with the money I”ll earn with the Ad Control program.
WIthout thinking I hit reply and then waited for five minutes for the page to load :-)
Oops – this will be my last smiley face.
And I tried to respond to this while aboard a BC Ferry and crashed the entire wireless system. So much for working while en route.
Then it has begun…
Narf!
[...] studied as part of the New Media curriculum in three universities, and the comments thread on her Mummified Fairy post has been called “one of the most beautiful things on the internet.” She once got into a [...]
I had missed the Albania post – remind me to never piss you off.
I may just have to take the week off and settle in to read everything on your blog.
Ha! Thanks. That reminds me to put the Randomizer back in the sidebar. Some people love just hopping from one post to another randomly.